Summary diagrams for a2
0 likes141 views
This document defines key terms related to ecology, including abiotic and biotic factors, producers, consumers, decomposers, niches, food webs, succession, sampling methods, and population estimation techniques. It discusses various abiotic factors like temperature, light availability, and water that influence organisms. Biotic factors include predation, competition, and disease. Sampling methods are described for estimating populations and community characteristics, including quadrat sampling, transects, and capture-mark-recapture for animals.
![55
Individuals can only have two copies of a gene and thus two alleles that may be the
same (homozygous [dominant or recessive]) or different (heterozygous).
However, there may be more than two alleles of a gene, like blood groups, which
have three alleles IA
, IB
and IO
.
IA
, IB
are codominant whilst IO
is recessive.
Thus there are 6 possible genotypes and 4 possible phenotypes shown in the table
across.
Monohybrid crosses: A simple breeding experiment involving a single characteristic
Test cross: you can see a phenotype but not the genotype. If a person shows the recessive trait, they must be homozygous for the characteristic, but showing a dominant trait
they could be homozygous or heterozygous. You can find out which by breeding the unknown with the homozygous recessive.
If all the results are dominant, then the parent is likely to be homozygous dominant. There may be some doubt as it is possible that the random nature of fertilisation has just
resulted in the dominant allele being passed on, so a large offspring number can help increase the certainty.
If the results are mixed then the parent must be heterozygous
How genotype controls phenotype
Genes are lengths of DNA that code for proteins. It is the proteins that control phenotype as enzymes, pumps and hormones and structural elements
Sex determination
X and Y chromosomes are non-homologous and are called Heterosomes, whilst the other
22 pairs are autosomes.
Males = XY Females = XX
Sex linked characteristics
The Y chromosomes is small, containing few genes and does little else than determine
sex. The X chromosomes is large and contains 1000s of genes. Females have 2 X
chromosomes whilst males only have 1 copy, so the inheritance of the genes on the X
chromosome is different for males and females, hence this inheritance is sex linked.
An example is colour-blindness where XR
for dominant, normal colour vision and Xr
represent colour blindness. See diagram on the right.](https://image.slidesharecdn.com/summarydiagramsfora2-181205082543/85/Summary-diagrams-for-a2-55-320.jpg)
Summary diagrams for a2
- 1. 1
- 2. 2 Abiotic factors: the non-living/physical components of the environment (temperature, light, soil pH) Light intensity: affects plants only Carbon dioxide concentration: affects plant populations only Mineral ions: affects plants only Water availability: affects both plants and animals Temperature: affects both plants and animals Abundance: counting the number of organisms in the sample. Usually the abundance of each species is recorded. If we divide abundance by size of the sampling area we get the density (number/m2 ) Autotroph: an organism that can trap an inorganic carbon source using energy from light or chemicals Biomes: parts of the atmosphere that have very different environmental conditions to each other. Biosphere: the parts of the earth that support life. Then organisms of the biosphere depend on one another and the earth’s physical environment which consists of the…. Biotic Factors: A living factor that affects a population or a process (predation, competition, parasitism, disease) Carrying capacity: The highest population that can be maintained for an indefinite period of time by a particular environment Climax community: the final community in succession Community: all the populations of different species that live and interact together in the same area at the same time Competitive exclusion principle: when two species are competing for limited resources the one using the resources most effectively will eliminate the other. Two species can’t occupy same niche indefinitely when resources are limiting Consumers: an organism that obtains energy by eating other living things Decomposers: live in the soil (generally) and feed on detritus, dead, decaying organic matter. There are two groups, the detritivores and the saprobionts/saprophytes. Detritivores: organisms that feed on dead or decaying organic matter Ecosystems: an area within which the organisms interact with each other and their physical environment Detritus: dead or decaying matter Ecology: the study of interrelationships between organisms and their environment. The environment includes both abiotic and biotic factors Ecosystems: An ecosystem is a self-supporting system made up of all the interacting biotic and abiotic features in a specific area. Ecological niche: the position an organism fills in its environment, comprising its habitat, the resources it uses and the time at which it occurs there Environmental resistance: conditions that reduce the growth rate of a population Food webs: a diagram showing all the feeding relationships in a single ecosystem or community Gross primary production: the rate at which chemical energy is stored in plants Habitat: the place where an organism is found Inorganic fertiliser: a fertiliser containing inorganic ions such as, nitrate, ammonium, potassium and phosphate ions. Intraspecific competition: between members of the same species Interspecific competition: between members of different species Limiting factor: the one factor of many that affect a process, that is nearest its lowest value and hence is rate-limiting. Microhabitats: an area within a habitat that has specific conditions Net primary production: the energy that remains after the energy used in respiration has been subtracted from the gross primary production Organic fertiliser: a fertiliser containing organic substances such as, urea. Omnivores: animals that regularly feed at both primary and higher trophic level. Pioneers species: species which are first to colonise cleared or disturbed ground. Primary succession: succession that occurs on previously uninhabited ground Population: a group of organisms of the same species that live together in the same area at the same time Producers: an organism that uses solar energy in photosynthesis to produce carbohydrates Pyramid of numbers: A diagram that shows the number of organisms at each trophic level in an ecosystem/food chain at a given moment irrespective of size. Pyramid of biomass: A diagram that shows the total biomass at each trophic level in an ecosystem/food chain, at a given moment, irrespective of the numbers Pyramid of energy: A diagram that shows the energy transferred to each trophic level of an ecosystem/food chain in a period of time irrespective of the numbers and biomass. Richness: number of different species found in the sample Saprophytes/saprobionts: microorganisms (fungi and bacteria0 that feed through extracellular digestion, secreting enzymes onto organic matter and absorbing the soluble products into their body to use in respiration (releases carbon dioxide to the environment again for use in photosynthesis) or to use in assimilation building new cells (biomass) Secondary succession: succession that occurs on in a place where there was some vegetation already present and the area has been disturbed by natural disaster or by deforestation etc. Succession: the process by which a community changes over time, a directional process where organisms affect the environment making it less suitable for themselves and more suitable for the next dominating species. Food chains: A very simple diagram showing how energy flows through an ecosystem Trophic level: the position in a food chain at which an organism feeds
- 3. 3 Random sampling: to get a representative sample of the whole area. Area is divided into a grid using measuring tapes; random numbers are generated (from tables, calculator, computer) and used as co-ordinated to place quadrats. There should be a large number of samples to be representative, allow for anomalies, and improve reliability and to allow statistical analysis. One should aim to sample 2% of the total area. Systematic sampling: used when you wish to investigate an environmental gradient (change across a habitat). Commonly this uses a transect. In the line transect the organisms touching the string are recorded. In a belt transect quadrats are placed at along the transect (it can be continuous, or interrupted, where quadrats are placed at regular intervals). Measuring Abiotic factors: usually requires digital equipment, temperature probe, pH probe, light meter. These give quick, calibrated, quantitative accurate data and can be used to record data at regular intervals or continuously across a time period Abiotic factors: water/air temperature, pH, turbidity (suspended solids), oxygen levels (air and water), mineral levels in soil and water, soil depth, texture, wind speed and direction, humidity Quadrats vary in size 10cm, 50cm, 100cm sides are common, and they may be subdivided into 25 or 100 squares. To find the best size quadrat nesting is used. Different sized quadrats are used and the number of species counted. From the species area graph the most appropriate size quadrat can be identified that is likely to catch all species but not waste effort. Quadrats are used to get quantitative data like… Density: number of individuals of each species in quadrat divided by area of quadrat Species frequency: record the number of quadrats within which the species was found e.g. 12 out of 40 had a species so, frequency was 30% % cover: useful when difficult to identify individual plants. Estimate to nearest 5%, the % area of the quadrat covered by a particular species, easier when quadrat is subdivided, this is subjective though. Abundance scale: ACFOR, Abundant, Common, Frequent, Occasional, rare. Not quantitative, but can be made semi quantitative by making each point (ACFOR) correspond to a % cover range
- 4. 4 Sampling animals is made more difficult by the fact they move. So traps need to be used Sweep nets in long grass and crops to catch insects, standardise the sweeping time height to allow comparisons Beating trays: used to get invertebrates from trees. Tree is hit with a stick and invertebrates fall into a tray Pitfall traps: smooth sided cup buried in ground, a raised cover keeps out predators and rain. Used to catch invertebrates Longworth traps: To catch small mammals: prepared with dry bedding and food; placed randomly in the area. Animals enter and trigger the door to close, they are safe from predators Capture – Mark – Recapture: the problem with counting animals is getting a good estimate of the total number in the area; they move quickly, they cover larger area and they try to remain hidden. So the capture, release, recapture method is used 1 Capture a sample of animals using one of the trapping techniques described above. The larger the sample the better the estimate works. 2 Count all the animals in this sample (S1) and mark (using one of methods below) then so that they can be recognised later. Typical marks include: a spot of paint for invertebrates, leg-rings for birds, a shaved patch of hair for mammals, small metal disks for fish, etc. Larger animals can also be “marked” by collecting a small blood sample and making a DNA fingerprint. Ensure marking is not harmful to animals, or prevents reintegration to the population or that it will wash off, or that it makes them more susceptible to predators. 3 Release all the animals where they were caught and give them time to mix with the rest of the population (typically one day). 4 Capture a second sample of animals using the same trapping technique. 5 Count the animals in the second sample (S2), and the number of marked (i.e. recaptured) animals in the second sample (R). 6 Calculate the population estimate (N, the Lincoln-Petersen Index) using the formula: Assumptions Marking does not affect their survival Capture of marked and unmarked animals is random Marks are not lost Animals mix with population again randomly and completely There are no massive changes in population size between sampling s1 and s2 due to reproduction or migration/immigration, population thus remains stable between samples Animals are not trap happy or trap shy Limitations Animals must be captured which can harm them or alter behaviour steps taken to minimise this. Marks can be lost Marking could affect interaction with population after capture ‘Catchability’ of animals can vary with season, time of day, life stage, but assumes equal ‘catachability’. Immigration/emigration/migration/birth and death issues can be overcome by having a small delay between sampling N = population n1 = number first caught and marked n2 = number caught in second sample m = number in second sample that had markings Marking techniques: A spot of paint for invertebrates, leg-rings for birds, a shaved patch of hair for mammals, small metal disks for fish, etc. Larger animals can also be “marked” by collecting a small blood sample and making a DNA fingerprint. One new solution is to mark with an ultra-violet marking pen which can’t be seen undernormal sunlight, but can be seen under ultra-violet light.
- 5. 5 Succession: The change in a community over time due to changing environmental (abiotic) and biotic factors conditions. This change in plant life is often quite predictable until a stable climax community is reached. Primary succession: when succession begins on an area that has not been inhabited previously (a slow process) Secondary succession: occurs on previously inhabited areas (farm land left to re-grow, forest areas devastated by fires or floods). It is faster as the soil is already in place. The key idea is that each species of plant changes its environment to make it more suitable for new species to colonise. Consequently, these initial species are often out-competed as the new species are usually more sophisticated and bigger. As the succession proceeds the habitat becomes less harsh and abiotic factors less hostile. Daily temperature fluctuations decrease due to shade, water holding capacity of the soil improves due to an increase in organic matter, nitrates in the soil increase, roots help hold soil together minimising erosion, As the plant life becomes more diverse the animal community becomes more diverse as there are more food sources, more niches, habitats. The climax community supports a complex food web. Early colonisers, pioneer species are fast growing plants, with shallow roots and wind-dispersed seeds being replaced by taller, slower growing plants with deep roots and animal dispersed seeds. The change occurs in stages called seral stages. The initial habitat is very harsh…. Extreme pH High winds Lack of minerals Lack of water Temperature fluctuations High salinity Pioneers are organisms adapted to cope with these extremes Lichen, algae and mosses The action of pioneers and successive species alters, pH, builds a simple soil, add minerals to this soil by death and decomposition, improve water holding capacity Lichen: fungus and algae mutualistic relationship. They are excellent pioneers because Fungus: can make minerals available form rock (acidic secretions) and decomposition of organic matter. They prevent desiccation of algae and anchorage to the rock Algae are photosynthetic providing sugars for the fungus. Describe and explain how succession occurs: Colonisation of area by pioneer species; these organisms changes the environment; this enables new species to colonise; Repetition of this process results in the environment becoming less hostile, biodiversity increases, providing food, habitat, nesting sites and niches, Eventually a climax community is reached (Human activities: ploughing, harvesting, animal grazing, burning, may prevent the development of the climax community and result in an artificial or Plagioclimax community)
- 6. 6 Bare rock Pioneer community Legumes and horse tails Grasses and ferns Small trees and shrubs Climax community Barren land develops: Fire, flood, deforestation, glaciers retreating, volcanic eruption, silt and mud deposition. Hostile (abiotic factors): pH, salinity, wind speed, nutrient levels, temperature fluctuations, water availability Chemical and physical weathering allows slow soil formation Pioneers must have adaptations to tolerate harsh abiotic factors: xerophytes, fast seed germination, low nutrient requirements, able to fix nitrogen, produce lots of seeds or spores (germinate fast and can tolerate acid soils, waterlogged soils) Lichen good pioneers mosses grow on top. They trap debris and increase organic matter through death and decay of themselves and detritivores forming a simple soil. Some free living nitrogen fixing bacteria may be present in soil. Nitrogen fixing bacteria (Rhizobium) found in root nodule of these plants and can fix atmospheric nitrogen allowing these plants to grow in a simple soil with lower nutrient levels. Their activity and death increases soil depth and nutrient quality. Increase in organic matter (humus) improves water holding capacity of soil and root growth aerates the soil and secretions change soil pH. Previous species (pioneers) have improved soil depth, quality (nutrients, pH, oxygen levels) and water holding capacity. Taller plants shelter soil reduce diurnal temperature variation and desiccation Pioneers can not compete and die out. Animal diversity and nesting increases Biodiversity increases rapidly due to hunting mating and nesting sites these birds bring in seeds. More niches are available, greater variety of habitats and food sources. Biodiversity may be greatest here before the dominant species of the climax community takes over and out competes many species. Nutrient cycling, light, temperature water availability of soil changes dramatically. Leaf litter may alter the soil pH significantly Interspecific competition leads to a reduction in biodiversity. Number of species and their populations will stabilise limited by…. Nutrient availability, light, number of producers, disease killing weak member sof species, predation, intra and inter specific competition. This is the most stable community with more complex food webs and a change in one species does affect others as greatly as other food sources exist. Succession: early pioneer species change the habitat making it more suitable for those that replace them in next stage. As it progresses biodiversity increases, as nesting sites, breeding sites, habitats, food sources are more varied and stable as abiotic factors are less harsh.
- 7. 7
- 8. 8 So why conserve a forest ecosystem. Trees available as a sustainable resource; Maintain habitats / niches / shelter; Maintain diversity / avoid loss of species / protect endangered species. Maintain stability (of ecosystem); Maintain food chains / webs / supply of food; Reduced loss of soil / erosion; Reduced flooding; Act as carbon sink / maintainO2and C02 balance reduce greenhouse effect Reduce global warming; Source of medicines; Examples of sustainable management and reasons to preserve the indigenous species of a habitat…. 1. Protection of habitat: maintains food sources, nesting sites 2. Legal measures like e.g. quotas, hunting bans: prevents populations falling to dangerously low numbers 3. Capture/culling of non-native species: these can often replace/kill off indigenous species 4. Captive breeding: to boost numbers of populations and ensure members of species are together at most fertile time 5. Surrogacy / artificial insemination / genetic manipulation techniques; 6. There may be cultural and aesthetic reasons for conservation and a link to tourism and the economic benefits to economy. 7. Possible undiscovered benefits where some genes may provide medicinal products or characteristics for biotechnology. 8. Maintaining genetic diversity for future breeding programmes. 9. Avoid damage to food webs and it helps control local pests. 10. Ethical reasons, taking into consideration other organisms have occupied the earth longer than man and should be respected One key area of controversy is deforestation. This is essential for building material, paper, farmland, urbanisation, fuel. However, it leads to many problems 1. Soil erosion/ mud slides / flooding / leaching of minerals – trees no longer protect soil from rain / from wind / roots no longer hold soil; 2. Increased CO2 (in air) OR “greenhouse effect” – trees remove CO2 in photosynthesise, the large scale felling of trees and subsequent decay or burning releases CO2. 3. Less diversity– loss of food / loss of habitat / niches 4. Changed rainfall patterns / drought – less transpiration from trees; 5. Loss of pharmaceuticals / ‘medicines’ / timber / ‘wood’; Conservation: the concept of preservation/maintenance of biodiversity, through sustainable management of resources to maintain forests and the habitats/niches and food they supply that ultimately maintains biodiversity. Biodiveristy includes…genetic diversity (variety of alleles), species diversity (variety os species) and habitat diversity (variety of habitats) So the aims of conservationa are to: 1) maintain diversity 2) maintain organisms’ habitats Effective conservation does nto eman leaving the environment untouched, which would lead to a small range of climax communities, instead it requires active inetervaention to manage succession and maiantain a wide range of plagioclimaxes (false climax communities), some techniques for this intervaention Thinning of woodland to ensure light reaches the ground encouraging shrubs and wildflowers to grow. Hedgerows maintained in farmland, providing ecological corridors for animals to move between areas, nesting sites, food sources, habitats for insects that may be natural predators of crop pests Grazing by animals, maintains grassland but prevents growth of tress and shrubs Periodic burning to remove saplings and allow fire resistant heather to thrive Cutting back reeds that dominate and dry out fenland, pump water into the fenland to keep it waterlogged
- 9. 9 Decay/decomposition/rotting/putrefaction: is the breakdown of detritus by organisms collectively known as decomposers. There are two groups of decomposers 1) Saprobionts (previously called saprophytes): these are microbes (bacteria and fungi) 2) Detritivores: small invertebrates that eat detritus Saprotrophs/ saprobionts Use saprobiotic nutrition, extracellular digestion They secrete digestive enzymes Absorb the soluble products Use these in aerobic respiration Release carbon dioxide Some of the bacteria have cellulose to break down plant fibres. Herbivores depend on these in their guts. Other enzymes like deaminase help with the ammonification process in N cycle. In terrestrial environments the main saprobionts are fungi. Fungi are composed of long thin hyphae that grow throughout the soil giving a large SA:VOL . In aquatic environments the main saprobionts are bacteria Detritivores: Use holozoic nutrition Ingest food, digest it in a gut, absorb soluble products and egest waste. They speed up digestion by helping the activity of saprobionts by…… Increase surface area of detritus for saprobionts Tunnelling activity: aerate soil, provides oxygen for saprobionts to respire aerobically Excrete useful minerals (urea) which saprobionts can metabolise (iii) Explain the role of bacteria in making carbon in dead plant remains available to plants. (4) decomposers/ saprotrophs; release enzymes and digest detritus/extracellular digetsion absorb products of digestion/ suitable e.g. that relates to these are respired and CO2 released; CO2 diffuses in through the stomata used by plants in photosynthesis/ enters leaves; What is the importance of decomposers to the producers? (1) Supply of inorganic molecules / e.g. CO2 / nitrate / phosphate / minerals;
- 10. 10 Describe how the carbohydrates in the dead leaves in the beech wood would be recycled by the activity of detritivores and microorganisms and the carbon dioxide made available for plants. (7) Detritivores break leaves into small pieces / increase surface area; Deposit faeces; Increases rate of microbial action; Bacterial fungi decompose / break down leaves or organic matter; Secretion of enzymes for digestion; Absorption of sugars; Respiration by detritivores/ microorganisms; Release of carbon dioxide; Carbon dioxide used in photosynthesis; The level of carbon dioxide in the atmosphere (0.04%) remained constant for millions of years Most carbon dioxide removed in photosynthesis is balanced by respiration Some was diverted for longer periods of time in carbon sinks Fossilisation Biomass (trees and animals) Dissolved in oceans Incorporated in carbonate based rocks The balance has been skewed due to the industrial revolution and changes to meet human population increases as outlined below Combustion of fossil fuels for electricity and heating Deforestation for farm land, communication networks, housing, shops Increased acidity rain from combustion led to chemical weathering Rising global temperatures led to less carbon dioxide dissolved in the oceans Less trees means less carbon dioxide fixation in photosynthesis The levels of carbon dioxide in the atmosphere fluctuate as rates of respiration and photosynthesis vary. Daily variations: Lowest carbon dioxide in the day when photosynthesis is taking place Highest at night when only respiration is taking place in both animals and plants Seasonal variation: Lowest CO2 in summer when days are warmer (enzymes), brighter (light intensity), longer Highest CO2 in winter when days are cooler (enzymes), shorter, lower light intensity and tress lose their leaves less photosynthesis. Also increased combustion of fossil fuels to cope with cold winter The concentrations of carbon dioxide in the air at different heights above ground in a forest changes over a period of 24 hours. Use your knowledge of photosynthesis to describe these changes and explain why they occur. 1. High concentration of carbon dioxide linked with night/darkness; 2. No photosynthesis in dark/night / light required for photosynthesis/light-dependent reaction; 3. (In dark) plants (and other organisms) respire; 4. In light net uptake of carbon dioxide by plants/plants use more carbon dioxide than they produce/ rate of photosynthesis greater than rate of respiration; 5. Decrease in carbon dioxide concentration with height; 6. At ground level fewer leaves/less photosynthesising tissue/more animals/less light The carbon dioxide concentration was monitored at ground level in the centre of a small roundabout. The measurements were made on a summer day. Describe and explain how you would expect the concentration of carbon dioxide to fluctuate over the period of 24 hours. (5) 1Higher carbon dioxide concentration at night/during darkness; 2Photosynthesis only takes place during light; 3Photosynthesis removes carbon dioxide and respiration adds carbon dioxide; 4Respiration taking place throughout 24 hours; 5Quantitative consideration such as that in plants overall photosynthetic rate greater than respiration rate; 6Human effect such as additional carbon dioxide from heavy daytime traffic/street lighting could prolong photosynthesis; Carbon source: ecosystem releasing more CO2 than it accumulates as biomass. Carbon neutral ecosystems fix and release equal amounts of carbon over time Carbon sink is an ecosystem accumulating more carbon biomass than it releases, occurs when decay is prevented, peat bogs too acidic, ocean is cold and anaerobic, growing forests as trees grow and live long lives.
