![Multiplex PCR Assay Targeting a Diguanylate Cyclase-Encoding Gene,
cgcA, To Differentiate Species within the Genus Cronobacter
L. Carter,a
L. A. Lindsey,a
* C. J. Grim,a,b
V. Sathyamoorthy,a
K. G. Jarvis,a
G. Gopinath,a
C. Lee,a
J. A. Sadowski,a
L. Trach,a
M. Pava-Ripoll,c
B. A. McCardell,a
B. D. Tall,a
L. Hua,b
CFSAN, FDA, Laurel, Maryland, USAa
; Oak Ridge Institute for Science and Education, Oak Ridge, Tennessee, USAb
; CFSAN, FDA, College Park, Maryland, USAc
In a comparison to the widely used Cronobacter rpoB PCR assay, a highly specific multiplexed PCR assay based on cgcA, a digua-
nylate cyclase gene, that identified all of the targeted six species among 305 Cronobacter isolates was designed. This assay will be
a valuable tool for identifying suspected Cronobacter isolates from food-borne investigations.
Cronobacter spp. are Gram-negative, opportunistic pathogens
that cause meningitis, necrotizing enterocolitis, and septice-
mia in neonates and elderly individuals (1–3). Cronobacter spp.
are ubiquitous in nature and have been isolated from clinical,
environmental, and food sources, most notably powdered infant
formula and other dried foods (2, 3), and, more recently, from
surfaces and intestinal tracts of wild filth flies (4). The Cronobacter
genus consists of seven species, C. condimenti, C. dublinensis, C.
malonaticus, C. muytjensii, C. sakazakii, C. turicensis, and C. uni-
versalis (5, 6). Although all species except C. condimenti have been
associated with clinical infections, C. sakazakii and C. malonaticus
isolates are responsible for causing the majority of infantile ill-
nesses (7). It is important to identify Cronobacter quickly and pre-
cisely. Current Cronobacter identification and subtyping methods
include 16S rRNA gene sequencing, ribotyping, DNA-DNA hy-
bridization, rpoB PCR, pulsed-field gel electrophoresis, plasmid-
otyping, and molecular serogrouping assays (3, 5, 8–12). These
methods have detected considerable diversity among Cronobacter
spp.; however, many of these are not rapid or require multiple
PCRs to identify or characterize isolates. Also, 16S rRNA gene
sequence analysis has limitations for discriminating between very
closely related organisms, such as C. malonaticus and C. sakazakii,
because of minimal sequence diversity or the presence of multiple
copies of 16S rRNA gene loci. It is necessary to ensure that reliable
and robust identification methods are used so that the control of
contamination by these organisms during the food manufactur-
ing process and the reduction of exposure to susceptible high-risk
individuals are achieved.
Cyclic diguanylate (c-di-GMP) is a bacterial signal transduc-
tion second messenger recognized for its involvement in the reg-
ulation of a number of complex physiological processes, including
bacterial virulence, biofilm formation, and persistence (long-term
survival) (13). Diguanylate cyclase, which synthesizes cyclic
diguanylate, possesses a conserved active domain of five amino
acids, Gly-Gly-Asp-Glu-Phe, or GGDEF (13). Several food-borne
pathogens, such as Vibrio cholerae, Salmonella, and Escherichia
coli, encode variable numbers of GGDEF domain proteins (13).
Analysis of 12 Cronobacter genomes revealed seven GGDEF
domain-encoding genes which were conserved among all Crono-
bacter spp. (15, 16; C. J. Grim, M. L. Kotewicz, K. A. Power, A. A.
