2011-Molecularmarker (1).ppt
- 1. GENETIC MARKERS IN PLANT BREEDING
- 2. Marker Gene of known function and location Gene that allows studying the inheritance of that gene Genetic information resides in the genome Genetic Marker Any phenotypic difference controlled by genes, that can be used for studying recombination processes or selection of a more or less closely associated target gene Anything in the genome that is variable and can be used to compare individuals Detectable allelic variation on a chromosome can be a phenotype, can also be a unique detectable sequence of DNA
- 3. Genetic Marker Morphological marker Molecular marker 1. Protein marker 2. DNA marker
- 4. Morphological Marker hulled naked Black white •Phenotypic markers •Naked eye marker
- 5. Readily detectable sequence of protein or DNA that are closely linked to a gene locus and/or a morphological or other characters of a plant Readily detectable sequence of protein or DNA whose inheritance can be monitored and associated with the trait inheritance independently from the environment Molecular Markers Types: a) protein polymorphisms b) DNA polymorphisms
- 6. Molecular markers allozymes (protein-electrophoresis) RAPD (random amplified polymorphic DNA) AFLP (Amplified Fragment Length Polymorphism) Multi-locus fingerprints (RFLP) Microsatellites (SSRs) Sequencing (SNPs)
- 7. Allozymes: Isoenzymes of protein nature whose synthesis is usually controlled by codominant alleles and inherited by monogenic ratios Isozymes: A species of enzyme that exists into two or more structural forms which are easily identified by their activities Proteins Markers
- 8. DNA Gene A Gene B AACCTGAAAAGTTACCCTTTAAAGGCTTAAGGAAAAAGGGTTTAACCAAGGAATTCCATCGGGAATTCCG MFG 1 ccacgcgtcc gtgaggactt gcaagcgccg cggatggtgg gctctgtggc tgggaacatg 61 ctgctgcgag ccgcttggag gcgggcgtcg ttggcggcta cctccttggc cctgggaagg 121 tcctcggtgc ccacccgggg actgcgcctg cgcgtgtaga tcatggcccc cattcgcctg 181 ttcactcaga ggcagaggca gtgctgcgac ctctctacat ggacgtacag gccaccactc 241 ctctggatcc cagagtgctt gatgccatgc tcccatacct tgtcaactac tatgggaacc 301 ctcattctcg gactcatgca tatggctggg agagcgaggc agccatggaa cgtgctcgcc 361 agcaagtagc atctctgatt ggagctgatc ctcgggagat cattttcact agtggagcta 421 ctgagtccaa caacatagca attaaggtag gaggagggat ggggatgttg tgtggccgac 481 agttgtgagg ggttgtggga agatggaagc cagaagcaaa aaagagggaa cctgacacta 541 tttctggctt cttgggttta gcgattagtg cccctctctc atttgaactc aactacccat 601 gtctccctag ttctttctct gcctttaaaa aaaaatgtgt ggaggacagc tttgtggag MFG DNA Marker M1 M2 Readily detectable sequence of DNA whose inheritance can be monitored and associated with the trait inheritance
- 9. Hybridization based markers Examine differences in size of specific DNA restriction fragments Usually performed on total cellular genome Require pure, high molecular weight DNA and probe DNA Marker 1. Hybridization molecular based markers 2. PCR molecular based markers
- 10. DNA/DNA Hybridization Denaturation Elevated temperature Known DNA sequence Restriction Fragment Length Polymorphism
- 11. RFLP techniques
- 12. 3 6 2 6 1 2 4 3 5 4 5 1 MFG RFLP Polymorphisms interpretation
- 13. Advantages and disadvantages • Advantages – Reproducible – Co-dominant – Simple • Disadvantages – Time consuming – Expensive – Use of radioactive probes
- 14. Polymerase Chain Reaction Powerful technique for amplifying DNA Amplified DNA are then separated by gel electrophoresis
- 15. PCR Based markers Sequencing (SNPs) Microsatellites (SSR) AFLP (Amplified Fragment Length Polymorphism) RAPD (random amplified polymorphic DNA)