- 11. 11 High frequency/shortwave solar radiation pass easily through the earth’s atmosphere Some solar radiation is reflected by clouds Greenhouse gases: CO2 (69.6%), CH4 (12.4%), N2 O (15.8%) Earth surface absorbs the solar radiation and heats up emitting long wave/low frequency infrared radiation Infrared radiation does not pass easily through the greenhouse gases and is absorbed and re-emitted. This was how earth stayed at ambient temperature Crops Higher/lower rainfall or higher/lower temperature may result in failing crops/plant life causing a change in the distribution of plant life and hence animals dependent on them. There may be changes in the type of crop that can be grown, no longer possible, now possible. Higher night temperature will affect the ability of some crops to set fruit or seed giving lower yields and less seeds for next planting. Warmer/shorter winters and warmer longer summers may allow pests to survive longer or appear in greater numbers than before, causing extensive crop damage, thus increase expenditure on pesticides. Melting polar ice caps cause loss of fertile low lying land (Nile delta). May lead to destruction of forests to provide farm land and as consequence this only adds to the issues. Rising sea levels due to melting of ice shelves and glaciers and thermal expansion of the ocean means salt water is extending further up rivers making soil salinity increase affect water availability for crops and irrigation difficult. Selects for xerophytes and changes biodiversity of the animals feeding. Animal Migratory birds are not travelling as far south as they would normally and are migrating north earlier. This means that food sources may mot be ready yet, plants with day length dependent flowering are not yet in bloom and as a consequence seeds, fruit and insects may not yet be abundant. As air temperature rises the Alpine snow line is rising. Animals that live on or above the snow line are forced to move with it and are forced in to smaller areas. This increases competition. Those that can not move up (higher altitudes less oxygen) also face extinction. Disruption of niches available within a community. Each organism is adapted to a particular niche and, as these change so does the species distribution. A niche is the place or function of an organism in an ecosystem. Organisms compete for a niche. If there is a niche for a flying organism that can feed on nectar, and carry pollen this can be filled by a bird, insect or mammal. Global warming forces migration and thus they compete for the niche and may displace indigenous species. Loss of glaciers and ice melting earlier affects hunting of Arctic animals; they must take longer riskier swims. Water As ocean temperatures increase less carbon dioxide can dissolve in them so this furthers the problem Increased evaporation leads to increased cloud cover, more solar energy reflected and the temperature could decrease. Others Ice albedo effect reduced. (albedo is a measure of how strongly an object reflects light). Ice reflects almost all the suns energy that hits it (important in maintaining global climate). As polar ice melts more energy is absorbed by the earth. Positive feedback loop. Increased extreme weather events Alteration to the timing of seasons Advantages Growing in regions that had previously been too dry of cold Growing seasons are prolonged so greater yields Higher carbon dioxide and temperature faster photosynthesis (limiting factors) Causes of greenhouse effect: combustion of fossil fuel, deforestation (reducing photosynthesis, decay/burning of trees releases carbon dioxide), agriculture (methanogenic bacteria in rice fields and ruminant intetsines) has led to mass increase in cattle rearing and rice fields to meet food demands, landfill sites have these bacteria too.
- 12. 12
- 13. 13 Dead/waste (urine) organic matter Ammonia NH3 Ammonium Compounds NH4 + Nitrites NO2 - Nitrates NO3 - Ammonification by Decomposers: saprobionts with extracellular digestion secreting proteases to form amino acids and then deaminase enzymes (removes amino group) ultimately leading to ammonium ions Water Nitrosomonas Nitrobacter Nitrogen Fixation: reduction of atmospheric nitrogen by free living soil bacteria (azobacter/clostridium) to ammonium ions, this is then passed through nitrification. Symbiotic organisms (Rhizobium) found in leguminous plants using an enzyme system Nitrogenase. This provides the plant directly with ammonium compounds, so nitrification does not follow, plant can assimilate ammonium compounds more easily than nitrates, but cannot absorb them in the soil, hence need for nitrate formation Bacteria get carbohydrates from the plant Bacteria that fix nitrogen are called Diazotrophs N2 + 6H 2NH3 (requires nitrogenase enzyme and 15 ATP molecules) Active uptake and assimilation Denitrification: occurs where there is a lack of oxygen in the soil leading to more anaerobic denitrifying bacteria, pseudomonas and thiobacillus Nitrification: Oxidation of ammonium compounds by these two different strains of nitrifying bacteria. These bacteria are chemoautotrophs: they gain their energy by the chemical oxidation (chemo) of ammonium compounds and use carbon dioxide to synthesise organic compounds. Autotroph means they do not depend on preformed organic material. This oxidation reaction is exothermic, releasing energy which bacteria use to make ATP instead of respiration. Mineralised nitrogen: Nitrogen as inorganic ions/nitrate/ammonia / nitrite Excretory nitrogen: Nitrogen in waste products of metabolism/urea/uric acid /ammonia Organic compounds containing nitrogen: Protein/amino acid/nucleic acid/ATP / urea;
- 14. 14 Substances found in fallen leaves contain the elements carbon and nitrogen. Explain how the activities of decomposers and nitrifying bacteria recycle the substances in fallen leaves for re- use by the trees. (7) A question asking about making carbon available and N available again for the trees, so answer both parts…. Carbon available because…… (Decomposers/saprobionts): Secrete enzymes (extracellular digestion) These enzymes hydrolyse organic matter; the soluble products are absorbed by named process e.g. diffusion/active transport; these products are used in respiration Releases carbon dioxide; Carbon dioxide used in photosynthesis; N available again because saprobionts release ammonia from organic material; Through action of proteases and deaminase enzymes (Nitrifying bacteria):convert Ammonia nitrate; Via nitrite An oxidation reaction Nitrates absorbed and used in synthesis of amino acids/protein/nucleic acids/other correct organic –N; Sources of ammonium compounds: 1) Decomposers (mainly saprobionts) convert (nitrogen in organic compounds) into ammonia/ammonium; 2) Nitrogen fixing bacteria: Convert nitrogen (gas) into ammonium; adding usable nitrogen to an ecosystem. This is a reduction process. This can be done by free living soil bacteria, the ammonium compounds must undergo nitrification then as plants cannot absorb the ammonium but can absorb nitrates. In N fixing bacteria associated with root nodules the plant uses the ammonium compounds directly. Nitrification: (Ammonium) nitrite; then Nitrite nitrate; by nitrifying bacteria (Nitrosomonas / Nitrobacter respectively) this is an oxidation reaction
- 15. 15 The law of diminishing returns: the increased application of fertiliser does not increase yield and so becomes uneconomic Eutrophication: the main cause is leaching of fertiliser from farms and sewage form houses and factories. Nitrate and phosphate concentration are the biggest limiting factors to grow of aquatic plants. Algae grow fastest, and this results in the algal bloom. Farming practices disrupt natural mineral cycles. Minerals taken from the soil by plants directly and animals indirectly are not returned. So the soil depletes of minerals. Plant growth is limited by mineral levels, particularly, NPK. So the problem can be tackled by… N fixing crops: crop rotation that includes leguminous crops one year of 4. The clover is then ploughed back into the soil. Clover will add humus to soil, nitrates (needed for protein synthesis), it is cheap, releases it minerals slowly causing less run-off and pollution. Inorganic fertilisers: soluble artificial fertilisers containing NPK. Organic fertilisers: natural fertilisers, animal manure, composted veg, sewage sludge. The also contain NPK, but in organic matter, urea, proteins, lipids and organic acids. These minerals must be released by decomposition. A combination of both the types of fertiliser maximises productivity. Considerations needed as beyond a certain point addition of fertilisers will have no further increase on growth so is an unnecessary expense. A Balance between increase in yield and profit against cost of buying and applying fertiliser. Fertilisers often contain Nitrogen/ Phosphates/ Potassium: 1) N = protein synthesis 2) Phosphates = help production of DNA, RNA, NADP and ATP 3) Potassium = Proteins synthesis, chlorophyll production (magnesium important here too) Explaining eutrophication Increased phosphate/nitrates causes algal bloom; algae (cover surface and) block out light; Plants (under surface) unable to photosynthesise; They die, and algae die (due to minerals now depleting) Algae are too numerous to be eaten by their consumers they accumulate Sudden increase in detritus (plant & alage) Increase in (aerobic) bacteria (decomposers); Bacteria use up oxygen in water; (high BOD) In respiration; Other aerobic organisms die, Anaerobes thrive releasing H2 S, CH4 , NH4
- 16. 16 Agricultural ecosystem Agricultural ecosystems are comprised largely of domesticated animals and plants used to produce food for man. There are considerable energy losses at each trophic level of a food chain. Humans are often third or even fourth in the chain. This means the energy we receive from our food is only a small proportion of the total energy available from the sun. Agriculture tries to ensure as much of this energy as possible is transferred to humans (effectively it channels energy away from other food chains and into the human food chain) this increase the productivity of the human food chain. Productivity Productivity is the rate at which something is produced. Plants are producers as they produce chemical energy from light energy in photosynthesis. The rate at which the plants assimilate this chemical energy is called gross productivity (measured for a given year and expressed as KJm-2 year-1 . Some of this chemical energy is used by the plant in respiration, so the remaining chemical energy is the net productivity and this is available to the next organism in the food chain (not all of this energy passes to the organism due to, indigestible and inedible parts) Net productivity = gross productivity – respiratory losses Net productivity is affected by two main factors 1) The efficiency of the crop carrying out photosynthesis, maximised by reducing the effects of limiting factors, carbon dioxide, light, temperature, water, minerals. 2) Area of the ground covered by leaves (photosynthetic organs) The two major differences in this system are 1) Energy input: naturally the sun is the only source of energy input. The additional energy input in the agricultural ecosystem is required for preventing the development of the climax community and also maximising the growth, Energy is required in ploughing, sowing crops, removing weeds, suppressing pests and disease, housing and feeding animals and transport etc. 2) Productivity: Natural ecosystems have a low productivity. The additional energy input to agricultural systems is used to reduce the impact of limiting factors. Energy used to exclude other species reduces competition and the ground is almost completely covered by the crop. The application of fertilisers and pesticides and disease prevention help increase productivity.
- 17. 17 Explain how farming practices increase the productivity of agricultural crops. 1. use of Fertilisers contain minerals NPK (added to soil); 2. Nitrate for proteins and phosphate/phosphorus for ATP/DNA; 3. Pesticides/biological control prevents damage/consumption of crop; 4. Weed killers/herbicides remove competition; 5. Selective breeding / genetic modification (of crops); 6. Glass/greenhouses enhance temp/CO2/ light limiting factors 7. Ploughing aerates soil to improves drainage; 8. Ploughing aeration of soil allows nitrification/decreases denitrification; 9. Benefit of crop rotation in terms of soil nutrients/fertility/pest reduction; 10. Irrigation/watering to remove limiting factor; 11. Protection of crops from birds/pests/frost by covers/netting etc.; Describe and explain the effects of monoculture on the environment. Removal off hedgerows; since small fields impracticable for large machines; so soil more exposed to wind; resultant increase in soil erosion (once); so reduction in diversity; since smaller variety of niches/habitats; since smaller variety of producers/plants also, deeper rooted plants removed; resultant increased soil erosion (once); increased risk of large-scale crop failure/increased disease/increased number of pest; since large numbers of same crop species grown close to each other; increased use of fertilisers result in eutrophication/damage to soil structure; reduction of gene pool increases susceptibility to disease Pests spread more rapidly Productivity: the amount of biomass produced by that ecosystem in a year measured either as Biomass: Kgm-2 y-1 Energy: MJm-2 y-1 Gross Primary Productivity (GPP) = amount of energy fixed by producers in photosynthesis and stored as chemical energy in glucose Gross Secondary Productivity (GSP) = amount of energy absorbed by secondary consumers But energy losses as heat from respiration, indigestible parts of food, uneaten parts of food etc. means not all energy is available to the next level in the food chain, so…… Net Primary productivity (NPP) and Net Secondary Productivity (NSP) is the amount of energy accumulated in producer or consumer biomass and available to the next trophic level Net productivity = Gross Productivity – losses due to respiration and heat. NPP gives us an indication of how good the ecosystem is at fixing solar energy Productivity is of interest to farmers who wish to maximise the NPP (arable farms) NSP (pastoral farms). So intensive methods are employed to improve productivity, such as….. Genetic engineering Selective breeding Fertilisers Pest control Factory farming herbicides Large fields Monoculture Mechanisation Some increase gross productivity (fertilisers) while some decrease respiratory loses (factory farming) The cost of sheds, heating, machinery, producing fertilisers demand energy and are costly, so the gains must outweigh the cost Factory farming/intensive rearing of livestock: increasing NSP Animals are kept indoors for part or all of the year, usually at very high density. The barn is kept warm by the collective body heat of so many animals in close proximity, and in very cold conditions buildings can be heated (though this costs the farmer). Less energy is lost as respiratory heat, so increasing NPP. In addition, animals can’t move much, so they don’t expend energy in muscle contraction. More of the food they eat is converted to useful biomass rather than being lost in respiration. Animals are given specialised, high-energy food, high nutritive value so animals grow quickly and can be sold sooner. The food is low in plant fibres (cellulose), so it is easy to digest and less energy is wasted in egested faeces. The food also contains mineral and vitamin supplements that the animals would normally obtain from fresh food and exposure to sunlight. The dense packing of animals makes it easy for pathogens to spread from host to host so animals are given antibiotics to mitigate the effect of infectious disease. Antibiotics also increase growth rate by killing intestinal bacteria. Animals are selectively bred to be fast-growing (see unit 2), and they are slaughtered before growth stops in adulthood, so more energy is transferred to biomass thus, the farmer doesn’t waste any food, and earns profit early. These methods are costly. Intensive farming depends on high levels of inputs to achieve high productivity. But the gains in productivity should exceed the. Factory farms produce large amounts of animal waste, which often pollute surrounding water ways. Factory farming also raises many ethical questions about the welfare of the animals.
- 18. 18 Explain how the use of pesticides can result in resistant strains of insect pests. 1. Variation/variety in pest population; 2. Due to mutation; 3. Allele for resistance; 4. Reference to selection; 5. Pests with resistance (survive and) breed / differential reproductive success; 6. Increase in frequency of allele; The same idea could lead to herbicide resistant weeds Pests are any organisms that damages farmers crops Pests: they reduce the yield in a variety of ways They include: weeds, fungi, animals Weeds: compete for, light, minerals, water carbon dioxide. They are usually fast growing compared to the crops establishing roots and shoots quickly and out- competing the crop. Insects reduce yields by….. Feeding on the organ of the plant that forms the crop Feeding on the leaves and reducing surface area for photosynthesis Feed on the roots and affect mineral uptake Feed on sugars in the phloem Spread disease Control can be cultural, chemical or biological. Modern practices try to combine all three in integrated pest management Pesticides: These include herbicides, insecticides, fungicides and bactericides. Characteristics of pesticide: selective toxicity, kill specific target, thus they need to be narrow spectrum (more expensive). Broad spectrum pesticides may kill pollinating insects and useful predators of the pest. Biodegradable: broken down by decomposers. Persistent pesticides may accumulate in the food chain (bioaccumulation). Particularly if fat soluble, not excreted form the body like water soluble chemicals. Chemically stable to have shelf life. Insecticides: can be contact, remaining on the surface of the crop and only killing insects that come in contact with it. Systemic insecticides are absorbed and transported through the crop and kill any insects that feed on the crop Easy to apply, and applied in a way to minimise damage to surrounding environment Cultural control Practices that reduce pest problems without using chemicals or biological agents. Provide suitable habitats close to crop for natural predators of the pest Weeding: removal of weeds and diseased crops Crop rotation: breaks the life cycle of host specific pests Intercropping: planting two crops in the same field rye grass and wheat encourages ladybirds to feed on aphids on wheat. Tilling: ploughing to turn soil burying weeds and expose insects to predatory birds Insect barriers: sticky bands on fruit trees to catch crawling insects Beetle banks: strips of uncultivated land around and within fields. This allows invertebrates to thrive that may predate a pest. Regularly monitor the crops for early signs of pest problems Principles of Biological control: controlling pests using other living organisms (predators, pathogen or parasites). Examples: The scale insect destroyed citrus trees, controlled by the ladybird beetle, ladybirds controlling aphids on wheat The control organism can be a predator/parasite or pathogen Specific to the pest The population of the control organism varies with that of the pest, both should eventually become low The control reduces the size of the pest population below the economic threshold, to a point where it no longer causes significant economic loss However, it does not eradicate (kill all) the pest The control species must be carefully selected/screened to……. Target only the pest species To ensure it too does not become a pest Survive in its new habitat to establish and maintain its population Can reproduce It is active during the growing season and when pest is a problem Ensure it does not carry disease Ensure that a new pest will not take over that niche Trials should be carried out in quarantine before being brought to farm Herbicides Weeds are plants growing where they are not wanted; they compete for resources and can harbour pests and disease that affect the crop. Crop seeds are treated with fungicides before sowing Advantages of biological control If well screened it will only target pest Self-perpetuating population (one application needed) No chemical residue left on the crop Pest won’t become resistant to control agent Cheaper (saves cost of repeated chemical use) Continuous control Disadvantages of biological control Doesn’t eradicate the pests Expense or setting up due to research May becomes a pest itself if no natural predators (must be well screened) Slow acting compared to chemicals Subject to environmental factors Possible effects on non-target species Can’t be used in stored grain or dead bodies will accumulate in produce Another Sterile males of the pest could be introduced to reduce success of reproduction Pheromones could be used attracting the pest to devices that destroy them
- 19. 19 Integrated Pest Management (IPM) Brings together all forms of pest management, aim to reduce effect of pesticides on the environment without compromising the maximisation of crop yields. There are 4 stages Identify pests and population density at which they cause economic harm (economic threshold) only act when population exceeds threshold Use suitable cultural methods to avoid population reaching threshold If population exceeds threshold use biological control to reduce it If biological control fails to reduce population use chemical control at low and controlled levels and at times of year to minimise impact on the environment Evaluate the effectiveness of each stage before proceeding to next Benefits If one method fails others are still partially effective Reduced amount of pesticide needed Increase yield Reduced chances of resistant species developing Less impact on food webs Fewer chemicals used Long term effect rather than the initial improvement seen by chemical methods alone, but loss in effectiveness over time and the need to reapply chemicals Biological control Farming aims to maximise yield and minimise expenditure and impact on environment. Essential to meet the growing needs of the human population. It uses many practices Selective breeding (pg27): for fast growing animals, high yielding crops, reduce allele frequency, genetic diversity Factory farming (pg52): restricted movement and warm holding sheds (more biomass less energy waste), specialised diets high in protein and fat and carbohydrates, low in cellulose so high digestibility. Antibiotics in food, reduce spread of disease, kills gut bacteria increasing growth rate. Monoculture (pg52): growing one crop that grows most effectively in the area. Reduce labour, more than one crop per year, but demands a lot of fertiliser. Requires, hedgerow removal to make more space for growing and to operate machinery. This reduces diversity due to loss of habitat and food sources, possibly lead to increased pest issues as predators of pest may have lived in hedgerows Pesticides (pg53): weeds and animal pests are controlled using chemicals, but these may affect the environment. Resistance may develop. Look to use IPM, takes the best of cultural, biological and chemical control to maximise yield minimise environmental damage Genetic engineering: inserting genes into crops making them herbicide resistance (this may encourage excess use of herbicides), genes into crops to make toxins to insects, may mutate and harm humans, may lead to resistant insects developing. Transfer of gene to non-crop species producing resistant weeds or disrupting food chains Fertilisers (pg51): organic, inorganic or a combination. Good and bad points discussed on page 51. Steps to selecting the Biological agent The search for agent in pests country of origin, in areas with a similar climate to the planned area of release: more likely to find suitable control agent, and it will be more likely to survive. Study the effect of the parasite on other organisms in the lab: see how it affects native species, as it may compete for food/habitat or prey on them. Release of large numbers of agent: Increase the chances of successful introduction to increase chances of reducing pest numbers below economic threshold The stable coexistence of pest and parasite at: means one application should be enough, means pest population should stay below threshold, if pest dies out so will agent, reapplication would be needed
- 20. 20 Biomass is measured in Kg/m2 or g/m2 of in marine ecosystems Kg/m3 The dry biomass is measured as water content varies and water contains no energy. But this requires killing the organisms, thus only a sample is used and this may not be representative of the population. Sample is randomly selected, dried in oven at 800 C evaporates water, does not burn organic matter until the mass is constant. Weigh a few individuals and get an average, then multiply the number of them by this value. Only measures the number organisms present at that time, so seasonal variation is not accounted for and this means that inverted pyramids may exist in marine ecosystems, when the mass of phytoplankton is less than that of zooplankton feeding on it. Across the year the mass of phytoplankton must be greater than the mass of the zooplankton Inverted pyramids are possible when the producer’s reproduction rate is faster than the rate of consumption (quickly eaten and so don’t reach a high biomass, but reproduce quickly to sustain the consumer) and has a short life unlike the consumers. If we compared the biomass of the phytoplankton against the increase in biomass of the zooplankton, the biomass of the phytoplankton would be greater Limitations of pyramids of biomass Does not show biomass can vary at each trophic level over time Variability in abiotic factors in an area may make comparisons between ecosystems difficult Samples required and must be large enough and random to represent the population Biomass may not be equivalent to energy, as 1g of fat has twice the energy as 1g of carbohydrate. Seasonal variations may not be accounted for Food Chains/webs: illustrate the relationship between members of a community in an ecosystem. Eacvh stage int eh food chain is called a trophic level, the arrows represent the flow of energy and matter. Food chains start with producers (plants, algae, plankton and photosynthetic bacteria) Pyramids of numbers: shows the number of organisms at each trophic level. The width of the bars can represent numbers using a linear or logarithmic scale. Usually numbers decrease as we move up the chain and the size of the organisms increase But…........... There is no account of the size of the organisms: 1 large tree is treated the same as tiny aphids. The numbers of 1 species may be too large to represent on the same scale as another species The transfer of matter and energy in an ecosystem can be displayed using ecological pyramids. There are three kinds. Pyramids of energy: represent the flow of energy into each trophi c level over a period of time. The units are usually KJm-2 yr-1 . They are never inverted. Allows comparison of productivity in an area No inverted pyramids