Franco, G. Gopinath, K. G. Jarvis, Q. Q. Yan, S. A. Jackson, L. Hu,
V. Sathyamoorthy, F. Pagotto, C. Iversen, A. Lehner, R. Stephan,
S. Fanning, and B. D. Tall, submitted for publication). Phyloge-
netic analysis of each set of homologous genes from the available
genomes revealed that homologs of two of the seven genes
(ESA_04212 and ESA_03399 of C. sakazakii ATCC BAA-894)
were highly similar within the genus and one of these was highly
similar throughout the Enterobacteriaceae (data not shown). In
contrast, the other five GGDEF domain-encoding genes (ho-
mologs of ESA_01230, ESA_01822, ESA_03401, ESA_03491, and
ESA_ 04315 from C. sakazakii ATCC BAA-894) showed species-
specific allelic divergence (Fig. 1A), some of which recapitulated
the species-specific phylogenetic relationships within the genus
(Fig. 1B), previously described by Iversen et al. (5) and as deter-
mined through multilocus sequence typing (MLST) (17), rpoB
sequencing analyses (12), and whole-genome phylogenetic recon-
struction (Grim et al., submitted).
In particular, multiple sequence alignment of homologues of
ESA_01230 from C. sakazakii ATCC BAA-894 (Fig. 1A), anno-
tated as a putative Cronobacter diguanylate cyclase (containing a
GGDEF domain) and designated cgcA here, yielded a phylogeny in
which all six species formed discrete, distinct lineages, with rela-
tionships in agreement with those in whole-genome analysis (Fig.
1B). Further, we hypothesized that this gene would be amenable to
species-specific primer design based on the length of the coding
sequences and the depth of branching exhibited between species,
which, taken together, would provide a significant number of vari-
able sites (single nucleotide polymorphisms [SNPs]) for species-
specific primer design (see Fig. S1 in the supplemental material).
These observations led us to design a set of species-specific
multiplex PCR primers which may be used to identify strains of
Cronobacter in a single multiplex PCR assay (Table 1 and Fig. 2).
Primer sequences were chosen by multiple alignment analysis of
the respective cgcA sequences using MEGA5 (18). The primer se-
quences were evaluated for their ability to form homo- and het-
erodimers as well as hairpins by using OligoAnalyzer 3.1 (Inte-
Received 21 September 2012 Accepted 30 October 2012
Published ahead of print 9 November 2012
Address correspondence to Lan Hu, lan16686@yahoo.com.
* Present address: L. A. Lindsey, Department of Food and Nutritional Sciences,
Tuskegee University, Tuskegee, Alabama, USA.
Supplemental material for this article may be found at http://dx.doi.org/10.1128
/AEM.02898-12.
Copyright © 2013, American Society for Microbiology. All Rights Reserved.
doi:10.1128/AEM.02898-12
734 aem.asm.org Applied and Environmental Microbiology p. 734–737 January 2013 Volume 79 Number 2
onJanuary2,2013byFDABiosciencesLibraryhttp://aem.asm.org/Downloadedfrom](https://image.slidesharecdn.com/12f38b8c-1f8d-4d57-9e21-f37849d009df-150302092700-conversion-gate02/85/2013_CarterEtal_MultiplexPCR-Cronobacter_-AEM-2-320.jpg)
2013_CarterEtal_MultiplexPCR-Cronobacter_ AEM
- 1. Published Ahead of Print 9 November 2012. 10.1128/AEM.02898-12. 2013, 79(2):734. DOI:Appl. Environ. Microbiol. Pava-Ripoll, B. A. McCardell, B. D. Tall and L. Hu Jarvis, G. Gopinath, C. Lee, J. A. Sadowski, L. Trach, M. L. Carter, L. A. Lindsey, C. J. Grim, V. Sathyamoorthy, K. G. Cronobacter , To Differentiate Species within the Genus cgcADiguanylate Cyclase-Encoding Gene, Multiplex PCR Assay Targeting a http://aem.asm.org/content/79/2/734 Updated information and services can be found at: These include: SUPPLEMENTAL MATERIAL Supplemental material CONTENT ALERTS more»articles cite this article), Receive: RSS Feeds, eTOCs, free email alerts (when new http://journals.asm.org/site/misc/reprints.xhtmlInformation about commercial reprint orders: http://journals.asm.org/site/subscriptions/To subscribe to to another ASM Journal go to: onJanuary2,2013byFDABiosciencesLibraryhttp://aem.asm.org/Downloadedfrom