- 16. RAPD Markers DNA markers which developed by amplifying random sequence of specific markers through the used of random primers
- 17. RAPD Disadvantages: Dominant markers Reproducibility problems Advantages: Amplifies anonymous stretches of DNA using arbitrary primers Fast and easy method for detecting polymorphisms
- 18. RAPD Markers RAPD markers need to be converted to stable PCR markers. The polymorphic RAPD marker band is isolated from the gel It is used a template and re-PCRed The new PCR product is cloned and sequenced Once the sequence is determined, new longer and specific primers can be designed
- 19. RAPD Polymorphisms among landraces of sorghum M Sequences of 10- mer RAPD primers Name Sequence OP A08 5’ –GTGACGTAGG- 3’ OP A15 5’ –TTCCGAACCC- 3’ OP A 17 5’ –GACCGCTTGT- 3’ OP A19 5’ –CAAACGTCGG- 3’ OP D02 5’ –GGACCCAACC- 3’ RAPD gel configuration
- 20. AFLP Markers Most complex of marker technologies Involves cleavage of DNA with two different enzymes Involves ligation of specific linker pairs to the digested DNA Subsets of the DNA are then amplified by PCR The PCR products are then separated on acrylamide gel 128 linker combinations are readily available Therefore 128 subsets can be amplified Patented technology
- 24. AFLP Markers Technically demanding Reliable and stable Moderate cost Need to use different kits adapted to the size of the genome being analyzed. Like RAPD markers need to be converted to quick and easy PCR based marker
- 25. SSR (Simple sequence repeat) DNA markers which developed by amplifying microsatellite in the genome Sequence Primer ACTGTCGACACACACACACACGCTAGCT (AC)7 TGACAGCTGTGTGTGTGTGTGCGATCGA ACTGTCGACACACACACACACACGCTAGCT (AC)8 TGACAGCTGTGTGTGTGTGTGTGCGATCGA ACTGTCGACACACACACACACACACACGCTAGCT (AC)10 TGACAGCTGTGTGTGTGTGTGTGTGTGCGATCGA ACTGTCGACACACACACACACACACACACACGCTAGCT (AC)12 TGACAGCTGTGTGTGTGTGTGTGTGTGTGTGCGATCGA
- 26. AATCCGGACTAGCTTCTTCTTCTTCTTCTTTAGCGAATTAGG P1 AAGGTTATTTCTTCTTCTTCTTCTTCTTCTTCTTAGGCTAGGCG P2 P1 P2 SSR polymorphisms Gel configuration
- 27. SNPs (Single Nucleotide Polymorphisms) Any two unrelated individuals differ by one base pair every 1,000 or so, referred to as SNPs. Many SNPs have no effect on cell function and therefore can be used as molecular markers. Hybridization using fluorescent dyes SNPs on a DNA strand DNA markers which their polymorphism can be determined by single nucleotide difference
- 29. Genetic marker characteristics Characteristics Morphological markers Protein markers RFLP markers RAPD markers SSR markers Number of loci Limited Limited Almost unlimited Unlimited High Inheritance Dominant Codominant Codominant Dominant Codominant Positive features Visible Easy to detect Utilized before the latest technologies were available Quick assays with many markers Well distributed within the genome, many polymorphism Negative features Possibly negative linkage to other characters Possibly tissue specific Radioactivity requirements, rather expensive High basic investment Long development of the markers, expensive
- 30. Polymorphism -Parent 1 : one band -Parent 2 : a smaller band -Offspring 1 : heterozygote = both bands -Offspring 2 : homozygote parent 1 Polymorphism Parent 1 : one band -Parent 2 : no band -Offspring 1 : homozygote parent 1 -Offspring 2 : ???? P 2 P 1 O 2 O 1 Gel configuration Co-dominant marker P 2 Gel configuration P 1 O 1 O 2 Dominant marker
- 31. Polymorphic Co-dominant inheritance Occurs throughout the genome Reproducible Easy, fast and cheap to detect Selectivity neutral High resolution with large number of samples Desirable properties