- 21. 21 Energy enters the food chain in the form of light energy. The light can either be absorbed, reflected of transmitted. Only that which is absorbed by the chlorophyll can be converted into chemical energy (glucose and its derivatives). As little as 1% of the solar energy reaching the earth is fixed into biomass of the producer Very little light energy is used by the plant because….. Wrong wavelength Misses chloroplasts and is transmitted Reflected Energy losses due to inefficiency of photosynthesis Some is used to evaporate water Other factors can limit the effectiveness of photosynthesis (temp/CO2) Only a small percentage of the light energy absorbed by the chlorophyll is stored as biomass because………… Energy is lost as heat in respiration and other metabolic processes Photosynthesis is inefficient (energy lost as electrons are passed on) CO2 and Temperature are limiting factors The total quantity of energy that plants in a community convert into organic matter is called the gross production. Plants use 20-25% of this energy in respiration leaving little to be stored. So, the stored energy is called the net production Net production = gross production – respiratory losses
- 22. 22 Consumers take in concentrated chemical energy in the form of organic molecules that constitutes the biomass of producers or consumers they eat. A lot of biomass is not absorbed by the consumer (bones, hair, cellulose, teeth, roots of plants etc.) and the energy in this biomass is passed onto the decomposers. Much of the energy that is absorbed is lost as heat in various metabolic reactions, particularly respiration and friction in movement. The heat losses are bigger in warm blooded animals and very active animals. Not all the chemical energy in the biomass of the organisms being consumed is passed to the next trophic level because….. Not all of the organisms are eaten by those at the next stage Not the entire organism is eaten (roots, woody material, teeth, bones, claws etc) Energy is lost in excretory products (urine) Not all of the food is digested: plant material is much more difficult to digest than meat, due to the cellulose and lignin, consequently the efficiency of the energy transfer from producer to primary consumer is 10% whereas from primary consumer to secondary consumer it may be as high as 15-20%. Energy lost in respiration (heat and movement): this uses biological molecules as a fuel source to release energy and produce ATP. The process releases some energy as heat which escapes to the surroundings. The ATP is used in many processes, active transport, anabolic processes, cell division, muscle contraction, when use energy is eventually lost as heat. Energy lost in maintaining body temperature: this is higher in mammals and birds (homeothemrs, warm blooded, endotherms) than cold blooded animals, it is higher again in smaller organisms as they have a larger surface area to volume ratio. Consequently food chains are rarely more than 4 trophic levels because…… Energy losses occur at each stage, as excreted products, egested indigestible parts, parts that are uneaten, heat from respiration and movement. There is not enough energy left to sustain a large enough breeding population at a higher trophic level. It may be possible to find 6 and 7 trophic levels; this may be a result of…. Aquatic food chains, where the organisms are cold blooded and so energy losses at each stage are slightly lower with regards maintaining body temp Animals may feed at lower trophic levels in different food chains There is a very large density of producers (larger producer biomass) and so the collective % of light energy absorbed may be greater thus allowing more trophic levels C = P + R + U + F The energy used in the production of new tissue. P = C – R – U - F
- 23. 23 Energy losses……. Sun producer: energy lost that is reflected, the wrong wavelength, does not fall on chlorophyll, factors like temperature and carbon dioxide limit the rate of photosynthesis Trophic level trophic level Parts of the organism are not eaten (roots, bones, teeth, fur), Parts of the organism are indigestible (particularly plant material cellulose, lignin) energy lost in faeces Some energy is lost in excretory materials (urine) Energy is used in respiration to drive, active transport, synthesis, cell division, muscle contraction and none of these processes are 100% efficient, so all respiratory energy is eventually lost as heat. Energy transfer from producer to primary consumer is about 5-10% of the net primary productivity. This is lower than primary consumer to secondary consumer (10-20%) because…. Much plant material is indigestible lignin and cellulose) A lot of the plant biomass may not be consumed by an individual herbivore Animal material is more digestible and has a higher energy value. Carnivores may be highly specialised for feeding on their prey. But still much less than 100% efficient because….. Animal tissue is not eaten or digested (bones, teeth fur) The energy is the waste (faeces and urine) and uneaten parts and dead organisms is absorbed by decomposers, used in the growth of these organisms and in respiration and the energy is eventually lost as heat In some cases it may become fossilised and the energy is released in combustion The efficiency of energy transfer differs at different stages as the energy is transferred through the ecosystem….. Some light energy is reflected, the wrong wavelength of does not fall on chlorophyll. Photosynthesis has a low efficiency (2%), there are losses in excretion and uneaten biomass, energy loss as heat, there is a lower efficiency of energy transfer between producer and herbivore than primary consumer and secondary consumer, meat is more digestible, they efficiency of transfer is lower in warm blooded animals and older animals that are no longer growing
- 24. 24 Productivity: the amount of biomass produced by that ecosystem in a year measured either as Biomass: Kgm-2 y-1 or Energy: KJm-2 y-1 Gross Primary Productivity (GPP) = amount of energy fixed by producers in photosynthesis and stored as chemical energy in glucose Gross Secondary Productivity (GSP) = amount of energy absorbed by secondary consumers But energy losses as heat from respiration, indigestible parts of food, uneaten parts of food etc. means not all energy is available to the next level in the food chain, so…… Net Primary productivity (NPP) and Net Secondary Productivity (NSP) is the amount of energy accumulated in producer or consumer biomass and available to the next trophic level Net productivity = Gross Productivity – losses due to respiration and heat. Only a small percentage of light energy is converted into chemical energy (GPP). It is low because… Some light is the wrong wavelength Some light is reflected Some light does not fall on the chlorophyll Inefficiency of photosynthesis CO2, temperature, nutrients can be limiting factors Of the GPP only a small percentage is available for transfer along the food chain (NPP) due to energy lost as heat in respiration Agricultural systems aim to increase GPP… Irrigation Fertilisers (add minerals NPK to soil) Pest control: cultural, biological, chemical or integrated Herbicides (reduce competition) Selective breeding for high yielding crops/ GM crops Monoculutre: growing one crop, the best crop for area year on year (environmental consequences to consider) Glass/greenhouses enhance temp/CO2/ light limiting factors Ploughing aerates soil to improve drainage and aeration of soil allows nitrification/decreases denitrification; Protection of crops from birds/pests/frost by covers/netting Energy losses occur at each stage of the food chain Producer consumer consumer………. because………. Energy lost in parts of the organism not consumed (roots, bones, fur, teeth) Energy lost in parts of the organism not digested (particularly cellulose/lignin) Energy is lost in excretory products like urine Energy lost as heat form respiration Active and warm blooded animals these losses are greater, small mammals the losses can be greater due to the large surface area to volume ratio and extent of heat loss Agricultural practices, intensive rearing of animals (factory farming), looks to minimise these losses and increase NSP…….. Slaughtered when still growing so more energy transferred to biomass Fed on controlled diet so higher proportion of (digested) food absorbed (high protein low plant diet) Movement restricted so less energy used Kept inside heated shed so less heat loss Genetically selected for high productivity/rapid growth In most communities the biomass at each trophic level is less than that above because………not all the organisms are eaten by those Loss of energy at each stage in the food chain by respiration and/or movement and/or excretion, uneaten material Less energy to be passed on Explain why a food chain rarely contains more than four trophic levels. Energy losses (at each trophic level) In……. excretion / egestion / movement /respiration /as heat So (too) little left to sustain a large enough breeding population at higher trophic levels Food chains can be 6-7 trophic levels when…. It’s an aquatic food chain, cold blooded animals Animals are feeding at a number of trophic levels There is a large density of producers, so GPP and hence NPP increases
- 25. 25 Eutrophication: Nitrates and Phosphates leached from farm land Algal Bloom blocks light penetrating the water Death of aquatic plants below surface death of algae as nutrients deplete Increase in the numbers of saprobionts Respiration of decomposers uses up oxygen in water Aerobic organisms die Biochemical Oxygen Demand (BOD): a high BOD indicates a high level of organic matter in waterways. The more bacteria, the more O2 they will use and so a high BOD results Fertilisers: used to replace minerals in the soil. IN agricultural practices nutrient cycles are disrupted, minerals are removed from the soil, but not replaced by decay. Two types: organic and Inorganic Combination of both is most effective, using the slow release of organic minerals in early stages and applying faster acting more readily available organic minerals at key stages in growth Law of diminishing returns: the increased application of fertiliser does not increase yield and so is uneconomic. Nitrogen needed for: Protein/amino acid/nucleic acid/ATP / urea; Potassium needed for: Protein synthesis, chlorophyll production Phosphates needed for: production of DNA, RNA, NADP and ATP Nitrogen cycle: Ammonification: release of inorganic nitrogen form organic nitrogen (proteins/amino acids). Saprobiotic organisms; secrete enzymes which hydrolyse organic compounds; releasing ammonia; Nitrification: oxidation of ammonium ions into nitrite and then nitrate by nitrifying bacteria Nitrogen fixing: reduction of nitrogen to ammonia by nitrogen fixing bacteria in soil (nitrification follows) or in mutualistic relationship with plants (legumes) (plants use ammonia directly) Denitrification: Conversion of nitrate to nitrogen; bacteria use nitrate for respiration; occurs in waterlogged (anaerobic conditions), by denitrifying bacteria Nitrates are absorbed by the plant roots used in amino acid/protein synthesis. Farmers growing legumes because: Clover contain N fixing bacteria; when clover decays it adds nitrogen compounds to soil; less fertiliser needed; Carbon Cycle How organic carbon is made available as CO2 by detritivores and saprobionts: Detritivores break leaves into small pieces increase surface area; increase rate of microbial activity. Add useful products of excretion (increase nitrogen); tunnelling aerates soil increases oxygen. Saprobionts decompose organic matter; Secreting enzymes for digestion (extracellular digestion); Absorption of products (sugars); Respiration by detritivores and saprobionts; Release of carbon dioxide; Carbon dioxide used in photosynthesis; Differences in how detritivores and saprobionts obtain nutrients: Decomposers secrete enzymes onto organic matter extracellular breakdown; Detritivores ingest organic matter and digest it in a gut
- 26. 26 Why??????? Higher productivity in agriculture: Remove issues of limiting factors: greenhouses can control tmepertaure, light internisty, carbon dioxide levels, irrigation ensures water is readily avilible, use of fertilisers means that minerals are readily avilible, management of pests reduces competition for resources form ‘weeds’ and minimises crop damage form animal pests. Selecetive breeding for high yielding crops or fast growing animals and genetic engineering of crops for tolerance or pest resistance. Factory farming of animals, reduces energy losses by restricting movement, warm holding sheds, high energy and highly digestible foods, growth hormones, antibiotics Lower species diversity in agriculture: Removal of hedgerwos removes habitats for animals and food sources, growing one type or limited types of crops reduces biodiversity Lower genetic diversity: Selective breeding for certain charcateristics reduces the gene pool (risk associated with this, susceptibility, variation maximises chances of survival) Limited natural recycling and high input of fertilisers: Minerals are removed form the soil by crops and are not returned (decomposed) in that area. Soild depletes of minerals. Fertilisers used to replace lost minerals and to maximise yield. Organic inorganic, or combination of both, consider problems of eutrophication. Competition controlled naturally and artificially Pest control, cultural, biological, chemical and integrated management.
- 27. 27
- 28. 28 The predator prey relationship The population sizes of the predator and prey are interdependent. An increase in the prey population means more food and delayed increase in the predator population follows. The increased number of predators kills more prey, so prey numbers fall Lack of food means predators numbers fall Key notes Predator population changes always lags behind the prey Predator number is always lower than the prey (due to energy loss in a food chain). Although the predator prey relationships are a significant contributor to the fluctuations they are not the only reasons as disease, arrival of new predators and climatic factors may also act. The changes in population are not always as severe as shown in many illustrations; this is because organisms usually have a number of food sources. The experiment shows that both food and predation affect hare population. Food availability has more of an effect. The combined effect is more effective than either separately. This graph is drawn from data on the fur trading for both species. However, this assumes that the numbers of fur traded is representative of the relative size of the populations. The population of the snowshoe hare fluctuated in a series of peaks and troughs. Each peak and trough is repeated roughly every ten years. The population of the lynx cycles in ten yearly peaks and troughs similar to that of the hare. The peaks in the lynx population typically occur after that of the hare The hare increases when lynx population is low as more survive. This increases food availability for the lynx so fewer starve and subsequently their population increases (rear more young), this increases predation on the hares so their population declines reducing food for the lynx so they decline in numbers.
- 29. 29 A population = the number of organisms of a particular species living in a habitat. This number is determined by a variety of interacting factors, abiotic (environmental, physical, non-living) and biotic (living factors) Lag phase: small numbers initially and the time needed to breed and for young to reach breeding age Exponential phase = rapidly increasing numbers in the population Stationary phase: carrying capacity is reached and the population remains relatively constant. Slight fluctuations in the population now affected by, food, predation, competition A 4th phase (decline phase) of the population curve may exist (usually not in a natural environment) in certain circumstances and here there is a decline in the population due to depleting resources for numerous possible reasons Human influence (hunting, deforestation, urbanisation) Or in bacterial growth when nutrients run out No population will grow indefinitely as the availability of resources and competition for these will limit growth. The factors that limit growth….Are called Environmental resistance and can be density-dependent or density-independent Temperature: Plant growth, Cold blood animals and Warm blooded animals are affected, when it is cold they expend more energy keeping warm, this will slow growth and slow reproduction Light: Light affects photosynthesis. pH: enzyme activity is affected by this Water/humidity: low water availability limits diversity, only xerophytes growing, limits the food sources and habitat and thus animals that can flourish. Abiotic factors Climatic: temperature, light, humidity, wind speed, rainfall Edaphic (soil): pH, mineral and moisture content Topographic: altitude Human factors: pollution Catastrophes: floods, fires, and earthquake These factors can vary within a habitat creating microclimates and microhabitats. These factors tend to be density-independent factors: the size of their impact is independent/is not related to the size of the population. Low light will limit plant growth regardless of the size of the plant population. A drop in temperature could kill many organisms whether the population is large or small These factors can often be seasonal Interspecific competition: competition for resources between members of different species usually having evolved slightly different ecological niches. When species which occupy a similar niche are brought in close contact one will usually out-compete the other (competitive exclusion principle), this will be the best adapted. Animals may find this situation arising due to deforestation and climate change forcing animals to migrate. Having a more varied diet helps maximise chances of survival Competitive exclusion principle: when two species are competing for limited resources the one using the resources most effectively will eliminate the other. Thus two species cannot occupy the same niche indefinitely when the resources are limiting Intraspecific competition: competition for resources between members of the same species, this is most intense as members have the same niche competing for exactly the same resources. This has a stabilising effect on a population, if population gets too big intraspecific competition increases and the population falls again. This is the driving force behind natural selection, as variants that are best competitors will survive and pass on their genes Biotic factors Food Competitors Predators Parasites Pathogens Biotic factors are usually density-dependent factors: the size of the effect depends upon the size of the population. Competition is greater if the population is greater. Higher population would mean transmission of disease is more rapid and more likely. If a population is high animals are more easily targeted by predators.
- 30. 30 An example of interspecific competition P. Caudatum grows slowly at first then accelerating exponentially from around day 4 to day 8. The growth rate then slows reaching a maximum around 12 days; this max population is sustained until day 20. When P. Caudatum is grown with P. Aurelia the population grows faster initially, reaching its maximum much earlier. The maximum population is much reduced (<half) and is not maintained for the 20 days, it reaches zero. This suggests that the P. Caudatum is unable to compete effectively and thus the population starves. P. aurelia‘s growth is slowed when P. Caudatum is present as availability of food is reduced due to competition. On both occasions P. aurelia reaches the maximum, as it out-competes the P. caudatum, which dies out making food available for growth A second example of interspecific competition The graph for Scotland shows evidence that changes in the red squirrel population are due to competition from the grey squirrel because, the fall in the red is mirrored by the increase in grey after 1985 In Wales between 1970 and 75 both populations fall, this could be a result of, lack of food, adverse weather, increase in squirrel predators, disease One suggestion for the competitive advantage of grey over red is that grey squirrels will forage in the trees like the red, but are more willing to forage on the forest floor increasing chance of finding food.
- 31. 31 A niche is the role the organism has within the habitat. The niche includes abiotic and biotic factors that the organism needs. Organisms are well adapted to their niche. Species with a narrow niche are called specialists. Many specialists can co-exist in a habitat as they are not competing for the same resources, this can give a high biodiversity Species with abroad niches are called generalists, and generalists in the same habitat will compete meaning that only a few will exist, giving a low biodiversity. Only species X would be found in section 1 Temperature and pH conditions where it is suitable for both X and Y to co-exist are found in section 3 The section where it would be too high a temperature for X and too low a pH for Y is section 2 Competition between X and Y would be found in section 3 No population of either X or Y would be found in section 4 because, the pH is too high for X and the temperature is too low for Y The abiotic factors that comprise an organism’s niche can be shown on a graph. For example, if a particular plant can only grow in a temperature range of 10–17°C and a soil pH of 6–7.5, then these ranges can be plotted on two axes of a graph, and where they intersect (the shaded box in the graph on the left) shows those aspects of the plant’s niche. We can add further axes to show the suitable ranges of other factors like humidity, light intensity and altitude, and so get a more detailed description of the niche (graph on right).
- 32. 32 The population of most animals has been kept in check by the availability of food, disease, climate, predators to name some of the limiting factors of the environment Modification of the human environment has led to a population explosion. The development of agricultural practice The industrial revolution Recycling Medical advances Understanding diets Waste management Improved quality of food So the typical sigmoid population growth is not followed by human populations but rather the exponential phase continues and no stationary stage is reached to stabilise the population. The increase in population, or growth rate, depends on four factors: Growth rate = (birth rate – death rate) + (immigration rate – emigration rate) The equation shows that growth rate can increase by increasing the birth rate or decreasing the death rate (ignoring migration). The staggering human population growth over the last two centuries is entirely due to a massively decreased death rate caused by the improvements in farming described earlier, and in medicine. The increased growth rate has therefore happened at different times for different countries. Factors affecting birth rates Economic conditions – usually lower income = higher birth Religion – some religions encourage big families and are against birth control Social pressure/conditions – a large family can improve social standing Birth control – pills and abortion can affect Political factors – governments influence by taxation and education Factors affecting death rates Age profile – greater proportion of elderly the higher the death rate Life expectancy – longer in MEDNs Food supply – adequate and balanced diet reduce death rate Water supply and sanitation Medical care Natural disasters War
- 33. 33 Demographic Transition Model: A model to show population changes in a country over time resulting from changes in social and economic situation of the country. Stage 1 High birth and death rates: Limited food causes starvation. Disease causes high but fluctuating death rate. Young are very susceptible to disease and starvation so high infant mortality rate. Short life expectancy means populations remain low and stable Stage 2 More reliable food supply, improving nutrition, and improved living conditions and reduced disease reduces death rates. Birth rates are high so population growth is rapid. Stage 3 Significant fall in birth rate is linked to social change. The increase in industrialisation and urbanisation means that families are less dependent on having children to contribute to the household. Birth control is practised. Stage 4 Stable population with low birth and death rates. Typically death rate is low and stable, birth rate is more variable. Proportion of elderly increases. In some countries death rate now exceeds birth rate a population declines (a possible 5th stage to this model) Most LEDNs are still in stages 2 and 3. Most MEDNs are in stage 4, and some have entered into the possible 5 stage, where the total population is declining. The problem here is that how do they support an increasingly older population that are dependent on a declining number who work. To help tackle these problems immigrants are being encouraged from countries where the population is growing. In the second and third stages the death rates fall before birth rate so the population still grows. In final stage birth rate and death rate are low so the population is stable. Developed countries in stage 4 Developing in stages 2 or 3 so pop growth is mainly here. Social Conditions affecting population structure. The growth of a population rarely follows the demographic transition model exactly; there are many factors that interact and are in turn affected by environmental factors. Three important factors affecting growth are Food supply Individual growth and health are food dependent. Lack of food increases infant mortality due to malnourishment, and malnourished have less chance of surviving infectious diseases. This also affects birth rate as fertility drops in malnourished women. Food shortage can be affected by, drought, crop diseases; other environmental factors (flood etc) there may also be difficulties with distribution. Sewage disposal This is tied into the supply of safe drinking water and the spread of water borne disease (cholera). Drinking water In UK it is taken from deep underground or from rivers or stored reservoirs. Social Conditions and life expectancy Human population growth in the past was limited by food supply, but agriculture offered humans a degree of control over their food production. As populations grew and settled in towns water borne disease had a significant effect due to poor sewage. Many other diseases were controlled until the invention of the vaccination. In modern developed countries fertility can be controlled.