- 2. Multiplex PCR Assay Targeting a Diguanylate Cyclase-Encoding Gene, cgcA, To Differentiate Species within the Genus Cronobacter L. Carter,a L. A. Lindsey,a * C. J. Grim,a,b V. Sathyamoorthy,a K. G. Jarvis,a G. Gopinath,a C. Lee,a J. A. Sadowski,a L. Trach,a M. Pava-Ripoll,c B. A. McCardell,a B. D. Tall,a L. Hua,b CFSAN, FDA, Laurel, Maryland, USAa ; Oak Ridge Institute for Science and Education, Oak Ridge, Tennessee, USAb ; CFSAN, FDA, College Park, Maryland, USAc In a comparison to the widely used Cronobacter rpoB PCR assay, a highly specific multiplexed PCR assay based on cgcA, a digua- nylate cyclase gene, that identified all of the targeted six species among 305 Cronobacter isolates was designed. This assay will be a valuable tool for identifying suspected Cronobacter isolates from food-borne investigations. Cronobacter spp. are Gram-negative, opportunistic pathogens that cause meningitis, necrotizing enterocolitis, and septice- mia in neonates and elderly individuals (1–3). Cronobacter spp. are ubiquitous in nature and have been isolated from clinical, environmental, and food sources, most notably powdered infant formula and other dried foods (2, 3), and, more recently, from surfaces and intestinal tracts of wild filth flies (4). The Cronobacter genus consists of seven species, C. condimenti, C. dublinensis, C. malonaticus, C. muytjensii, C. sakazakii, C. turicensis, and C. uni- versalis (5, 6). Although all species except C. condimenti have been associated with clinical infections, C. sakazakii and C. malonaticus isolates are responsible for causing the majority of infantile ill- nesses (7). It is important to identify Cronobacter quickly and pre- cisely. Current Cronobacter identification and subtyping methods include 16S rRNA gene sequencing, ribotyping, DNA-DNA hy- bridization, rpoB PCR, pulsed-field gel electrophoresis, plasmid- otyping, and molecular serogrouping assays (3, 5, 8–12). These methods have detected considerable diversity among Cronobacter spp.; however, many of these are not rapid or require multiple PCRs to identify or characterize isolates. Also, 16S rRNA gene sequence analysis has limitations for discriminating between very closely related organisms, such as C. malonaticus and C. sakazakii, because of minimal sequence diversity or the presence of multiple copies of 16S rRNA gene loci. It is necessary to ensure that reliable and robust identification methods are used so that the control of contamination by these organisms during the food manufactur- ing process and the reduction of exposure to susceptible high-risk individuals are achieved. Cyclic diguanylate (c-di-GMP) is a bacterial signal transduc- tion second messenger recognized for its involvement in the reg- ulation of a number of complex physiological processes, including bacterial virulence, biofilm formation, and persistence (long-term survival) (13). Diguanylate cyclase, which synthesizes cyclic diguanylate, possesses a conserved active domain of five amino acids, Gly-Gly-Asp-Glu-Phe, or GGDEF (13). Several food-borne pathogens, such as Vibrio cholerae, Salmonella, and Escherichia coli, encode variable numbers of GGDEF domain proteins (13). Analysis of 12 Cronobacter genomes revealed seven GGDEF domain-encoding genes which were conserved among all Crono- bacter spp. (15, 16; C. J. Grim, M. L. Kotewicz, K. A. Power, A. A. Franco, G. Gopinath, K. G. Jarvis, Q. Q. Yan, S. A. Jackson, L. Hu, V. Sathyamoorthy, F. Pagotto, C. Iversen, A. Lehner, R. Stephan, S. Fanning, and B. D. Tall, submitted for publication). Phyloge- netic analysis of each set of homologous genes from the