- 34. 34 The demographic transition model leads to a change in the age structure of a population. These changes can be illustrated in population pyramids or survival curves. Pyramids it helps to group the bars as pre-reproductive (<15), reproductive (15-44), post reproductive (>45) The shape tells about the future growth of the population… The wider the base the faster the population growth. A narrow base suggests a falling population Steep pyramid suggests a longer life expectancy A pyramid with a wide base and with a narrow tip suggests high infant mortality and short life expectancy Survivor curves are created by tracking a group of individuals from birth until the last one dies. The age each one dies at is recorded. The percentage of the group surviving at each stage is plotted. The life expectancy (mean life span) can be calculated by reading of the age at which 50% survive. Type I: long life expectancy, low infant mortality expected in affluent countries Type II: intermediate life expectancy and roughly constant death rate. Type III: short life expectancy, most die young (shown in animals with low parental care and produce large number of off-spring to compensate) in human populations this is evident in countries with poor health care, sanitation and nutrition. A bowing curve to the right demonstrates an improved ability to survive suggesting improved living conditions, medical care, and technology. Although people talk about quality of life in preference to length, the fact remains that length of life is the most objective way to measure quality
- 35. 35
- 36. 36 The light-dependent reactions use light energy to split water and make ATP, oxygen and energetic hydrogen atoms. This stage takes place within the thylakoid membranes of chloroplasts, and is very much like the respiratory chain, only in reverse. • The light-independent reactions don’t need light, but do need the products of the light- dependent stage (ATP and H), so they stop in the absence of light. This stage takes place in the stroma of the chloroplasts and involves the fixation of carbon dioxide and the synthesis of glucose. • Plants do not turn carbon dioxide into oxygen; they turn carbon dioxide into glucose, and water into oxygen. The chloroplast is adapted for its function. Contains chlorophyll for light absorption; Range of different pigments to absorb different wavelengths; Stacking / arrangement of grana/thylakoids maximises light catchment; layering of membrane allows a lot of pigment; Stroma contains enzymes for photosynthesis; (Calvin cycle) Outer membrane keeps enzymes in chloroplast; Starch grains / lipid droplets store products of photosynthesis; Ribosomes and DNA for enzyme/protein synthesis; Shape of chloroplast gives large surface area for CO2, absorption. Disc shape provides large surface for light absorption; Permeable membrane allows diffusion of gases / carbon dioxide; Membranes provide surface for attachment of electron / hydrogen acceptors; The absorption spectrum is the graph of absorbance of different wavelengths of light by a pigment The action spectrum shows the rate of photosynthesis at different wavelengths. Note the peaks of absorption occur at 650-700nm (red light) and 400-450nm (blue light). These absorption peaks correspond to the peaks in photosynthetic rate shown in the action spectrum Chlorophyll is a fairly small molecule (not a protein) Chlorophyll and the other pigments are arranged in complexes with proteins, called photosystems. Each photosystem contains some 200 chlorophyll molecules and 50 molecules of accessory pigments, together with several protein molecules (including enzymes) and lipids. These photosystems are located in the thylakoid membranes and they hold the light- absorbing pigments in the best position to maximise the absorbance of photons of light. The chloroplasts of green plants have two kinds of photosystem called photosystem I (PSI) and photosystem II (PSII). These absorb light at different wavelengths and have slightly different jobs in the light dependent reactions of photosynthesis. How the leaf is adapted for photosynthesis Large surface area to collect solar energy; transparent nature of cuticle to allow light penetration; position of chlorophyll to trap light; stomata to allow exchange of gases; thin / max. surface area to volume ratio for diffusion of gases; spongy mesophyll / air spaces for carbon dioxide store; xylem for input of water; phloem for removal of end products;
- 37. 37 The light-dependent stage of photosynthesis. Light absorbed by chlorophyll in photosystem (PSI/PSII) electrons excited to a higher energy level Electrons are emitted form chlorophyll (oxidised) picked up by electron acceptor Electrons pass down chain of carriers energy released as electrons pass down the electron transport chain energy used in producing ATP from ADP and phosphate; (ADP + Pi+ energy (ATP) A process called photophosphorylation Photolysis of water Provides electrons to replace those lost from PS II (stabilising the chlorophyll/reducing it) Provides the protons/H+ i ons to reduce NADP Reduced NADP formed by accepting electrons and H+; The way in which ATP and reduced NADP are produced in the light-dependent reaction In context of ATP formation light raises energy level of (excites) electrons These pass through electron carriers; energy is released as electrons pass down the transport chain energy is used to form ATP from ADP + P; Reduced NADP is made by accepting protons / H + ions; And electrons; From photolysis / water; The role of electron transport chains in the light dependent reactions 1. Electron transport chain accepts excited electrons; 2. From chlorophyll / photosystem; 3. Electrons lose energy along chain; 4. ATP produced; 5. From ADP and Pi; 6. Reduced NADP formed; 7. When electrons (from transport chain) and H + combine with NADP; 8. H + from photolysis; PSII absorbs light, excites electrons to a higher energy level. This drives photolysis of water (2H2 O O2 + 4H+ + 4e- ), the protons build up in the thylakoid lumen and the electrons replace those in the chlorophyll. Excited electrons pass along electron carriers releasing energy as they go which pumps protons form stroma to lumen of thylakoid Electrons are finally picked up by NADP The protons are used to make ATP using the ATP synthase enzyme (photophosphorylation) The H+ ions are then picked up by NADP forming reduced NAPD
- 38. 38 Plants produce ATP in their chloroplasts during photosynthesis. They also produce ATP during respiration. Explain why it is important for plants to produce ATP during respiration in addition to during photosynthesis. 1. In the dark no ATP production in photosynthesis; 2. Some tissues unable to photosynthesise/produce ATP; 3. ATP cannot be moved from cell to cell/stored; 4. Plant uses more ATP than produced in photosynthesis; 5. ATP for active transport; 6. ATP for synthesis (of named substance); In light independent reaction/Calvin cycle; 1. Carbon dioxide combines with ribulose bisphosphate/RuBP CO2 acceptor; 2. This reaction is catalysed by ribulose bisphosphate carboxylase (RuBISCo) 3. Produces two molecules of glycerate (3-)phosphate/GP; 4. GP is reduced to triose phosphate/TP; 5. Using reduced NADP; 6. Using energy from ATP; 7. Some TP is converted to hexose compounds/other organic substances 8. Some TP is used to regenerate ribulose bisphosphate; 9. This regeneration of RuBP requires ATP 10. 10 molecules of 3C/TP/GP form 6 molecules of 5C/RuBP; Explain how ATP and reduced NADP are used in the light-independent reactions. GP converted to triose phosphate (GALP) this involves a reduction; reduced NADP provides the reducing power ATP supplies energy for this reaction; ATP is also used to provide the phosphate for production of RuBP;
- 39. 39
- 40. 40 The ‘Lollipop’ experiment was used by Melvin Calvin to work out the details of the light independent reactions. Single celled algae are grown in a solution of radioactive hydrogencarbonate (14 C) which supplies radioactive Carbon dioxide and will be incorporated into the compounds. At 5 second intervals samples of the algae are dropped in to hot methanol (stops chemical reactions instantly, through enzyme denaturation), the compounds are separated (two way chromatography) out and those that are radioactive are identified and the pathway established by the time at which the substances appear. The rapid action tap is essential because the reactions occur quickly and the samples can be removed after a precise time period. Photosynthometer (Audus apparatus). Set up to avoid air bubbles within and ensure it is air tight (air entering/leaving will alter volume of gas making results unreliable. Water bath keeps temperature constant, so change sin rate are only due to light. Temperature can be adjusted to investigate temp effect. Potassium hydrogencarbonate is used to produce excess CO2 for plant so it does not limit Light source with adjustable intensity is used The rate of photosynthesis by a plant or alga can be measured by recording the amount of oxygen produced, or carbon dioxide used, in a given period of time. But these measurements are also affected by respiration, which plants do all the time, so the respiration rate must be measured separately. The conditions at which the rates of photosynthesis and respiration are equal, so there is no net change in oxygen or carbon dioxide concentration, is called the compensation point. Many of the environmental factors that affect photosynthesis also affect respiration. Temperature influences enzyme. Photosynthesis is more sensitive to temperature with an optimum of about 30- 35°C, whereas respiration often has an optimum nearer to 45°C. There is a temperature compensation point around 40°C (A), above this temperature plants lose mass as the rate of respiration is greater than the rate of photosynthesis. Carbon dioxide is the substrate for the enzyme rubisco in the light-independent stages of photosynthesis, so the higher the carbon dioxide concentration the faster the rate of the Calvin cycle. The rate of respiration is not affected by carbon dioxide concentration, and the carbon dioxide compensation point is usually very low, at about 50ppm (A). Normal carbon dioxide concentration in the air is about 400ppm (B), whereas the optimum concentration for most plants is nearer to 1000ppm, so carbon dioxide is often the limiting factor. Light is the source of energy for the production of ATP and NADPH in the light-dependent stages of photosynthesis, so the higher the light intensity the faster the rate of photosynthesis. The rate of respiration is not affected by light intensity, and the light compensation point is usually low. Shade plants are adapted to growing in low light conditions (such as a forest floor), so have a very low light compensation point (A) and a low optimum intensity. Shade plants make good house plants, since they are adapted to the low light intensities indoors. Sun plants have a higher compensation point (B), and have a very high optimum near the light intensity of a bright summer’s day (C). Both photosynthesis and respiration are affected by time of day: photosynthesis by changes in light and respiration by changes in temperature. At night respiration exceeds photosynthesis, while during the day photosynthesis exceeds respiration, so there are two compensation points each day (A and B). Over a 24-hour period the amount of photosynthesis is greater than the amount of respiration, so plants gain mass and have a net uptake of carbon dioxide.
- 41. 41
- 42. 42
- 43. 43 The different stages of respiration take place in different parts of the cell. This compartmentalisation allows the cell to keep the various metabolites separate, and to control the stages more easily. The energy released by respiration is in the form of ATP. Stage 1 (glycolysis) is anaerobic respiration, this occurs in the cytoplasm Stages 2 (link reaction occurs in the matrix) and 3 (oxidative phosphorylation, chemiosmosis, electron transport, occurs on the cristae) are the aerobic stages and occur in the mitochondria 1. Glucose enters cells from the tissue fluid by facilitated diffusion using a specific glucose carrier. This carrier can be controlled (gated) by hormones such as insulin, so that uptake of glucose can be regulated. 2. Glucose is phosphorylated using 2 ATPs. keeps glucose in the cell by effectively removing “pure” glucose, so glucose will always diffuse down its concentration gradient from the tissue fluid into the cell (glucose phosphate no longer fits the membrane carrier). It “activates” glucose for biosynthesis reactions. 3. The Hexose Bisphosphate splits into two triose phosphate (3 carbon) sugars. 4. The triose sugar is changed over several steps to form pyruvate, a 3-carbon compound. In these steps some energy is released to form ATP (the only ATP formed in glycolysis), and a hydrogen atom is also released. This hydrogen is later used by the respiratory chain to make more ATP. The hydrogen atom is taken up and carried to the respiratory chain by the coenzyme NAD, which becomes reduced NAD in the process. Pyruvate can also be turned back into glucose by reversing glycolysis, and this is called gluconeogenesis. 5. In the absence of oxygen pyruvate is converted into lactate or ethanol in anaerobic respiration 6. In the presence of oxygen pyruvate enters the mitochondrial matrix. It is converted to a compound called acetyl coA. Since this step links glycolysis and the Krebs cycle, (link reaction). In this reaction pyruvate loses a CO2 and a hydrogen to form a 2-carbon acetyl compound, which is temporarily attached to coenzyme A (or just coA), so the product is called acetyl coA. The hydrogen is taken up by NAD again. 7. The acetyl CoA then enters the Krebs Cycle. The 2-carbon acetyl is transferred from acetyl coA to the 4-carbon oxaloacetate to form the 6-carbon citrate. Citrate is then gradually broken down in several steps to re-form oxaloacetate, producing carbon dioxide and hydrogen in the process. Some ATP is also made directly in the Krebs cycle. As before, the CO2 diffuses out the cell and the hydrogen is taken up by NAD, or by an alternative hydrogen carrier called FAD. These hydrogen atoms are carried to the inner mitochondrial membrane for the final part of respiration. The removal of hydrogen/dehydrogenation is done by enzymes/dehydrogenases. The resulting H is accepted by NAD/which forms reduced NAD. This occurs in glycolysis and Krebs cycle, (FAD is used as well in Krebs);
- 44. 44 1. Reduced NAD releases its H and is oxidised to NAD, which returns to the Krebs cycle. Reduced FAD attaches to a protein further along the respiratory chain. The H split into H ions and electron. 2. The electrons are passed along the chain of proteins in the inner mitochondrial membrane, releasing its energy as it goes. 3. This energy is used to pump H ions into the intermemberane space, creating a proton gradient between the inner membrane space and the matrix. 4. The H ions can only move down their electrochemical gradient through a special channel in the ATP synthase enzyme, as they move down this gradient, they release energy that can be used to phosphorylate ADP. 4 protons = 1 ATP This is why reduced FAD yields less ATP, as it does not provide as much energy to pump H ions into the intermeembrane space as reduced NAD does 3. Oxygen (terminal electron acceptor) combines with hydrogen and electrons to form water (O2 + H+ + e- _ H2O). In absence of oxygen electron transport chain stops. Aerobic respiration yields more ATP per molecule of glucose than anaerobic. Explain. Oxygen as terminal hydrogen/electron acceptor; Operation of electron transport chain/ oxidative phosphorylation; Thus pyruvate can enter the Krebs cycle; Significance of ATP formed in glycolysis; Explain why oxygen is needed for the production of ATP on the cristae of the mitochondrion. ATP formed as electrons pass along transport chain; oxygen is terminal electron acceptor accepting electrons from electron transport chain; It also accepts H + forming H2O Electrons cannot be passed along electron transport chain if no O2 to accept them; Describe how ATP is made in mitochondria 1. Substrate level phosphorylation in Krebs 2. Krebs cycle/link reaction produces reduced NAD and FAD; 3. Electrons released from reduced NAD/FAD 4. (Electrons) pass along carriers/through electron transport chain (redox reactions) 5. Energy released; phosphorylates 6. ADP/ADP + Pi; 7. Protons move into intermembrane space; 8. ATP synthase; Describe the roles of the coenzymes and carrier proteins in the synthesis of ATP. hydrogen attaches to NAD/FAD (reduction) Electrons transferred from coenzyme to coenzyme on transport chain series of redox reactions; this releases energy to pump protons H + /protons pumped into intermembrane space; H + / protons flow back through /enzyme; ATPase; Energy used to synthesise ATP from ADP and Pi
- 45. 45 If there is no oxygen (anaerobic conditions) then water cannot be made, electrons can‘t leave the respiratory chain, so NADH cannot unload any hydrogen to the respiratory chain. This means that there is no NAD in the cell; it’s all in the form of NADH. Without NAD as a coenzyme, some of the enzymes of the Krebs cycle and glycolysis cannot work, so the whole of respiration stops. Anaerobic respiration circumvents this problem by adding an extra step to the end of glycolysis that regenerates NAD, so allowing glycolysis to continue and some ATP to be made. Anaerobic respiration only makes 2 ATPs per glucose, but it’s better than nothing! There are two different kinds of anaerobic respiration: In animals and bacteria the extra step converts pyruvate to lactate (or lactic acid). This is a reduction, so reduced NAD is used and NAD is regenerated, to be used in glycolysis. The reaction is reversible, so the energy remaining in the lactate molecule can be retrieved when oxygen becomes available and the lactate is oxidised via the rest of aerobic respiration. Unfortunately the lactate is poisonous, causing acidosis in muscles cells, which stops enzymes working, possible affects the binding of calcium to troponin in the muscle and causes muscle fatigue and cramp. Anaerobic respiration in muscles cannot be continued for very long. In plants and fungi the extra steps converts pyruvate to ethanol. This is also a reduction, so NADH is used and NAD is regenerated, to be used in glycolysis. Ethanol is a two-carbon compound and carbon dioxide is also formed. This means the reaction is irreversible, so the energy in the ethanol cannot be retrieved by the cells. Ethanolic anaerobic respiration is also known as fermentation, and we make use of fermentation in yeast to make ethanol in beer and wine. Describe what happens to pyruvate in anaerobic conditions and explain why anaerobic respiration is advantageous to human skeletal muscle. Forms lactate Use of reduced NAD / NADH; Regenerates NAD; NAD can be re-used to oxidise more respiratory substrate allows glycolysis to continue; Can still release energy/form ATP when oxygen in short supply/when no oxygen; Give two ways in which anaerobic respiration of glucose in yeast is Similar to anaerobic respiration of glucose in muscle cells ATP formed/used; pyruvate formed/reduced; NAD/reduced NAD; glycolysis involved/two stage process; Different from anaerobic respiration of glucose in a muscle cells Ethanol/alcohol formed by yeast, lactate (allow lactic acid) by muscle cell; CO2 released by yeast but not by muscle cell;
- 46. 46 Counting ATP How much ATP do we get per molecule of glucose? • Some ATP molecules are made directly by the enzymes in glycolysis or the Krebs cycle. This is called substrate level phosphorylation (since ADP is being phosphorylated to form ATP). • Most of the ATP molecules are made by the ATP synthase enzyme in the respiratory chain. Since this requires oxygen it is called oxidative phosphorylation. Scientists don’t yet know exactly how many protons are pumped in the respiratory chain, but the current estimates are: 10 protons pumped by NADH; 6 by FADH; and 4 protons needed by ATP synthase to make one ATP molecule. This means that each NADH can make 2.5 ATPs (10/4) and each FADH can make 1.5 ATPs (6/4). Previous estimates were 3 ATPs for NADH and 2 ATPs for FADH, and these numbers still appear in most textbooks, although they are now probably wrong. Remember two ATP molecules were used in the activation of glucose at the start of glycolysis, so this must be subtracted from the total We had: (per glucose molecule) 10 reduced NAD’s (2 from glycolysis 2 from link 6 from kerbs) 2 reduced FAD’s (from Krebs) 2 ATP made by substrate level phosphorylation in the Krebs cycle 2 ATP made by substrate level phosphorylation in glycolysis (4 were made but we invested 2 so it’s a net 2 ATP here) Reduced NAD makes either, (depending on the books you read) 3 ATP per reduced NAD or 2.5 Reduced FAD makes either, (depending on the books you read) 2 ATP per reduced FAD or 1.5 So…………… 10 × 3 = 30 10 × 2.5 = 25 2 × 2 = 4 2 × 1.5 = 3 2 ATP 2 ATP 2 ATP 2 ATP Total = 38 Total = 32
- 47. 47
- 48. 48 Glycolysis: occurs in the cytoplasm Glucose enters the cell through specific carriers; it is phosphorylated to prevent it leaving the cell this uses ATP to provide the Phosphate. Glucose is quite stable and so does not react easily, thus it is activated by the investment of energy. It is phosphorylated using 2ATP molecules (one has already been accounted for above); this forms an unstable hexose (6C) bisphosphate which then breaks down into two triose (3C) phosphates. These triose sugars undergo a series of dehydrogenations (each one has hydrogen removed) and dephosphorylations, each losses two phosphate groups (transferred to 2 ADPs, making 2 ATPs through substrate level phosphorylation.. Consequently for 1 molecule of glucose 2ATP are invested 2 pyruvate molecules are formed 4 ATP (generated by substrate level phosphoylation, enzyme catalysed transfer of phosphate from a molecule to ADP) 2 reduced NAD are made that are then transferred to the electron transport chain Remember though, there is only a net gain of 2 ATP in glycolysis (4 ATP generated – 2 ATP invested = 2 ATP left) Link reaction (occurs in mitochondria) Here pyruvate is actively taken into the mitochondrial matrix Dehydrogenated: the hydrogen is picked up by NAD Decarboxylated (CO2 removed) making a 2C acetyl compound that is temporarily attached to a coenzyme A (CoA), forming acetyl CoA which then enters the krebs cycle. Krebs cycle (occurs in matrix of mitochondria) Acetyl group is transferred to a 4C compound, oxaloacetate and forms a 6C compound citrate. This is dehydrogenated (hydrogen picked up by NAD) and decaroxylated to 5 carbon α ketoglutarate. This 5 carbon compound is dehyrgoenated (losing 3 hydrogen atoms, 2 are picked up by NAD and one is picked up by FAD) and decarboxylated (producing carbon dioxide), oxaloacetate is regenerated. 1 turn produces 3 reduced NAD’s 1 reduced FAD 1 ATP (substrate level) 2 carbon dioxides Remember there are two pyruvates, hence two acetyls so two turns, so double this for 1 glucose Chemiosmosis: Reduced NAD is transferred to NAD dehydrogenase located on the cristae of the mitochondrial inner membrane, reduced FAD arrives a second dehydrogenase enzyme complex on the cristae The reduced NAD (and FAD) are oxidised, the hydrogen is removed Each hydrogen atom is split into a hydrogen ion and electron The electrons are passed down a series of electron carriers at progressively lower energy levels. As the electrons move they release energy that is used to power the proton pumps in the cristae and they pump the protons (H+ ) into the intermembrane space The protons can only move back into the matrix at special channel proteins in the membrane that are associated with ATP synthase As the protons move down their electrochemical gradient the energy released is used to phosphoylate ADP producing ATP (ADP + Pi ATP)
- 49. 49 How is the structure of the mitochondria related to its function? Mitochondria have a double membrane: the outer membrane contains many protein channels called porins, which let almost any small molecule through; while the inner membrane is more normal and is selectively permeable to solutes. The inner membrane is highly folded into projections called cristae, giving a larger surface area. The electron microscope reveals blobs on the inner membrane, called stalked particles. These blobs have now been identified as enzyme complexes that synthesise ATP, and are more correctly called ATP synthase enzymes (more later). The space inside the inner membrane is called the matrix, and is where the Krebs cycle takes place. The matrix also contains DNA, tRNA and ribosomes, and some genes are replicated and expressed here. Explain the advantage of mitochondria in muscle cells having more cristae. (More cristae means a larger surface area for electron transport chain more enzymes for ATP production/oxidative phosphorylation; muscle cells use more ATP (than skin cells)(not just more respiration); Q. ATP is sometimes described as an immediate source of energy. Explain why. (Energy release) only involves a single reaction/one- step/ energy transfer direct to reaction requiring energy; Q. why is it that the body converts chemical energy in glucose, to chemical energy in ATP? ATP is a more useful as an immediate energy for metabolism than glucose because Energy is available more rapidly because it is released in single reaction ATP releases its energy in small/manageable quantities; Q. Why is ATP a useful energy store? 1. Releases energy in small / manageable amounts when hydrolysed 2. Hydrolysed in a one-step / single bond broken; 3. Immediate energy source/makes energy available rapidly; 4. Phosphorylates/adds phosphate; 5. Makes (phosphorylated substances) more reactive / lowers activation energy; 6. Reformed/made again using energy from other reactions 7. Can be readily moved/stored/broken down when needed; 8. Cannot pass out of cell; Q. What is ATP used for? The processes in a cell that require energy can be put into three groups: • Muscle contraction and other forms of movement, such as cilia, flagella, cytoplasmic streaming, etc. Each step of the muscle cross bridge cycle costs one ATP molecule. • Active transport. Each shape change in an active transport protein pump costs one ATP molecule. • Biosynthesis – building up large molecules from smaller ones, e.g. protein synthesis, DNA replication, starch synthesis, etc. Each monomer added to a growing polymer chain costs one ATP molecule. Since these processes use ATP, they all involve ATPase enzymes. ATPases catalyse the hydrolysis of ATP to ADP + Pi, and do work with the energy released. Phagocytosis; Synthesis of glycogen; Protein / enzyme; DNA / RNA; Lipid / cholesterol; Bile production; Cell division
- 50. 50 A species is defined as Organisms that can breed together to produce fertile offspring, Organisms in the same species are similar in morphology, behaviour and biochemistry, and have the same ecological niche. Organisms in the same species share a common ancestor. Speciation New species arise from an existing species where reproductively isolated populations have resulted (thus, there is no gene flow between the populations). This most commonly happens when the two populations become physically separated (allopatric speciation) If the speciation occurs when the organisms are occupying the same geographical area but are reproductively isolated it is sympatric speciation. Common in plants (flower at different times, polyploidy) less so in animals (but could arise due to differences in reproductive organs, differences in mating ritual) Each population experiences different environmental conditions, accumulates different mutations and over a long period of time natural selection changes the allelic frequencies of each population in different ways This makes the organisms become so different they can no longer interbreed Gene pool: all the alleles of all the genes in a population which result in variation. Sympatric speciation Copper-tolerant plants flower at a different time from those which are not copper-tolerant. Explain how this might eventually lead to the production of a new species of plant. 1. Reproductively isolated due to different flowering times 2. Different selection pressures for two populations 3. Different features or plants are selected or survive /different adaptations; 4. Populations become (genetically) different; 5. Unable to produce fertile offspring; Explaining how geographical isolation can lead to the formation of new species. (Allopatric speciation) 1. Populations are isolated by geographical barrier (river, mountain, desert or ocean); 2. No gene flow between populations 3. Variation exists within the populations 4. Each population faces different selection pressures due to different environments (climatic, food, predators) 5. Mutation in one group (different from other group) 6. Natural selection for specific alleles means populations become adapted to local environment; 7. The best suited organisms survive and reproduce pass on their alleles; 8. Change in allele frequencies over a long period of time 9. Isolated populations become so different they can no longer interbreed; Explaining sympatric speciation Original population living in one area 2 species evolved in the same area; Genetic variability exists in the population Groups within the population becomes reproductively isolated (flowering at different times, different courtship behaviour) Gene pools become increasingly different; Until interbreeding does not produce fertile offspring; What is meant by reproductive isolation? Organisms cannot interbreed/ breed or mate or reproduce with another group Due to incompatible gametes/ wrong courtship behaviour/ other valid reason
- 51. 51 Darwin's theory of evolution based on natural selection was based on four observations: • Individuals within a species differ– there is variation. • Offspring resemble their parents – characteristics are inherited. •More offspring are generally produced than survive to maturity – most organisms die young from predation, disease and competition. Those that survive have better characteristics and thus reproduce and pass on these genes • Populations are usually fairly constant in size. Summary of Natural Selection 1. There is genetic variation in the characteristics within a population 2. Individuals with characteristics that make them less well adapted to their environment will die young from predation, disease or competition. 3. Individuals with characteristics that make them well adapted to their environment will survive and reproduce. 4. The allele frequency will change in each generation. Differences between reproductive successes of individuals affect the allele frequency in a population. It works like this More organisms are produced than the environment can support Populations remain a constant size (relatively) Thus competition exists between members of a species to survive In any population there is a gene pool (all the alleles of all the genes in that) Some organisms will have allele combinations that make them better for competing thus they are more likely to survive and thus reproduce and pass on their alleles. Thus the advantageous alleles the parents had are more likely to be passed on and the offspring are in turn more likely to survive as they have advantageous alleles Over generations the number of individuals with advantageous alleles increases compared to the dwindling number of disadvantageous alleles So the allele frequency changes, advantageous alleles are more common. What is advantageous is dependent on the environment. The Peppered Moth. These light-coloured moths are well camouflaged from bird predators against pale lichen-covered bark of trees, while rare mutant dark moths are easily picked off. During the industrial revolution in the 19th century, birch woods near industrial centres became black with pollution. In this changed environment the black moths had a selective advantage and became the most common colour, while the pale moths were easily predated and became rare. Kettlewell tested this by releasing dark and light moths in polluted and unpolluted environments and observing selective predation. Since pollution has cleared up in the 20th century the selection has revered again and pale moths are now favoured again over dark ones. Bacterial resistance to antibiotics. Antibiotics kill bacteria, but occasionally a chance mutant bacterium appears that is resistant to an antibiotic. In an environment where the antibiotic is often present, this mutant has an enormous selective advantage since all the normal (wild type) bacteria are killed leaving the mutant cell free to reproduce and colonise the whole environment without any competition. Some farmers routinely feed antibiotics to their animals to prevent infection, but this is a perfect environment for resistant bacteria to thrive. The best solution is to stop using the antibiotic so that the resistant strain has no selective advantage, and may die out. Darwin explained the giraffe's long neck as follows: 1. In a population of animals there would be random genetic variation in neck length. 2. In an environment where there were trees and bushes, the longer-necked animals were slightly better adapted as they could reach more leaves, and so competed well compared to their shorter-necked relatives. These longer-necked animals lived longer, through more breeding seasons, and so had more offspring. 3. The shorter-necked animals would be more likely to lose the competition for food, so would be poorly nourished and would probably die young from predation or disease. They would have few, if any, offspring. 4. So in the next generation there were more long-neck alleles than short-neck alleles in the population. If this continued over very many generations, then in time the frequency of long-neck alleles would increase and so the average neck length would increase.
- 52. 52 Directional Selection occurs when one extreme phonotype (e.g. tallest) is favoured over the other extreme (e.g. shortest). This happens when the environment changes in a particular way. "Environment" includes biotic as well as abiotic factors, so organisms evolve in response to each other. e.g. if predators run faster there is selective pressure for prey to run faster, or if one tree species grows taller, there is selective pressure for other to grow tall. Most environments do change (e.g. due to migration of new species, or natural catastrophes, or climate change, or to sea level change, or continental drift, etc.), so directional selection is common. Stabilising (or Normalising) Selection. This occurs when the intermediate phenotype is selected over extreme phenotypes, and tends to occur when the environment doesn't change much. For example birds’ eggs and human babies of intermediate birth weight are most likely to survive. The mean will not change, the standard deviation will decrease as it selects against the extremes. Disruptive (or Diverging) Selection. This occurs when both extremes of phenotype are selected over intermediate types. For example in a population of finches, birds with large and small beaks feed on large and small seeds respectively and both do well, but birds with intermediate beaks have no advantage, and are selected against. Explain how selection results in an insecticide resistance. Insecticide resistance already in population; (resulting) from mutation; resistant insects are not killed (by insecticide)/survive; reproduce/breed; passing on the relevant allele to the next generation/offspring; resulting in increasing frequency of resistance allele in population Explain what is meant by stabilising selection and describe where it takes place. 1. Occurs in an unchanging environment; 1 2. (Initial range of values in which) mean is best adapted; 3. Selection against extremes / selection for the mean; 4. Mean/median/mode unaltered 5. Range/S.D is reduced; 6. Repeated over many generations; 7. Increasing proportion of populations becomes well adapted to environment; Explain how natural selection produces changes within a species. Variation between members of population/species; predation/disease/competition results in differential survival; some have adaptations that favour survival; survive to reproduce/have more offspring/ pass on their alleles/genes; produces changes in frequency of alleles Explain how resistance to an antibiotic could become widespread in a bacterial population following a gene mutation conferring resistance in just one bacterium. 1. Frequent use of antibiotic creates selection pressure 2. Bacteria with mutation/ resistance have advantage over others 3. (Survive to) reproduce more than other types 4. Pass on advantageous allele/ mutated allele in greater numbers 5. Frequency of (advantageous) allele increases over generations Explain how natural selection favours the evolution of bottom dwelling bacteria containing photosynthetic pigment that absorbs red and blue light most effectively rather than green absorbed by those living near the surface of the water Little green light reaches bottom as absorbed by surface dwellers Red and blue not absorbed and so penetrate; Variation in pigments of sediment dwellers; Bacteria with chlorophyll at an advantage; As chlorophyll absorbs red and blue; (Survive to) reproduce in greater numbers; Pass on advantageous alleles/genes in greater numbers / increase in frequency of advantageous alleles in subsequent generations; Increase in frequency/numbers of bacteria with chlorophyll;
- 53. 53 The sum of all the alleles of all the genes of all the individuals in a population is called the gene pool The Hardy-Weinberg Principle The frequencies of dominant and recessive alleles in a population remain constant over time, so long as five key conditions about the population were met: 1. There are no mutations, so no new alleles are created. 2. There is no immigration /emigration, so no new alleles are introduced/ lost. 3. There is no selection, so no alleles are favoured or eliminated. 4. Mating is random, so alleles are mixed randomly. 5. The population is large, so there are no genetic bottlenecks. These conditions mean that there is nothing to disturb the gene pool; the allele frequencies in the population will remain constant from generation to generation. Before this it was thought that dominant alleles would increase in frequency over time, and recessive alleles would decrease in frequency, but this intuitive idea is wrong. Dominant alleles need not be common. For example the dominant allele for Huntington’s disease is very rare in the population and almost everyone is homozygous recessive. The Hardy-Weinberg principle can be tested by measuring allele frequencies over time, and it is often found that the frequencies do change. This means that the at least one of the five conditions is not true, and the gene pool is not stable. In other words the population is evolving. So the Hardy-Weinberg principle provides a means of detecting evolution, and quantifying the rate of evolutionary change. If the gene pool is stable then we can use a simple equation to calculate the gene frequencies in a population. There are three kinds of frequencies: Phenotype frequencies are proportions of the different characteristics in the population (e.g. red or white). These are the easiest, because we can see and count them in a population. Genotype frequencies are the proportions of the three possible genotypes (BB, Bb and bb) in the population. This isn’t so easy, because we can’t see the genotypes, but we can calculate them. Allele frequencies are the proportions of the two alleles B and b in the population. Allele frequencies are particularly interesting because evolution causes the allele frequencies to change. The two equations you need are (p= frequency of dominant allele/ q = frequency of recessive allele) 1) p + q = 1 (use this when given allele frequencies) 2) p2 + 2pq + q2 = 1 (use when given phenotype/genotype frequencies) In a study of people, the frequency of the I O allele was found to be 0.55 and that of the I A allele, 0.18. What was the frequency of the I B allele in this population? Sum of allele frequencies must be 1 (p + q = 1) so 0.55 + 0.18 + I B = 1 I B = 0.27 A population of 1000 cats has 840 black cats and 160 white cats. Black is dominant and white is recessive. Calculate how many of the black cats were homozygous and heterozygous. We know that q2 = 0.16 (160/1000) We know that p2 + 2pq = 0.84 (840/1000) We can work out the frequency of the dominant and recessive alleles q2 = 0.16 q = 0.4 p + q = 1 p = 1 – 0.4 p = 0.6 Now we can calculate the genotype frequencies p2 so homozygous dominant black cats = 0.6 ×0.6 = 0.36 2pq, heterozygous cats = 2 × 0.6 × 0.4 = 0.48 q2, homozygous recessive white cats = 0.16 So: there were 360 homozygous black cats and 480 heterozygous making the 840 black cats. In the flour beetle, the allele for red body colour (R) is dominant to the allele for black body colour (r). A mixed culture of red beetles and black beetles was kept in a container in the laboratory under optimal breeding conditions. After one year, there were 149 red beetles and 84 black beetles in the container. (a) Use the Hardy-Weinberg equation to calculate the expected percentage of heterozygous red beetles in this population. Total population = 84 + 149 = 233. Black = recessive =q. 84 blacks means q2 = 0.36 (84/233), thus q = 0.6 P = 1 – 0.6 = 0.4 Heterozygotes =2 × 0.6 × 0.4 = 0.48 = 48%
- 54. 54 Homogametic sex: the sex that produces gametes containing sex chromosomes of the same type. Female gametes all have X chromosomes Homologous chromosomes: a pair of chromosomes containing the same gene sequences each derived from one parent Homozygous (pure breed): possessing the same alleles of genes at one or more loci on homologous chromosomes Locus: the position on a chromosome of a gene or other chromosome marker Multiple alleles: genes that have more than two different alleles Phenotype: the features of an individual that result from the expression of the genes and their interaction with the environment Recessive allele: an allele whose effects only show when there are no dominant alleles present. A recessive phenotype is always homozygous. The allele not expressed in the heterozygous state Sex chromosomes: the X and Y chromosomes in human beings which determine the sex of an individual Sex linkage: genes, other than those that determine sexual features, which occupy a locus on one sex chromosome but not the other Test-cross: cross fertilisation carried out between an unknown genotype showing the dominant phenotype and an individual showing the recessive phenotype. Genetics definitions: you may wish to add more to this Alleles: alternative forms of the same gene Autosome: a chromosome not involved in sex determination (human genome has 22 pair’s autosomes and 1 pair of sex chromosomes) Chromosomes: the self-replicating genetic structures of the cell containing the DNA Co-dominant alleles: alleles whose effects both show in the phenotype of a heterozygote (Remember incomplete dominance is where we get a blending of characteristics, breeding a red and white flower gives pink flowers, co-dominance both characteristics are expressed so we would get flowers with red and white spots) Dominant allele: an allele whose effect always shows in the phenotype when it is present, it is the allele expressed in the heterozygous state Gene pool: all the alleles of all the genes in a population of organism, which results in variation Genotype: the alleles of a gene (genetic constitution) an individual inherits Haploid: a nucleus with only a single set of chromosomes Heterosomes: chromosomes involved in sex determination which are different in appearance. In humans that Y chromosome determining male sex characteristics is much shorter than the X. Heterozygous: Possessing different alleles of genes at one or more loci on homologous chromosomes Heterogametic sex: the sex that produces gametes containing sex chromosomes of two types. Males produce gametes with either an X or Y in them
- 55. 55 Individuals can only have two copies of a gene and thus two alleles that may be the same (homozygous [dominant or recessive]) or different (heterozygous). However, there may be more than two alleles of a gene, like blood groups, which have three alleles IA , IB and IO . IA , IB are codominant whilst IO is recessive. Thus there are 6 possible genotypes and 4 possible phenotypes shown in the table across. Monohybrid crosses: A simple breeding experiment involving a single characteristic Test cross: you can see a phenotype but not the genotype. If a person shows the recessive trait, they must be homozygous for the characteristic, but showing a dominant trait they could be homozygous or heterozygous. You can find out which by breeding the unknown with the homozygous recessive. If all the results are dominant, then the parent is likely to be homozygous dominant. There may be some doubt as it is possible that the random nature of fertilisation has just resulted in the dominant allele being passed on, so a large offspring number can help increase the certainty. If the results are mixed then the parent must be heterozygous How genotype controls phenotype Genes are lengths of DNA that code for proteins. It is the proteins that control phenotype as enzymes, pumps and hormones and structural elements Sex determination X and Y chromosomes are non-homologous and are called Heterosomes, whilst the other 22 pairs are autosomes. Males = XY Females = XX Sex linked characteristics The Y chromosomes is small, containing few genes and does little else than determine sex. The X chromosomes is large and contains 1000s of genes. Females have 2 X chromosomes whilst males only have 1 copy, so the inheritance of the genes on the X chromosome is different for males and females, hence this inheritance is sex linked. An example is colour-blindness where XR for dominant, normal colour vision and Xr represent colour blindness. See diagram on the right.
- 56. 56 Co-dominance/Incomplete dominance In most cases one allele is dominant over another and thus we get just two phenotypes. But in some cases there are more phenotypes as neither allele is completely dominant over the other, thus the heterozygote has a phenotype of its own. With co-dominance, a cross between organisms with two different phenotypes produces offspring with a third phenotype in which both of the parental traits appear together. With incomplete dominance, a cross between organisms with two different phenotypes produces offspring with a third phenotype that is a blending of the parental traits.
- 57. 57
- 58. 58 Propagation of the Action Potential Depolarisation of axon membrane causes local currents to be set up These currents cause a change in the permeability of the adjoining region as voltage gated Na + channels open (in adjoining region) Sodium ions enter adjoining region causing depolarisation Repolarisation Sodium channels voltage gates close (absolute refractory: no new action potential can be produced) Potassium voltage gates open Potassium ions leave down electrical/chemical gradient causing Repolarisation; hyperpolarisation (more negative inside the axon than at rest) relative refractory: larger stimulus is required to produce a new action potential Sodium-potassium pump restores resting potential; Resting Potential (-70mv, inside of the axon is negative in relation to the outside) Caused by distribution of ions across membrane controlled by intrinsic protein channels and carriers Sodium potassium pump actively transports sodium out of axon and potassium into the axon Membrane is more permeable to potassium than sodium, sodium gates are closed Potassium diffuses out of the axon Negatively charged proteins are found inside the axon Depolarisation Change in the membrane potential. Inside of neurone becomes positive with respect to outside Voltage Gated sodium channels open Inflow of sodium ions down electrochemical gradient causes depolarisation The ‘all or nothing’ nature of a nerve impulse All action potentials are the same size and have a minimum threshold value for action potential to occur Myelin insulates axon depolarisation so ions can only pass through (plasma membrane of axon) at gaps in myelin sheath (nodes of Ranvier) impulse jumps from node to node (saltatory conduction). In non myelinated neurones depolarisation occurs along the entire length of membrane. Thus energy demand is lower in myelinated neurones as active transport of ions, for maintaining and restoring resting potential occurs only at the nodes, so less ATP required, less respiration needed
- 59. 59 Reflexes (purpose) 1. Automatic (adjustments to changes in environment)/ involuntary; 2. Reducing/avoiding damage to tissues / prevents injury/named injury 3. Role in homeostasis/example; 4. Posture/balance; 5. Finding/obtaining food/mate/suitable conditions; 6. Escape from predators; Transmission at a synapse Presynaptic membrane depolarises; Calcium channels open; Calcium ions enter; Vesicles move to/fuse with presynaptic membrane; Release of transmitter by exocytosis; Diffusion across gap/cleft; Binds to receptors in postsynaptic membrane; Sodium channels open and sodium ions enter postsynaptic membrane G a n g l i o n c e l l s B i p o l a r c e l l s R o d c e l l C o n e c e l l A high degree of visual acuity: Cone cells (responsible for acuity); Each cone cell connected to an individual neurone; idea of light striking each individual cone cell to generate a separate action potential / impulse; very small area of retina stimulated, so very accurate vision; Visual sensitivity in low light levels: Rod cells (responsible for sensitivity); Several rods connected to each bipolar cell; Additive effect of small amount of light striking several rod cells; creating a large enough depolarisation to generate an action potential in the ganglion cell
- 60. 60
- 61. 61
- 62. 62
- 63. 63
- 64. 64 Chemical (ligand) gated: found on the postsynaptic membrane, attachment of a neurotransmitter causes it to open. Some chemicals open sodium channels causing depolarisation (Excitatory) some open potassium channels or chlorine channels causing hyperpolarisation. Stretch mediated: Pacinian corpuscle
- 65. 65 Describe the events which produce an action potential. 1 Stimulus to threshold / critical firing level; 2 Sodium channels/gates open; 3 Sodium ions enter; 4 Down electrical/chemical gradient; 5 Positive feedback; 6 Depolarisation; 7 Inside becomes positive / membrane potential reverses; 8 Potassium channels/gates open; 9 Potassium ions leave; 10 Down electrical/chemical gradient 11 Repolarisation; 12 Sodium channels/gates close; 13 Undershoot / hyperpolarisation; 14 Sodium-potassium pump restores resting potential; Describe the events which allow transmission to take place across the synapse (6) Increased permeability of (presynaptic) membrane to calcium ions; Ca 2+ enter; vesicles fuse with membrane; exocytosis of / release of acetylcholine / neurotransmitter diffuses across synaptic cleft; binds to receptors on postsynaptic membrane / side increased Na + permeability / opens sodium channels / depolarises membrane acetylcholine broken down by acetylcholinesterase; Reflexes: rapid involuntary repsonses to a stimulus. Rapid: Only involves 3 neurones: receptor, relay and effector neurone; myelination: saltatory conduction; Few synapses; chemical / synaptic transmission is slow OR electrical / nervous transmission is fast; Automatic does not necessarily involve passage to brain / only spinal cord; same pathway used each time; higher brain centres not involved / no thinking; How a resting potential is maintained in a neurone. Membrane less permeable to sodium ions gated channels are closed / fewer channels; Sodium ions actively transported out; By sodium ion carrier / intrinsic proteins; Higher concentration of sodium ions outside the neurone; Inside negative compared to outside / 3 sodium ions out for two potassium ions in Negatively charged proteins / large anions inside axon; Explain the importance of reflex actions. 1. Automatic (adjustments to changes in environment)/ involuntary; 2. Reducing/avoiding damage to tissues 3. Role in homeostasis/example; 4. Posture/balance; 5. Finding/obtaining food/mate/suitable conditions; 6. Escape from predators; When pressure is applied to a Pacinian corpuscle, an impulse is produced in its sensory neurone. Explain how. (Pressure) deforms and opens (sodium) channels Entry of sodium ions; Causes depolarisation (generator potential) Ions diffuse downstream and when threshold of nearby voltage gated channels is reached they open and sodium diffuses in causing depolarisation Describe how this action potential passes along the neurone.propagation. (Depolarisation of axon membrane causes) local currents to be set up; Change permeability (of adjoining region) to Na+/ o pen Na+ g ates (in adjoining region); sodium ions enter adjoining region; adjoining region depolarises; This process repeated along axon / self propagation; Correct reference to/description of saltatory conduction; Why impulses along a non-myelinated axon are slower than along a myelinated axon. Non-myelinated – next section of membrane depolarised / whole membrane; myelinated – depolarisation / ion movement only at nodes; impulse jumps from node to node /saltatory conduction The ‘all or nothing’ principle All action potentials are the same size; a minimum threshold value is needed for action potential to occur Transmission of information may be modified by summation. Summation = addition of a number of impulses converging on a single post synaptic neurone; allows integration of stimuli from a variety of sources (spatial summation); allows weak background stimuli to be filtered out before reaching the brain (temporal summation) Functions of the mitochondria in the synaptic bulb. Active transport of ions/ ionic pump; (reject active transport of Ach) Synthesis of acetylcholine / neurotransmitter/ reform vacuole; Reabsorption of acetylcholine, or acetyl + choline (from cleft); Movement of vesicles (to membrane); Synthesis of relevant enzyme, e.g. acetylcholinesterase. Why transmission in myleinated neurones uses less energy. Myelinated leads to saltatory conduction Active transport of ions is used less only at nodes of Ranvier; Less respiration needed less ATP needed; For repolarisation of ion balance;
- 66. 66 Baroreceptors monitor the pressure of the blood flowing into and out from the heart Chemoreceptors monitor the pH of the blood flowing in the heart and the brain Rise in pressure stimulates heart to slow Pressure receptors (baroreceptors) in aorta and carotid sinus send impulses to cardio-inhibitory centre in the medulla Impulses are sent along the vagus nerves of the parasympathetic nervous system to SAN; The release of ACh decreases impulses from SAN and this decreases impulses to AVN decreased stimulation of AVN How exercise causes heart rate to increase Respiration increases CO2 produced acidity of blood increases Detected by chemoreceptors in aortic and carotid bodies and medulla Impulses to cardio accelerator centre More impulses along sympathetic nerves Noradrenaline released at SAN increase heart rate Higher pressure of blood in venous return (muscle contraction stronger) Detected by pressure receptors in aorta and carotid artery Impulses sent to the cardio acceleratory centre More impulses via sympathetic nerves affecting the SAN Changes in the heart rate are controlled by a region of the brain called the medulla. It has 2 regions CAC (linked to the SA node by sympathetic nervous system) – increases heart rate by increasing sympathetic stimulation to the heart releasing noradrenaline at the AVN, SAN and the cardiac fibres. It inhibits parasympathetic stimulation CIC (linked to the SA node by the parasympathetic nervous system): decreases cardiac output by inhibiting stimulation of the heart by the sympathetic system and increasing the activity parasympathetic system, where the vagus nerve release ACH at the SAN Mechanism of a heart beat Cardiac muscle is myogenic SAN sends out a wave of depolarisation across the atria Atrial systole occurs AVN relays the impulse to the ventricles (Impulse is delayed to allow time for the ventricles to fill) Impulse passes to the ventricles travelling down the Bundle of His and up the ventricular walls along the purkyne fibres causing ventricular systole
- 67. 67 Muscles There are three types of muscle: • Skeletal muscle (striated, voluntary) This is always attached to the skeleton, and is under voluntary control via the motor neurones of the somatic nervous system. It can be subdivided into red (slow) muscle and white (fast) muscle. The striated appearance is due to the overlap of thick (myosin) and thin (actin filaments). • Cardiac Muscle This is special type of red skeletal muscle. It looks and works much like skeletal muscle, but is not attached to skeleton, and is not under voluntary control. • Smooth Muscle This is found in internal body organs such as the wall of the gut, the uterus, blood arteries and arterioles. It is under involuntary control via the autonomic nervous system or hormones. Muscles contain about 1000 fibres running the whole length of the muscle, joined together by tendons at the ends Fibres are single muscle cells. They are made from the fusion of many cells. They are multinucleate. They are packed with mitochondria, which provide ATP for contraction and uptake of calcium into the sarcoplasmic reticulum. The sarcoplasm is packed with myofibrils, bundles of filaments. A myofibril is made of repeating dark and light bands. There is a Z line in the middle of the light band and an M line in the middle of the dark band. Under very high resolution the myofibrils are shown to be made of filaments, there are two types, thick (myosin) and thin (actin) Myosin: Thick filament. Each molecule has a tail with two heads at the end. The tails meet at the M line of the A band. The myosin heads contains ATPase, an enzyme complex that hydrolyses ATP ADP + Pi. Actin: thin filament. Chains of globular proteins. 2 chains are twisted round each other. At point of twist, myosin head binding site is located. Actin is associated with two other proteins 1) Troponin: attached at regular intervals along the chain, can bind calcium ions 2) Tropomyosin: lies in the grooves between the actin chains, blocking the myosin binding site Tropomyosin blocks the myosin binding site on the actin filament when the muscle is at rest. When calcium is released it binds to troponin and this causes the tropomyosin to shift position exposing the binding site for myosin.
- 68. 68 Closer look at the myofibril banding pattern I-Band/Light band/Isotropic band: light passes through easily. Contains only actin filaments Dark Z line running down it, where proteins anchor the actin filaments Distance between Z lines = a sarcomere A-band/Dark band/Anisotropic band: Actin and myosin overlap Darker M line down the centre, proteins anchor filaments H-band, region in A band that is less dense as no overlap with actin here, only myosin present. Sarcomeres get shorter when the muscle contracts, so the whole muscle gets shorter. But the dark band, which represents the thick filament, does not change in length. This shows that the filaments don’t contract themselves, but instead they must slide past each other. This sliding filament theory The sarcomere shortens The I bands shortens as actin moves between the myosin The H band shortens or disappears as overlap between 2 filaments increases The A band does not change myosin does not move Energy for muscle contraction Muscle contraction requires ATP; this can be sourced form a variety of places 1) ATP stores in the muscle last for around 2-3 seconds of activity, produced by aerobic respiration 2) Regeneration of ATP from Creatine Phosphate/PC (without respiration). The hydrolysis of PC releases inorganic phosphate and energy which can be used to phosphorylate ADP ATP. This is a coupled reaction as they occur together PC P + C + energy ADP + P + energy ATP 3) From anaerobic glycolysis. This produces lactic acid and some ATP. The build-up of lactic acid means that this process is short lived. The possible reasons for this are….. The change in pH (more acidic) affects the enzymes involved in glycolysis The increases in acidity affect the binding of calcium to troponin.
- 69. 69 Neuromuscular Junction Nerve impulse depolarises the presynaptic membrane Calcium channels opened and calcium ions enter the presynaptic membrane Synaptic vesicles move towards and fuse with, the presynaptic membrane; Release of transmitter substance (Ach skeletal muscles or noradrenaline effcetors associated with the sympathetic nervous system) into synaptic cleft Diffusion of transmitter substance across cleft Attachment to receptor sites on intrinsic protein molecules on post synaptic membrane causes Ion gated sodium channels to open and sodium ion influx down concentration gradient Causing depolarisation of post synaptic membrane/sarcolemma;
- 70. 70 Muscle fibres 1) White/fast twitch: (principally releases energy by anaerobic respiration) Speed of response is more important than sustained contraction Provide rapid and powerful contractions: hydrolyses ATP rapidly (ATP from CP/ATP or Glycolysis) Fewer mitochondria Low density of capillaries Low myoglobin concentration Extensive sarcoplasmic reticulum: rapid release and uptake of calcium More myosin filaments High concentration of anaerobic enzymes CP store Higher concentrations of ATPase than slow twitch so that ATP can be hydrolysed rapidly. Fatigue quickly and accumulate lactic acid 2) Red/slow twitch/tonic muscle fibres (principally releases energy by aerobic respiration) Slower, less powerful sustained contractions (endurance muscles) Many mitochondria (release energy) Dense capillary network (providing oxygen and glucose) High myoglobin (oxygen holding component of muscle) Glycogen store Small diameter giving short diffusion pathway High concentration of enzymes involved in aerobic respiration High resistance to fatigue Explain the advantage of having both fast and slow twitch fibres Fast fibres make immediate contraction possible before the blood supply adjusts Most energy anaerobically generated; fast fibres used in explosive locomotion; slow fibres allow sustained contraction Slow fibres used in maintaining posture/endurance events Respire / release energy aerobically; Or too much lactate would accumulate; Slow twitch fibres adapted to aerobic metabolism; As have many mitochondria; Site of Krebs’ cycle; And electron transport chain; Much ATP formed; Also are resistant to fatigue;
- 71. 71 The I band = actin only (z line is dark line in middle of I band where proteins hold actin in place The A band = actin and myosin overlap. The H-zone is a lighter region within the A band where only actin is present. There is a dark line, the m-line here where proteins hold myosin in place Sarcomere = distance between z-line In contraction: sarcomere gets smaller, H-zone gets smaller, I-band gets smaller but…..the A band remains unchanged Transmission across the neuromuscular junction Nerve impulse depolarises the presynaptic membrane; calcium channels opened and calcium ions enter the presynaptic membrane; synaptic vesicles move towards and fuse with, the presynaptic membrane; release of transmitter substance (Ach skeletal muscles or noradrenaline effcetors associated with the sympathetic nervous system) into synaptic cleft diffusion of transmitter substance across cleft attachment to receptor sites on intrinsic protein molecules on post synaptic membrane causes ion gated sodium channels to open and sodium ion influx down concentration gradient; causing depolarisation of post synaptic membrane/sarcolemma; Describe role of ATP and Calcium in muscle contraction Calcium ions bind to troponin; Remove blocking action of tropomyosin and exposes actin binding sites; Calcium activates myosin ATPase and ATP is hydrolysed allowing myosin to form a cross-bridge ATP is required to break the cross bridge and to remove calcium form the sarcoplasm into the sarcoplasmic reticulum (active transport)
- 72. 72 At rest the tropomyosin blocks the myosin binding site on the actin filament At rest the myosin head ATPase is inactive and the myosin is in its low energy configuration (the head bends back over the myosin tail. The muscle is in a relaxed state The depolarisation of the sarcolemma (an action potential) causes calcium to be released from the sarcoplasmic reticulum. This causes some important changes….. Calcium binds to troponin and causes a conformational change in the troponin- tropomyosin complex to expose the binding sites Calcium activates the myosin head ATPase and hydrolyses ATP. This causes the myosin to change into the high energy configuration where the myosin head is at a right angle to its tail and an acto-myosin cross bridge forms. Note the ADP and Pi remain attached The ADP and Pi are released from the myosin head and it reverts to the low energy configuration (power stroke) and pulls the actin filament across as it goes. The cross bridge is broken when a second ATP molecule attaches to the myosin head The ATP for muscle contraction comes from the following… From ATP stored in muscle (2-3 secs worth) Anaerobic glycolysis leads to lactic acid Aerobic respiration Alactic system, phosphocreatine (PC) Break down of PC releases energy and inorganic P. The inorganic P is attached to ADP using the energy released from PC hydrolysis, this is a coupled reaction. Lactic acid prevents muscle contraction because Affects enzymes involved in ATP production Affects the binding of calcium to protein troponin
- 73. 73 Plants can sense and respond to stimuli. Many of these responses are directional growth responses, called tropisms. Tropisms can be positive (growing towards the stimulus) or negative (growing away from the stimulus) and occur in response to a variety of stimuli: From these experiments (1-3) the Darwins concluded that light is detected only at the shoot tip, and an “influence” was transmitted from the tip down the shoot to cause bending further down. They had no idea what this “influence” was. Frits Went (4-6) showed that the “influence” was a chemical. He knew that seedlings with their tips cut off would not grow, while seedlings with an intact tip would. So he cut off the tips off growing seedlings, placed them on small blocks of agar for two hours, and then placed the agar blocks on top of cut seedlings in the dark. Agar jelly allows chemicals to diffuse through but contains no living cells, and a control experiment using agar blocks that had not been in contact with shoot tips did not promote growth. Went concluded that a chemical substance had diffused from the shoot tip into the agar, and that this substance stimulated growth further down the shoot. He called this substance auxin. In the 1960s Winslow Briggs (7-9) used Went’s method (experiment 6) to assay the amount of auxin in plant material. He found that the greater the amount of auxin, the greater the bending. In the experiments below the numbers refer to the angle of bending and therefore to the amount of auxin. These discoveries are summarised in the Cholodny-Went theory, which states that auxin is synthesized in the coleoptile tip; asymmetric illumination is detected by the coleoptile tip and this causes auxin to move into the darker side; auxin diffuses down the coleoptile; and the higher auxin concentration on the darker side causes the coleoptile to bend toward the light source. Although there is a lot of evidence supporting this theory, it is by no means certain and some recent studies using radioactive tracers have found no difference in IAA concentration on the dark and light sides of a shoot. An alternative mechanism is that IAA is present on both sides but is somehow inhibited on the light side, so there is little growth. How does auxin work? In 1934 auxin was identified as a compound called indoleacetic acid, or IAA. It was the first of a group of substances controlling plant growth responses called plant growth regulators, or PGRs. PGRs are a bit like animal hormones, but the term hormones is not used for plants because PGRs are not made in glands and do not travel in blood. IAA is hydrophobic so it can diffuse through cell membranes and so move around the plant. IAA stimulates growth by: 1. Binding to a receptor protein in the target cell membranes and activating a proton pump. 2. This pump pumps protons (hydrogen ions) from the cytoplasm of these cells to their cell walls. 3. The resulting decrease in pH activates an enzyme that breaks the bonds between cellulose microfibrils. 4. This loosens the cell wall and so allows the cell to elongate under the internal turgor pressure.
- 74. 74 Explain how the body of a mammal may respond to a rise in the environmental temperature. Reducing body temp Hot receptors in skin; nervous impulse; to hypothalamus; blood temperature monitored; heat loss centre involved; vasodilation / dilation of arterioles; more blood to surface / heat lost by radiation; piloerector muscles relax; hairs flatten on skin surface; less insulation; sweating initiated / increased; panting / licking; evaporation removes latent heat; drop in metabolic rate / use less brown fat; accept long term changes such as less fat deposition; thinner fur; migration; accept one behavioural process; Cross-channel swimmers experience a large decrease in external temperature when they enter the water. Describe the processes involved in thermoregulation in response to this large decrease in external temperature. (7) Raising body temp 1. hypothalamus (contains the thermoregulatory centre); 2.has receptors which detect temperature changes of blood; 3.receives impulses from receptors in skin; 4.nerve impulses transmitted (from hypothalamus / brain); 5.results in vasoconstriction / constriction of arterioles / dilation of shunt vessels; 6.diversion of blood to core / specified organ / less blood to skin; 7.muscular contraction /shivering generates heat via respiration; 8.release of thyroxine / adrenaline; 9.increase in metabolic rate / respiration; 10.correct reference to negative feedback mechanisms; Describe the role of insulin in the control of blood glucose concentration. (4) increase in blood sugar leads to lower blood sugar (homeostatic principle)/ (more) insulin secreted; binds to (specific) receptors on (liver/muscle) cells; leads to more glucose entering cells/carrier activity/ increased permeability to glucose; glucose leaves the blood; glucose entering cell converted to glycogen; Describe how a small amount of glucagon in the body could cause a rapid increase in the concentration of glucose in the blood plasma. (3) Ref to cascade / amplification effect; 1 >1 molecule of cyclic AMP formed per glucagon (molecule); each cyclic AMP activates >1 enzyme(molecule) ; each enzyme causes breakdown of >1 glycogen (molecule); each glycogen gives >1 glucose / glycogen is a polymer; glucose diffuses into blood / glucose moves high to low concentration; 12 (b) Explain how the hormone glucagon brings about its changes in the body. It acts on liver cells; causing conversion of glycogen into glucose; via action of an enzyme; gluconeogenesis; Negative feedback An initial stimulus causes a response that reduces the magnitude of the initial stimulus Positive feedback A stimulus causes a response that intensifies the initial input
- 75. 75 Hormones… Chemicals secreted from endocrine glands Carried in the blood stream to their target organs Target organs have specific receptors that compliment the shape of the hormone 2nd Messenger Model/cascade effect of hormones Hormone (1st messenger) does not enter the cell but attaches to a receptor on the cell membrane Attachment starts a cascade system through the action of a second messenger cAMP Example of cascade effect specific to glucagon Attachment of 1 molecule of glucagon activates an enzyme adenylate cyclase 1 Active Adenylate cyclase converts many molecules of ATP to many cAMP’s Each molecule of cAMP activates more than one glycogen phosphorylase enzyme Each glycogen phosphorylase enzyme catalyses the hydrolysis of more than one glycogen molecule Each glycogen molecule is made up of many glucose monomers In this process a small amount of a hormone (glucagon) causes a series of amplified steps that causes a big response. Hormones are…. Small molecules Transported in the plasma Effective in small amounts
- 76. 76 Blood temperature monitored by thermoreceptors in hypotahlamus Environmental temperature monitored by thermoreceptors in skin send impulses to… Environmental temperature monitored by thermoreceptors in skin send impulses to… H Y P O T H A L A M U S Cooling Down Thermoreceptors in skin detect rise in environmental temperature and send impulses to the hypothalamus Thermorecptors in the hypothalamus detect rise in blood temperature Heat loss centre is stimulated (parasympathetic nerves mainly involved) Impulses sent via parasympathetic nerves to the precapillary sphincters in arterioles and they relax causing vasodilation allowing more blood to flow in the capillaries in the surface of the skin causing more heat loss by radiation Impulses along parasympathetic nerves cause erector pilli muscles to relax so hairs lie flat reducing the layer of insulating air Increased impulses along the sympathetic nerves causes an increase in sweating. The high latent heat of vaporisation of water uses heat energy from the body thus cooling the body down. Heat loss by the evaporation of water in sweat. Metabolic rate decreases Warming Up Thermoreceptors in skin detect rise in environmental temperature and send impulses to the hypothalamus Thermorecptors in the hypothalamus detect rise in blood temperature Heat gain centre is stimulated (mainly sympathetic nerves involved here) 2 responses- heat conservation and heat generation Conservation Vasoconstriction impulses sent along the sympathetic nerves cause pre capillary sphincters in arterioles to contract and reduce blood flow in the capillaries supplying the skin. Blood is diverted through the arteriovenous shunt vessel, so less heat loss by radiation occurs. Piloerection impulses along the sympathetic nerves to the erector pili muscles cause them to contract and the hair stands up trapping a layer of insulating air Trapped layer of air warms up and reduces the temperature gradient between the blood and environment. Reduced sweating, impulses via the parasympathetic nerves causes less sweating Generation Shivering- increased muscle activity, increases respiration, releasing heat energy that transfers to blood flowing through the organs. Increased metabolism- due to increase in release of adrenaline from adrenal glands and increased thyroxine from the thyroid glands. Brown fat oxidation (infants and animals). Rich in mitochondria and oxidation of fat releases heat energy. Brown fat is located at the back of the neck and warms blood flowing to the brain
- 77. 77
- 78. 78 P l a s m a g l u c o s e c o n c e n t r a t i o n N o f o o d f r o m t h i s p o i n t o n K e y C h a n g e i n t h i s p e r i o d d u e t o g l u c a g o n C h a n g e i n t h i s p e r i o d d u e t o i n s u l i n T i m e Describe how blood glucose concentration is controlled by hormones in an individual who is not affected by diabetes. Insulin / glucagon secreted by pancreas / islets of Langerhans; Hormone receptors in membrane (of target cells); (insulin stimulates) conversion of glucose to glycogen / glycogenesis: activates / involves enzymes; stimulates uptake by cells; conversion of glucose to lipid / protein; glucagon stimulates conversion of glycogen to glucose;/ glycogenolysis; glucagon stimulates conversion of lipid / protein to glucose / gluconeogenesis; G l u c a g o n R e c e p t o r C e l l s u r f a c e m e m b r a n e A T P C y c l i c A M P G l y c o g e n G l u c o s e A c t i v e e n z y m e I n a c t i v e e n z y m e A d e n y l a t e c y c l a s e } How the cascade effect works with hormones Ref to cascade / amplification effect; >1 molecule of cyclic AMP formed per glucagon (molecule); each cyclic AMP activates >1 enzyme(molecule) ; each enzyme causes breakdown of >1 glycogen (molecule); each glycogen gives >1 glucose / glycogen is a polymer; glucose diffuses into blood / glucose moves high to low concentration; Use evidence from the graph to explain the role of negative feedback in the control of plasma glucose concentration. (5) 1. Deviation of a value from norm initiates corrective mechanisms; 2. Fluctuations in plasma glucose concentration detected by hypothalmus/islet cells in pancreas; 3. Initial decrease, no food given (in plasma glucose) stimulates (increased) secretion of glucagon; 4. Increases (in plasma glucose) stimulate (increased) secretion of insulin; 5. Correct ref. to role of and/or cells as secretors; 6. Correct ref. to interconversion of glycogen / glucose; 7. Increased/decreased uptake of glucose by cells (as appropriate)/correct ref to change in membrane permeability;
- 79. 79 Fasting blood glucose level: this is the amount of glucose in the blood after fasting overnight (about 10hours). It tells us the amount of glucose required by the cells to maintain resting metabolic rate Diabetes is a condition in which there are higher than normal blood glucose levels in the body. Symptoms can be, excessive thirst, hunger and urination. Sweet smelling breath (Ketosis: due to the high level of ketones form fat metabolism), glucose in the urine. Type I- pancreas does not secrete enough insulin Type II – liver no longer responds to insulin Pancreas monitors and controls the BGL The organ has both endocrine and exocrine properties Endocrine secreting hormones into the blood vessels Exocrine properties secreting enzymes into ducts The endocrine tissue of the pancreas is called the Islets of Langerhans. this contains two types of cells Alpha cells Secreting glucagon Causes glycogenolysis (glycogen glucose) Through the action of glycogen phosphorylase Beta cells Secreting insulin Causes glycogenesis (glucose glycogen) Through the action of glycogen synthase Role of insulin Binds to specific receptors on the membrane and opens channel proteins in the membrane increasing the permeability of the cells (mainly in the liver and muscle) to glucose Increases respiration so that more glucose is used Causes the activation of enzymes involved in the conversion of glucose to glycogen (glycogenesis) Causes the conversion of glucose into fat in adipose tissue Role of glucagon Only affects the liver cells Acts through the cascade effect through a second messenger Causes the activation of an enzyme (glycogen phosphorylase) that causes the hydrolysis of glycogen to glucose. It also encourages the formation of glucose from non glucose substrates (amino acids, fatty acids) in a process called gluconeogensis Adrenaline (sometimes called epinephrine) causes increased glycogenolysis
- 80. 80 1. FSH is secreted by the pituitary glands, and stimulates the development of a Graafian follicle in one of the ovaries. This follicle contains a single ovum cell surrounded by other calls. 2. The follicle secretes oestrogen, which stimulates the uterus to rebuild the endometrium wall that has been shed during menstruation. Oestrogen also affects the pituitary gland, initially inhibiting the release of FSH. However, as the follicle gradually develops, the concentration of oestrogen in the blood rises, and it starts to stimulate the release of FSH and LH by the pituitary gland. 3. The sudden surge of LH at about day 14 causes the fully developed follicle to burst, release the ovum in the oviduct – ovulation. LH also stimulates the follicle to develop into a body called the corpus luteum, which secretes progesterone. 4. Progesterone stimulates the uterus to complete the development of the endometrium wall, which is now ready to receive an embryo. Progesterone also inhibits the release of LH and FSH by the pituitary gland, which in turn stops the release of oestrogen and progesterone by the ovaries. 5. The corpus luteum degenerates over the next 10 days, due to prostaglandins produces by the ovary, so less progesterone is secreted. When the concentration of progesterone drops low enough menstruation is triggered. The inhibition of the pituitary gland is also removed, so FSH starts to be released and the cycle starts again. If an egg is fertilised and the embryo implants in the uterus, the embryo secretes a hormone called human chorionic gonadotrophin (HCG). HCG stops the corpus luteum degenerating, so progesterone continues to be produced and there is no menstruation. Progesterone also stops the pituitary releasing FSH, so no more ova are matured during pregnancy. Pregnancy test kits test for the presence of small amounts of HCG in the urine. The menstrual cycle in humans is controlled by four hormones secreted by two glands. • The pituitary gland, below the hypothalamus in the brain, secretes the hormones follicle stimulating hormone (FSH) and luteinising hormone (LH), which target the ovaries. • The ovaries are endocrine organs as well as creating and releasing ova. They secrete the hormones oestrogen and progesterone, which target the pituitary gland and the uterus. The effects of these four hormones are shown in this diagram.
- 81. 81 During the oestrous cycle in a mammal, one or more follicles mature. Ovulation then takes place. Describe the part played by hormones in controlling these events. (6) FSH secreted by pituitary gland; Stimulates growth of follicle; Ovary/follicle cells produce oestrogen; Negative feedback/inhibits secretion of FSH; Oestrogen stimulates secretion of LH/LH from pituitary; LH stimulating ovulation; Second increase in FSH also associated with ovulation; Explain how oral contraceptives containing progesterone and oestrogen work. (5) Oestrogen inhibits FSH; prevents follicle developing; progesterone inhibits LH; also inhibits FSH; inhibits ovulation; FSH and LH bring about ovulation Describe the role of hormones in controlling the development of the changes associated with puberty in girls. (6) Production of FSH/LH/pituitary hormones; Stimulate ovary/follicle development; Producing oestrogen; Oestrogen stimulating breast development; Oestrogen stimulating pelvic girdle growth; Androgen secretion; Androgens responsible for growth spurt/pubic hair development; Growth hormone also involved; Explain how the different components of nervous system are involved in the cooling an animal down (6) (b) Stimulus is increased blood temperature; Increase in temperature results from exercise/respiration/metabolism; Detected by receptors in hypothalamus; Hypothalamus is coordinator; In this case, the heat loss centre; Effectors are muscles; Of arteriole; Response involves vasodilation; Increased blood flow to capillaries; Allowing heat loss by radiation/convection; Correct reference to action potential/nerve impulse; Describe how the body responds to a rise in core body temperature. (5) Temperature receptors stimulated in; (in skin disqualifies) hypothalamus; heat loss centre stimulated; nerve impulses to sweat glands; increase rate of / start sweat production; nerve impulses to skin arterioles; vasodilation (ref to vessels moving disqualifies) Explain how the body of a mammal may respond to a rise in the environmental temperature. Hot receptors in skin; nervous impulse; to hypothalamus; blood temperature monitored; heat loss centre involved; vasodilation / dilation of arterioles; more blood to surface / heat lost by radiation; piloerector muscles relax; hairs flatten on skin surface; less insulation; sweating initiated / increased; panting / licking; evaporation removes latent heat; drop in metabolic rate / use less brown fat; accept long term changes such as less fat deposition; thinner fur; migration; accept one behavioural process;Describe the important differences between the nervous and hormonal co–ordination systems found in a mammal.(4) Rapid / slow; direct / broadcast; short lived/ long term; mainly electrical ; chemical; delivery via nerves / blood vessels; cause depolarisation of target cell membrane / receptors in membrane of target cell; Explain how normal core body temperature is maintained when a person moves into a cold room. (5) 1. Sensors in skin/hypothalmus detect reduced temperature; 2. heat gain centre activated/inhibition of heat loss centre; 3. vasoconstriction/constriction of arterioles in skin surface; (R capillaried) 4. dilation of shunt vessels/constriction of – capillary sphincter; 5. less blood to skin surface/capillaries 6. reduced heat loss by radiation; 7. incresed heat gain by increased metabolic rate/respiration/ movement/shivering; 8. decreased heat loss by putting on clothes/huddling/reduced sweating; During exercise, much heat is generated. Describe the homeostatic mechanisms that restore normal body temperature following vigorous exercise.(5) Receptors in hypothalamus detect increase in core temperature / temperature of blood; Heat loss centre stimulated; Skin arteries / arterioles dilate / vasodilation; Shunt vessels / pre-capillary sphincters constrict; More blood flows to surface (capillaries); Heat loss by radiation; Heat loss by evaporation of sweat; Reduced metabolic rate; Remove clothing / seek cooler area / cold drink;
- 82. 82 Use a gene probe to locate the desired gene Remove using a restriction enzyme Cuts at recognition sequence/restriction site Typically a palindromic sequence GAATTC CTTAAG Can produce sticky ends Or blunt ends Use reverse transcriptase on mRNA from cell producing gene product cDNA formed Use nucleotides and DNA polymerase to make gene Why It’s better to use mRNA Than look for one gene among the many in the nucleus Large amounts of mRNA can be obtained from the cell producing the protein The introns are removed Plasmid = vector A carrier that transfers genetic material from one organism to the next Cut with the same restriction enzyme Gene and plasmid anneal by H- bonds between complementary base pairs DNA ligase forms phosphate sugar bonds in the covalent backbone Getting the recombinant genetic material into the bacteria Heat shock: Incubate, recombinant plasmids, with bacteria and calcium ions at 00 C Raise temperature to 420 C suddenly Low success rate Other methods Electroporation: voltage across cell membrane Or use a virus, adapted to get genetic material inside host cells Gene markers A marker gene is a gene used in molecular biology to determine if a nucleic acid sequence has been successfully inserted into an organism's DNA Selective: targets a feature that normally protects the organism form harm, antibiotic resistance genes Screening Changes organisms appearance (GFP) or metabolism (enzyme marker) Faster than using the selective markers Replica plating Use R- plasmid with resistance to 2 antibiotics Insert desired gene within gene for tetracycline resistance Transformed bacteria have ampicillin resistance not to tetracycline. Grow on ampicillin plate Those that grow have a plasmid (may not be recombinant) Create replica, tetracycline plate Missing colonies have recombinant plasmid Fertility segment removed from the plasmid to prevent conjugation (transfer of genetic material between organisms. Reduces the risk of other organisms getting the gene
- 83. Remember this process has a low success rate. When trying to make recombinant plasmids there are several possible outcomes (recombinant plasmid, reformed plasmid and rings of sample DNA . When trying to transform the bacteria there are three possible outcomes. So we must identify the bacteria that have been transformed 83 Replica plating Bacteria are spread on ampicillin agar to get separate colonies Bacteria containing plasmids will survive Replica plate with tetracycline produced Colonies transferred using nylon/felt material Bacteria growing on ampicillin but not tetracycline have recombinant plasmid Ampicillin plate Tetracycline plate
- 84. 84 Isolation of a gene: 1) Restriction enzymes (restriction endonucleases): The enzymes have very specific active sites that hydrolyse the phosphodiester bond in DNA backbone These cut DNA at specific base sequences (recognition sequences) They are produced naturally by bacteria (defence against viruses) and are named after the bacteria from which they are sourced. There are 1000s of types with unique active sites and hence recognition sequences. These recognition sequences are usually palindromic sequences, meaning that they read the same both ways, they are 4-8 base pairs long. GAATTC CTTAAG Usually they make a staggered cut and produce sticky ends: short sections on unpaired bases (single stranded DNA) Sometimes they cut straight across and make blunt ends The resulting products are called restriction fragments The resulting sticky ends can anneal with other sticky ends produced by the action of the same restriction enzyme DNA ligase Repairs the DNA by joining nucleotides and reforming the phosphodiester bonds in backbone Reverse transcriptase An enzyme produced by Retroviruses, who have their genetic information as RNA. Reverse transcriptase converts RNA to DNA It is used to generate DNA sequences for a gene. Only certain genes are expressed in cells. So if we know what cell expresses the gene we want (e.g. insulin) then we know these cells will have the mRNA for the protein. mRNA is extracted and mixed with reverse transcriptase forming cDNA. The cDNA is heated with DNA nucleotides and polymerase. Why use reverse transcriptase……. 1) The resulting DNA does not have the introns (genes with introns are too big to be incorporated into the bacterial plasmids, plus bacteria cannot splice out the introns, so the cDNA can be expressed by bacteria 2) A large amount of mRNA can be acquired 3) Do not have to locate and cut the gene among the 1000s in the nucleus 4) It forms a stable copy of the gene, as DNA is less easily broken down than RNA
- 85. 85 In Vivo gene cloning (in vivo: means using a whole living organism, not just part, here the plasmid and then bacteria are used to amplify the gene.) We have seen that we can obtain a desired gene by using restriction enzyme to cut at specific palindromic recognition sites/restriction sequences or by using reverse transcriptase to make cDNA from mRNA (removed from a cell that produces a the desired protein). We can determine the gene by gene sequencing or analysing the amino acids making up the protein and working out the codons for these. Now we must use the gene. We can amplify Clone the gene) the amount of it using in vivo techniques or as discussed later, in vitro techniques (PCR). Using in vivo we can both amplify the gene and have the gene expressed. The diagram below shows how a gene can be incorporated into a plasmid using restriction and ligase enzymes. 1. A restriction enzyme is used to cut the gene from the donor DNA, with sticky ends. 2. The same restriction enzyme cuts the plasmid in the middle of one of the marker genes (we’ll see why this is useful later). But use of the same restriction enzyme produces complimentary sticky ends 3. The gene and plasmid are mixed in a test tube and they anneal because they were cut with the same restriction enzyme and have the same sticky ends. 4. The fragments are joined covalently by DNA ligase to form a hybrid vector/recombinant plasmid (in other words a mixture or hybrid of bacterial and foreign DNA). 5. Several other products are also formed: some plasmids will simply re-anneal with themselves to re-form the original plasmid, and some DNA fragments will join together to form chains or circles. These different products cannot easily be separated, but it doesn’t matter, as the marker genes can be used later to identify the correct hybrid vector. Vectors: something that carries genetic material form one organism to another Characteristics The vector must be able to replicate once inside the host It must have more than one recognition site for the restriction enzyme to cut It should have some form of genetic marker to make it identifiable Easily integrated into the host Easy to obtain and handle Plasmids make good vectors because They are big enough to hold the genes we want It is circular so is less likely to be broken down It contains control sequences (transcription promoter) so the gene is replicated and expressed They often contain marker genes in the form of antibiotic resistance that serve as recognition sites for the endonucleases They are separate to the main DNA The negative aspect of using plasmids as vectors is that relatively small genes must be inserted into them Viral vectors Advantages: They are adapted to gain entry to the host cells They are often host specific with regard to infection They can integrate their DNA into that of the host Disadvantages: But they can trigger an immune response Uptake may be sporadic as some viruses (retro viruses) only infect dividing cells The expression of the gene is not always guaranteed as it is not inserted into the chromosome. Why clone a gene? A particular gene can be isolated and its nucleotide sequence determined Control sequences of DNA can be identified & analyzed Protein/enzyme/RNA function can be investigated Mutations can be identified, e.g. gene defects related to specific diseases Organisms can be ‘engineered’ for specific purposes, e.g. insulin production, insect resistance, etc. Genetic fingerprinting
- 86. 86 Advantages of in vivo Very little risk of contamination as it is based around the annealing of complementary sticky ends that must be produced using restriction enzymes, unlikely any contaminating DNA will possess these. Accuracy of copying is greater than that of PCR It can be used to produce active proteins rather than just the gene itself, as the bacteria will translate the gene that has been integrated into its genome. Disadvantages of in vivo Slow process as the gene must be identified; removed, added to the plasmid, then the bacteria must be transformed, identified and cultured The success rate of transformation is very low The success rate of recombination is very low Large amounts of DNA needed Needs pure intact DNA Takes a few days to complete Transformation: Transformation means inserting new DNA (usually a recombinant plasmid) into a living cell (called a host cell), which is thus genetically modified, or transformed. A transformed cell can replicate and express the genes in the new DNA. DNA is a large molecule that does not readily cross cell membranes, so the membranes must be made permeable in some way. There are different ways of doing this depending on the type of host cell. These methods are outlined below Heats shock: host cell and vector are incubated together in a solution containing calcium ions and 00 C. The temperature is suddenly raised to 400 C. This causes some cells to transform. It works well on bacteria and animal cells. Electroporation: high voltage pulse disrupts the membrane and allows the vector to enter Viruses: as mentioned above, mainly as their mechanism of infection relies on getting to genes into a host cell. The viruses must be genetically engineered so they can’t reproduce themselves and they are non-toxic. Micro-Injection. To transform individual cells, such as fertilised animal egg cells, the DNA is injected directly into the nucleus using an incredibly fine micro-pipette. Gene Gun. Tiny gold particles coated with DNA can be fired at plant cells using a compressed air gun. The particles can penetrate the tough cell wall and deliver the DNA to the nucleus. Plant Tumours. Plant cells are infected with a transformed bacterium, which inserts its plasmid into the plant cells' chromosomal DNA. Whole new plants are grown from these cells by micropropagation. Liposomes. Human cells in vivo can be transformed by DNA encased in liposomes, which fuse with the cell membrane, delivering the DNA into the cell. Viruses. Human cells in vivo can be infected by genetically-engineered viruses, which deliver the DNA into host cells. The viruses must first be made it safe, so they can’t cause disease.
- 87. 87 Marker Genes Marker genes (or reporter genes) are used to find which cells have actually taken up the hybrid vector Selective markers: The R plasmid. This plasmid contains the genes for resistance to two antibiotics Tetracycline Ampicilin The restriction enzyme cuts at the gene for tetracycline, The gene is inserted into this gene The plasmid no longer carries the resistance to tetracycline but is still resistant to ampicillin So all bacteria that took up a plasmid (irrespective of whether it is the original reformed plasmids or the recombinant) are resistant to ampicillin. The bacteria are grown on agar containing ampicillin and any that grow have taken up some form of plasmid A replica plate is made but this time it contains tetracycline. So where the bacteria are no missing (didn’t grow on the replica) it means the plasmid they took up was the recombinant plasmid. So replica plating can be used to identify transformed bacteria. Marker genes and Replica plating Bacteria are spread on ampicillin agar to get separate colonies Bacteria containing plasmids (recombinant or original reformed) will survive Replica plate with tetracycline produced Colonies transferred using nylon/felt material Bacteria growing on ampicillin but not tetracycline have recombinant plasmid Identification of transformed cell using gene markers Identification of the cell with the recombinant plasmid Some key things to remember are this………… Some plasmids will have re-joined without taking up the gene we want Some plasmids will now be recombinant Some cells have not taken up any plasmid Some have taken up foreign genetic material (DNA loop) So the cells with the recombinant plasmid must be identified using gene markers The markers can be selective or screening markers. Selective markers: protects the organism from a selective agent that would normally kill it (antibiotics) Screening marker: These markers will make the cell look or behave (metabolically) different.
- 88. 88 Why clone a gene? A particular gene can be isolated and its nucleotide sequence determined Control sequences of DNA can be identified & analyzed Protein/enzyme/RNA function can be investigated Mutations can be identified, e.g. gene defects related to specific diseases Organisms can be ‘engineered’ for specific purposes, e.g. insulin production, insect resistance, etc. Genetic fingerprinting Polymerase Chain Reaction (PCR): (In vitro gene cloning) The amplification of small quantities of DNA This is basically DNA replication in a test tube It requires some key materials DNA polymerase: sourced form thermophilic bacteria, making it very heat stable Free nucleotides: that can form H-bonds with the template strands Primers: short sections of DNA that are complimentary to bases at one of the ends of the DNA. They are crucial as DNA polymerase can only add new nucleotides to an existing chain; it also prevents the original strands from annealing (re-joining), ensures only target sequences are copied, those that lie between the primers Three key stages involved Separation of DNA at 95o C: this is usually done by DNA helicase during in vivo replication. In this process high temperature are used to break the H bonds between the bases. Annealing of primers at 55o C: the mixture is cooled to 55o C and the primers attach to their complementary bases. This provides the starting point for the DNA polymerase to begin copying the DNA Synthesis of DNA: the temperature is raised to 720 C. This is the optimum temperature for the DNA polymerase; it begins to add free nucleotides to the primers. Heat stable DNA polymerase is used as it can work at a higher temperature and so the reaction takes place faster The whole cycle takes about 2 minutes meaning that a lot of DNA can be rapidly produced. Advantages of in vitro Small amounts of genetic material can be used and amplified The amplification is rapid Degraded (damaged/old DNA can be used) Can be completed in a few hours Disadvantages of in vitro Any contamination is amplified It takes time to make primers and DNA sequence must be known at least in part Increased frequency of copying error Any copying errors will be copied at each subsequent cycle DNA is not expressed
- 89. Advantages of in vitro Small amounts of genetic material can be used and amplified The amplification is rapid Degraded (damaged/old DNA can be used) Can be completed in a few hours Disadvantages of in vitro Any contamination is amplified It takes time to make primers and DNA sequence must be known at least in part Increased frequency of copying error Any copying errors will be copied at each subsequent cycle DNA is not expressed Advantages of in vivo Very little risk of contamination as it is based around the annealing of complementary sticky ends that must be produced using restriction enzymes, unlikely any contaminating DNA will possess these. Accuracy of copying is greater than that of PCR It can be used to produce active proteins rather than just the gene itself, as the bacteria will translate the gene that has been integrated into its genome. Disadvantages of in vivo Slow process as the gene must be identified; removed, added to the plasmid, then the bacteria must be transformed, identified and cultured The success rate of transformation is very low The success rate of recombination is very low Large amounts of DNA needed Needs pure intact DNA Takes a few days to complete Why clone a gene? A particular gene can be isolated and its nucleotide sequence determined Control sequences of DNA can be identified & analyzed Protein/enzyme/RNA function can be investigated Mutations can be identified, e.g. gene defects related to specific diseases Organisms can be ‘engineered’ for specific purposes, e.g. insulin production, insect resistance, etc. 89
- 90. 90 Transcription (DNA mRNA) The start of each gene is marked by a promoter (sequence of bases) Section of DNA unzips (H-bonds break, DNA helicase) Free RNA nucleotides line up to complementary bases on the antisense strand U replaces T in mRNA RNA polymerase joins the nucleotides Pre mRNA strand is formed Pre mRNA is modified, introns removed, exons spliced by enzymes Mature mRNA leaves the nucleus Compare replication and transcription Alike H bonds break/DNA unwinds/DNA unzips; between (complementary) bases; DNA acts as a template for complimentary base complementary nucleotides/bases added/DNA acts as template; same, correctly named, enzymes e.g. polymerase; Different Uracil replaces thymine all copied in replication or only section copied in transcription Only one strand is used as a template in transcription (antisense strand), both strands are used in replication RNA polymerase in transcription whereas DNA polymerase is sued in replication mRNA is produced in transcription, DNA is produced in replication
- 91. 91 Translation (protein synthesis) mRNA moves into cytoplasm through nuclear pore to ribosome; mRNA read in codons / triplets anticodon of tRNA which is complimentary to the codon of mRNA matches up; The tRNA carries specific amino acid; ATP used in activation / joining amino acids; amino acids join by peptide bonds; In condensation recations This requires energy tRNA used repeatedly as it is released and collects another amino acid; sequence of bases / codons determines sequence of amino acids the primary structure of the protein
- 92. Transcription factors Switch on the desired gene These are activated from an inactive form By hormones usually (oestrogen example) Transcription factor attaches to promoter region by gene to be transcribed Transcription initiation complex forms RNA polymerase can attach Transcription (DNA mRNA) The start of each gene is marked by a promoter (sequence of bases) Section of DNA unzips (H-bonds break, DNA helicase) Free RNA nucleotides line up to complementary bases on the antisense strand U replaces T in mRNA RNA polymerase joins the nucleotides Pre mRNA strand is formed Pre mRNA is modified, introns removed, exons spliced Mature mRNA leaves the nucleus Translation (protein synthesis) mRNA enters the ribosomes Read as base triplets (codons) tRNA with complementary anticodon Carries specific amino acid Peptide bonds form between adjacent amino acids (condensation reaction) ATP is required 92 siRNA: this is involved in post transcriptional regulation of translation. siRNA is formed from the hydrolysis of longer pieces of double stranded RNA. It is then split into single strands by an endonuclease. The passenger strand is no longer required and the guide strand is incorporated into the RNA Interference Specificity Complex (RISC). This complex moves to a region on the mRNA stand with a complementary base sequence and the mRNA is then cleaved, thus preventing translation.
- 93. Mutation: change in the structure or quantity of genetic material. Occur naturally, but the frequency can be increased by mutagenic agents like: X-rays, Benzene, Uranium, Gamma Rays, UV light, high energy radiation The length of exposure and the size of the dose may influence whether mutations occur DNA base sequence determines the mRNA sequence; this determines the order of amino acids assembled at the ribosomes. The primary structure determine how H-bonds form between the amino acids during folding for the secondary structure, further folding then ensues to form the tertiary structure of the protein. Silent mutations do not result in a change to the amino acid sequence of a protein. They may occur in a non- coding region (outside of a gene or within an intron), or they may occur within an exon in a manner that does not alter the final amino acid sequence. This happens when the change is on the third base of a codon, due to the degeneracy of the genetic code, most amino acids have more than one codon, differing only in the third base. So the genetic code is more likely to tolerate mutations in the third base This mutation alters the codon so that when it is transcribed a different amino acid will be put in place. This can have a big effect if the amino acid is crucial to the bonding in folding of the protein or if it acts as a part of the active site of an enzyme. However, if an amino acid with similar properties is coded for, or the amino acid was not involved in the folding of the chain or the functioning of the enzyme, then it may not be a serious mutation. With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the STOP codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA 93
- 94. transcribed from this mutant gene will stop prematurely. The earlier in the gene that this occurs, the more truncated the protein product and the more likely that it will be unable to function. This is caused by addition or deletion of bases. Changes the way the codons are read (causes a frame shift) and as such changes the primary sequence of amino acids. This will affect the folding of the protein and may result in a non-functioning protein. CFTR protein in cystic fibrosis is a result of deletion 94
- 95. 95 Electrophoresis Separates DNA (restriction fragments) due to differences in the length. Short fragments will travel further than long fragments in a given time It uses an aragose or polyacrylamide gel covered in a buffer solution It works because an electric current is applied across the gel, and the nucleotides contain a negatively charged phosphate group, so DNA moves toward the positive anode. Visualising the DNA Staining: using chemicals to stain the DNA blue or fluorescent molecules so the DNA appears under UV light. These chemicals are included in the gel and are picked up by the DNA as it diffuses through the gel Radiolabelling (autoradiography): DNA samples are radioactively labelled with an isotope of phosphate (P32 ). When the gel is completed, photographic film is placed on top of the gel in the dark for a few hours. The radiation exposes the film and the DNA shows up as dark bands. Restriction mapping A restriction map is a diagram of a piece of DNA marked with the locations of sites where it is cut by restriction enzymes. A piece of DNA is cut with two different restriction enzymes, both on their own, and together. This gives three different mixtures of restriction fragments, which are run on an electrophoresis gel (labelled E1, E2 and E1+E2 on the gel below). The first lane on this gel contains a “DNA ladder” – a mixture of DNA fragments of known sizes – which is used to calibrate the gel. By comparison with the ladder bands, the length of each restriction fragment can be measured (marked in kilobases, kb on this diagram). From this information alone we have to deduce the restriction map. Firstly, the fragment lengths in each lane add up to 17, so we know the original DNA was 17kb long. There must be two recognition sites for restriction enzyme 1 (E1), since it gave three bands, while there must be just one recognition site for restriction enzyme 2 (E2), since it gave two bands. By a process of logic, we can construct the restriction map (on left) to account for the banding pattern. 1Kb = 1000 bases
- 96. How a genetic finger print is carried out and how it can be used 99.9% of the DNA in humans is the same. The 0.1% ( over 100,00 base pairs) shows enough variation to distinguish individuals. Differences occur in non-coding DNA due to mutations that can accumulate in these regions as they do not affect function. Makes use of regions of genetic material, called introns that contain regions of repeating sequences Satellites: any DNA with repetitive sequences Tandem repeat: simple sequences of bases in DNA repeated without break Short tandem repeats/microsatellites: a tandem repeat with a sequence <10bases Minisatellite: tandem repeats with a sequence of 10-60 bases Variable non tandem repeats/VNTRs): region of DNA with a particular tandem repeat. Everyone has the same repeating sequence in this region; the number of repeats varies from individual These VNTRs are unique to an individual These are inherited, but the combinations inherited are random, but when compared against parent DNA there is some comparable sequences. The process The DNA is extracted in a solvent of chloroform and phenol The DNA is cut to fragments Using restriction enzymes Different sized fragments are separated by gel electrophoresis. Smaller fragments travel further DNA double strands separated by alkali DNA Transferred to nylon membrane (Southern Blotting, described in line below) and fixed by UV light Nylon membrane placed onto gel, towels on top of that, weight to get good contact between membrane and gel. Paper absorbes the alkali and draws up –ve DNA which sticks to the +ve membrane Radioactively/fluorescently labelled DNA probes are applied and anneal with complementary base sequences. 96
- 97. Visualisation of the DNA is then done by, autoradiography (when using radioactive probes) or UV light (when using fluorescence) 97 Gene/DNA probes Short single strands of DNA They are radioactively/fluorescently labelled Complimentary to at least part of the target gene They will then hybridise with the restriction fragments that have been separated by electrophoresis and contain the complimentary sequences Identification either by Autoradiography or fluorescence Southern Blot: used to detect a specific target sequence in DNA. IN a gel the DNA is fragile and also it continues to diffuse through the gel and this can blur the bands. In a blot the DNA is fixed so the target gene can be identified. 1. DNA is extracted and amplified by PCR 2. DNA is digested by restriction enzymes 3. Restriction fragments are separated using gel electrophoresis 4. Gel is placed in an alkali (this separates the DNA breaking H- bonds) 5. A nylon/nitrocellulose sheet is placed on top of the gel and covered with paper towels and pressed down with a weight to ensure a good contact 6. The alkali is drawn up by the towels and takes the DNA with it. The negative DNA adheres to the positive nylon sheet 7. Nylon sheet is peeled off and treated with UV light to fix the DNA 8. Sheet is placed in a bag of DNA probes that will anneal to specific complimentary base sequences if present 9. The hybridised DNA must then be visualised by autoradiography or fluorescence Uses of southern blotting Identify the few restriction fragments with complementary sequences, out of the 100s of fragments produced Identify genes in one species that are similar to those in another for purpose of classification Used in genetic finger prints Screen for genetic diseases
- 98. 98 tRNA vs mRNA tRNA (carries amino acids with complementary anticodon to mRNA codon) Clover shaped Standard length Has an amino acid binding site Anticodon tRNA has H bonds between complementary base pairs Limited number of types (64) mRNA (carries information from the Nucleus to the ribosome) Linear Variable length (depends on the length of gene) Many different types (depends on the gene) No H-bonding No base pairs DNA Vs RNA Similarities: Contain phosphate Made up of nucleotides Contains organic bases (A, C and G) (not T as it is replaced by U in RNA) Pentose sugar Differences RNA single stranded RNA has non-coding strands (introns) removed Ribose sugar in RNA deoxyribose in DNA U in ribose replaces the T 3 types of RNA, only one DNA Smaller than DNA Describe the features of a gene Gene is a short (length) of DNA; Gene is a sequence of bases/chain of nucleotides; Triplet (base) code (codon) On sense/coding strand; Each triplet coding for amino acid; Degenerate code, where most amino acids have more than one codon. Of the 64 codons 1 is a start (methionine, which is often removed) and 3 are stop codes Non-overlapping where each base is part of one codon Sequence of triplets/bases code for protein Give ways in which the structure of the DNA molecule enables it to carry out its functions. Sugar – phosphate backbone gives strength; Coiling gives compact shape; Sequence of bases allows information to be stored; Long molecule / coiling stores large amount of information; Complementary base pairing enables information to be replicated or transcribed; Double helix protects weak hydrogen bonds / double helix makes molecule stable; Many hydrogen bonds together give molecule stability; Prevents code being corrupted; Hydrogen bonding allows chains to split easily for replication / transcription Explain how DNA replicates Hydrogen bonds broken by DNA helicase semi-conservative replication where both strands used (as templates) nucleotides line up to their complementary base pairing , H-bond DNA polymerase; joins the nucleotides Describe the molecular structure of DNA Associated with histone proteins Double helix Polymer of nucleotides; composition of a nucleotide as pentose, phosphate and base 4 bases named ATCG sugar-phosphate ‘backbone’; two (polynucleotide) strands running antiparallel specific base-pairing; example e.g. A–T / C–G held by hydrogen bonding;
- 99. Base sequencing (Sanger Method) Used to determine the exact order of bases in a gene. Uses modified nucleotides; they have an oxygen removed (dideoxynucleotides) and can only bond with one other nucleotide. These bases act as terminators in DNA synthesis Four tubes are set up containing Primers (labelled) Normal nucleotides (A, T, C, G) DNA polymerase The DNA to be sequenced Into tube 1, modified base A is added Into tube 2, modified base T is added Into tube 3, modified base C is added Into tube 4 modified base G is added As the binding of the nucleotides (normal or modified) is equally likely in all tubes chains of different lengths are created in each test-tube. But in each test tube all the chains have the same last nucleotide. These chain fragments can be separated by gel electrophoresis. The negatively charged DNA is attracted to the positive terminal on the gel. Shorter chains travel a further distance. DNA to be sequenced: CTGACTTCGACAA Primer attached TGTT (primer) 99 In tube 1 possible chains are TTGTTGA TTGTTGAA TTGTTGAAGTCA TTGTTGAAGTCAG In tube 2 possible chains are… TTGTCGAAGT TTGTCGAAGTCAG The base sequence for the gel shown on the right side of the page is as follows (start from the bottom (shortest chain) and read up the page) TCCTAAGTCCTCCGGATGGTACTTCTAGTTC But this is the complementary bases for the original strand, so the actual sequence for the desired gene is the complementary strand to this AGGATTCAGGAGGCCTACCATGAAGATCAAG
- 100. 100
- 101. 101 GM Crops Nitrogen fixing ability Increased nutritional value Longer shelf life (reduced softening) Disease resistance Pesticide resistance (produce toxin) Herbicide resistance Tolerance to extreme conditions GM Bacteria Produce antibiotics, bacteria will do this naturally but are altered to do it faster and in greater quantities. Produce useful hormones (insulin produced this way is more effective than animal insulin, safer, no rejection and preserves animal welfare Enzymes for the food industry GM Animals Pharming/transgenic, to produce pharmaceuticals Xenotransplantation, transfer organs or tissues form animal to humans. Animals are engineered to reduce rejection Disease resistance Growth hormones Genetic engineering has made it possible to transfer genes from one species to another. For example, a gene that gives resistance to herbicide and another gene which gives resistance to insect attack have been transferred into maize. Some people think that there will be great advantages in growing maize with these genes. Others are equally convinced that there are long-term dangers in growing crops of this maize. Evaluate both of these viewpoints. Positive: Fewer crops lost to insect damage Fewer crops lost to diseases spread by insects; Can spray herbicide with no loss to crop and this will reduce competition from weeds increasing yield Less use of insecticide required, which is better for the environment and will not impact upon other food chains Possibly cheaper food as farmer loss and input is not as high Negative: Gene transfer to non-crop species creation of “plague” weeds resistant to the herbicide Transfer of insecticide genes into non crop species may affect food chains Selects for the development of insects resistant to the pesticide Encourage an excessive use of herbicides which may affect the environment New allergens created A new variety of tomato has been produced by genetic engineering. This variety contains a synthetic gene that blocks the action of a natural gene that would make the fruit soften rapidly once ripe. It also contains a marker gene. The marker gene added by the scientists makes this variety of tomato resistant to the antibiotic, kanamycin. It is possible that this gene could be taken up by disease-producing bacteria in the human gut. In humans, kanamycin is used to treat certain types of gut infections. Using information from the passage, explain the advantages and disadvantages of putting this new variety of tomato on the market. advantages e.g.: food stays firm for longer; allowing shipment and reducing losses longer shelf life; greater profit for the producer and possibly cheaper food for the consumer disadvantages e.g. transfer of mutant gene to bacteria / gut bacteria might become resistant to kanamycin; more difficult to treat gut infection; consumer resistance to GM food; long term effects unknown Improving tolerance may mean growing crops in regions they normally wouldn’t grow, may solve food shortage and malnourishment, but may affect the economy of countries that relay on the export of these crops. The crop may become a pest affecting delicate ecosystem. Hormones from GM bacteria: Insulin is produced this way. Previously it was obtained from animals, but this meant animal welfare was poor, there was a risk of passing on pathogens, risk of rejection and as it was from animals it was not as effective. Using insulin made form bacteria means that these issues are resolved and also it can be produced in large quantities quickly and cheaply GMO: produced in 3 ways: Alter the genes Delete/switch off a gene Add a foreign gene
- 102. 102 Organism Modification Long life tomato There are two well-known projects, both affecting the gene for the enzyme polygalactourinase (PG), a pectinase that softens fruits as they ripen. Tomatoes that make less PG ripen more slowly and retain more flavour. The American “Flavr Savr”tomato used antisense technology to silence the gene, while the British Zeneca tomato disrupted the gene. Both were successful and were on sale for a few years, but neither is produced any more. Insect resistant crops Genes for various powerful protein toxins have been transferred from the bacterium Bacillus thuringiensis to crop plants including maize, rice and potatoes. These Bt toxins are thousands of times more powerful than chemical insecticides, and since they are built-in to the crops, insecticide spraying (which is non-specific and damages the environment) is unnecessary. Virus resistant crops Gene for virus coat protein has been cloned and inserted into tobacco, potato and tomato plants. The coat protein seems to “immunise” the plants, which are much more resistant to viral attack. Herbicide resistant crops The gene for resistance to the herbicide BASTA has been transferred from Streptomyces bacteria to tomato, potato, corn, and wheat plants, making them resistant to BASTA. Fields can safely be sprayed with this herbicide, which will kill all weeds, but not the crops. However, this means continued use of agrochemicals, so is controversial. Pest resistant legumes The gene for an enzyme that synthesises a chemical toxic to weevils has been transferred from Bacillus bacteria to The Rhizobium bacteria that live in the root nodules of legume plants. These root nodules are now resistant to attack by weevils. N fixing crops This is a huge project, which aims to transfer the 15-or-so genes required for nitrogen fixation from the nitrogen-fixing bacteria Rhizobium into cereals and other crop plants. These crops would then be able to fix their own atmospheric nitrogen and would not need any fertiliser. However, the process is extremely complex, and the project is nowhere near success. Crop improvement Proteins in some crop plants, including wheat, are often deficient in essential amino acid (which is why vegetarians have to watch their diet so carefully), so the protein genes are being altered to improve their composition for human consumption. mastitis-resistant cattle The gene for the enzyme lactoferrin, which helps to resists the infection that causes the udder disease mastitis, has been introduced to Herman – the first transgenic bull. Herman’s offspring inherit this gene, do not get mastitis and so produce more milk. Tick resistant sheep The gene for the enzyme chitinase, which kills ticks by digesting their exoskeletons, has been transferred from plants to sheep. These sheep should be immune to tick parasites, and may not need sheep dip. Fast growing fish A number of fish species, including salmon, trout and carp, have been given a gene from another fish (the ocean pout) which activates the fish’s own growth hormone gene so that they grow larger and more quickly. Salmon grow to 30 times their normal mass at 10 times the normal rate. Environment cleaning microbes Genes for enzymes that digest many different hydrocarbons found in crude oil have been transferred to Pseudomonas bacteria so that they can clean up oil spills. Benefits: Medicines and drugs can be produced safely in large quantities from microbes rather than from slaughtered animals. Benefit humans and can spare animal suffering as well. Agricultural productivity can be improved while using less pesticides or fertilisers, so helping the environment. GM crops can grow on previously unsuitable soil or in unsuitable climates. GM crops can improve the nutrition and health of millions of people by improving the nutritional quality of their staple crops. Risks • Genetic modification of an organism may have unforeseen genetic effects on that organism and its offspring. These genetic effects could include metabolic diseases or cancer, and would be particularly important in vertebrate animals, which have a nervous system and so are capable of suffering. The research process may also harm animals. • Genes transferred into GMOs could be transferred again into other organisms, by natural accidents. These natural accidents could include horizontal gene transmission in bacteria, cross-species pollination in plants, and viral transfer. This could result in a weed being resistant to a herbicide, or a pathogenic bacterium being resistant to an antibiotic. To avoid transfer via crosspollination, genes can now be inserted into chloroplast DNA, which is not found in pollen. • A GMO may have an unforeseen effect on its food web, affecting other organisms. Many ecosystems are often delicately balanced, and a GMO could change that balance. • GMOs may continue to reduce the genetic biodiversity already occurring due to selective breeding. •. There could be unexpected and complicated social and economic consequences from using GMOs. For example if GM bananas could be grown in temperate countries, that would be disastrous for the economies of those Caribbean countries who rely on banana exports. • Developing GMOs is expensive, and the ownership of the technology remains with the large multi-national corporations. This means the benefits may not be available to farmers in third world countries who need it most. Evaluating Biotechnology: The whole point of creating GMOs is to benefit humans. Opposition is often based on ethical, moral or social grounds, such as harm to animals or the environment, though there can also be more practical issues, such as distrust of large corporations.
- 103. 103 The purpose of genetic modification is usually to benefit humans in many ways…… Increase crop yield by introducing herbicide resistance, pesticide production and disease resistance) Improve nutritional value of crops Develop crops that can grow in inhospitable environments Making vaccines Making medicine GM Bacteria: Modified to increase the rate of antibiotic production Produce enzymes for use in industry Lipases for cheese manufacture, proteases to tenderise meat/baby food) and amylases for brewing Modified to produce hormones (insulin and growth hormones and sex hormones) Bacteria can now produce human insulin for use in treating diabetes. This is better than using animal insulin because… Protects animal welfare, the insulin is more specific and thus effective, it can be produced in large amounts, and the required amount, it is less likely to cause an immune response GM crops Modified in a variety of ways… Tomatoes modified to prevent ripening allowing them to stay longer on the vine and still be transported without damage and consequent loss of product Herbicide resistance Disease resistance Pest resistant: gene added so that the plant can produce a toxin to kill the pest GM animals Modified in a variety of ways Genes for resistance to diseases Growth gene added for a rapid growth Genes added so animals produce medically useful proteins in their milk GM crops Benefits: Less crop damage/loss by insects, increase yield, reduce consumer costs Less competition from weeds as herbicide can be used, increase yield reduces consumer costs Pesticide production means less use of pesticide spraying, protects environment as many pesticides are broad spectrum and affect non target species, affecting food chains. Improve nutrition in countries that can grow limited crops and that have limited food GM crops Concerns: New allergens being produced Selection for pesticide resistant insects leading to increased cost of developing new pesticides in future and possible surges in some insect populations Transfer of added genes to non-crop species, cross species pollination, producing super weeds (resistant to herbicides) and affecting natural wildlife and food chains GM crops can be made infertile, but then farmers need to buy new seeds every year, so cost goes up for consumers Disrupt economy of some countries that relay on exporting produce that does not grow in certain countries. If they can now grow the crop themselves this may affect the economy. Herbicide resistance encourages excessive use by farmers which then affects the environment Transfer of genes into gut micro flora and how this may affect bacteria, increasing resistance??? GM animal’s benefits Rapid growth means quick turn over for farmer maximising profits, cheaper food for consumer Initially expensive to modify animal, but with embryo cloning cheap source of medical proteins and a large supply GM animal’s concerns Animal welfare neglected as animals grow rapidly they suffer with heart, breathing and joint issues Risks to the organism and it’s offspring such as metabolic disorders and cancer Research harms animals initially
- 104. 104 Gene therapy: the insertion of gene into the cells and tissues of individuals to treat genetic disorders. Types of Gene Therapy It is important to appreciate the different between somatic cell therapy and germ-line therapy. • Somatic cell therapy means genetically altering specific body (or somatic) cells in order to treat the disease. This therapy may treat the disease in the patient, but any genetic changes will not be passed on the offspring of the patient. • Germ-line therapy means genetically altering those cells (sperm cells, sperm precursor cells, ova, ova precursor cells, zygotes or early embryos) that will pass their genes down the “germ-line” to future generations. Alterations to any of these cells will affect every cell in the resulting human, and in all his or her descendants. Treatment using gene therapy Gene replacement: a healthy gene replaces a defective gene Gene supplementation: copies of the healthy gene are added alongside the defective gene. The added dominant genes mask the effect of the recessive allele. Problems of Gene Therapy • Most gene therapy attempted so far has had only a short-lived effect. Problems with integrating the therapeutic DNA into the host cell, and of replicating new DNA when the host cell divides, have meant that patients have to repeat the gene therapy treatment at intervals. • Therapeutic DNA and modified host cells are recognised as non-self by the immune system and so destroyed in a primary immune response. Subsequent repeated treatments stimulate a greater secondary immune response, which can be harmful to the patient. • There is a chance that the therapeutic DNA is integrated in the host genome in the middle of another gene, for example in a tumour suppressor gene. • Viruses are the most successful vectors in gene therapy but they also present a variety of potential problems to the patient including toxicity, immune and inflammatory responses and recovery of pathogenicity. •Multigene disorders are probably impossible to treat effectively using gene therapy. Liposome aerosols may not be fine enough the reach the bronchioles Few of the delivered genes are expressed The uptake of the therapeutic gene is low Cystic fibrosis: This is caused by a recessive mutant allele, where three bases, AAA are missing (a mutation resulting from deletion). The normal gene (the cystic fibrosis trans-membrane conductance regulator) CFTR produces a protein of some 1480 amino acids. The deletion results in the absence of a single amino acid, but as such the protein cannot perform its function of transporting chloride ions out of cells across the membrane. Water will normally follow as a result (osmosis) and epithelial membranes are kept moist. In CF sufferers, the protein is either not made or does not function. The epithelial membranes are dry and thus the mucus is sticky and thick. The symptoms include……………. Mucus congestion in the lungs leading to risk of chest infection (cilia can’t shift the mucus) Breathing difficulties and less gas exchange Thick mucus in pancreatic ducts preventing enzymes form reaching the small intestine (duodenum) and fibrosis cysts form. Thick mucus in the sperm ducts of a male, possibly leading to infertility. Parents can be genetically screened to see if they carry the gene. The correct gene (the therapeutic DNA) needs to be introduced into human cells, where it can be expressed. Some of the most common methods are: • Liposomes. The therapeutic DNA is encased in a lipid vesicle called a liposome. The liposome membrane then fuses with the cell membrane, delivering the therapeutic DNA into the cell. • Viruses. Normal viral infection depends on the virus delivering its own DNA into host cells, where it can be expressed to make new virus particles. So genetically-modified viruses can be used to deliver human genes by the same method. The virus must first be genetically engineered to make it safe, so that it can’t reproduce itself or make toxins. • Stem cells. In some cases stem cells can be removed from the patient (e.g. from bone marrow), genetically modified in vitro with the therapeutic DNA, then the stem cells injected back into the patient. This method is safer and avoids immune rejection, but only works for some tissues. SCID (severe combined immunodeficiency): sufferers cannot make ADA (adenosine deaminase) that breaks down toxins in white blood cells.
- 105. 105
- 106. 106 Totipotent: stem cells that can differentiate into any type of cell (embryos <32 cells) Pluripotent: stem cells that can differentiate into nearly all cells (5 day old embryo) Multipotent: stem cells that develop into a related family of cells. Adult stem cell, these are used to repair and replace damaged tissue