available genomes revealed that homologs of two of the seven genes (ESA_04212 and ESA_03399 of C. sakazakii ATCC BAA-894) were highly similar within the genus and one of these was highly similar throughout the Enterobacteriaceae (data not shown). In contrast, the other five GGDEF domain-encoding genes (ho- mologs of ESA_01230, ESA_01822, ESA_03401, ESA_03491, and ESA_ 04315 from C. sakazakii ATCC BAA-894) showed species- specific allelic divergence (Fig. 1A), some of which recapitulated the species-specific phylogenetic relationships within the genus (Fig. 1B), previously described by Iversen et al. (5) and as deter- mined through multilocus sequence typing (MLST) (17), rpoB sequencing analyses (12), and whole-genome phylogenetic recon- struction (Grim et al., submitted). In particular, multiple sequence alignment of homologues of ESA_01230 from C. sakazakii ATCC BAA-894 (Fig. 1A), anno- tated as a putative Cronobacter diguanylate cyclase (containing a GGDEF domain) and designated cgcA here, yielded a phylogeny in which all six species formed discrete, distinct lineages, with rela- tionships in agreement with those in whole-genome analysis (Fig. 1B). Further, we hypothesized that this gene would be amenable to species-specific primer design based on the length of the coding sequences and the depth of branching exhibited between species, which, taken together, would provide a significant number of vari- able sites (single nucleotide polymorphisms [SNPs]) for species- specific primer design (see Fig. S1 in the supplemental material). These observations led us to design a set of species-specific multiplex PCR primers which may be used to identify strains of Cronobacter in a single multiplex PCR assay (Table 1 and Fig. 2). Primer sequences were chosen by multiple alignment analysis of the respective cgcA sequences using MEGA5 (18). The primer se- quences were evaluated for their ability to form homo- and het- erodimers as well as hairpins by using OligoAnalyzer 3.1 (Inte- Received 21 September 2012 Accepted 30 October 2012 Published ahead of print 9 November 2012 Address correspondence to Lan Hu, lan16686@yahoo.com. * Present address: L. A. Lindsey, Department of Food and Nutritional Sciences, Tuskegee University, Tuskegee, Alabama, USA. Supplemental material for this article may be found at http://dx.doi.org/10.1128 /AEM.02898-12. Copyright © 2013, American Society for Microbiology. All Rights Reserved. doi:10.1128/AEM.02898-12 734 aem.asm.org Applied and Environmental Microbiology p. 734–737 January 2013 Volume 79 Number 2 onJanuary2,2013byFDABiosciencesLibraryhttp://aem.asm.org/Downloadedfrom
- 3. grated DNA Technologies, Coralville, IA). All primers were synthesized by Integrated DNA Technologies. Empirical primer concentration and PCR optimization studies were performed by changing primer and template concentrations and PCR assay pa- rameter conditions so that optimal kinetics were achieved. PCR mixtures were prepared using the GoTaq green master mix (Promega Corp., Madison, WI) according to the manufactur- er’s instructions using boiled genomic DNA preparations (ap- proximately 50 ng DNA/25-l reaction mixture) as the DNA tem- plate (19). GoTaq Hot Start green master mix is a premixed, proprietary, ready-to-use solution containing GoTaq Hot Start polymerase, deoxynucleoside triphosphates (dNTPs), MgCl2, and reaction buffers at optimal concentrations for efficient amplifica- tion of DNA templates by PCR. GoTaq Hot Start polymerase is supplied in 2ϫ Green GoTaq reaction buffer (pH 8.5), 400 M dATP, 400 M dGTP, 400 M dCTP, 400 M dTTP, and 4 mM MgCl2. In all PCRs, the polymerase was activated by using a 3-min predenaturation step at 94°C, followed by 25 cycles of denatur- ation at 94°C for 30 s, annealing at 62°C for 30 s, and a one-min extension at 72°C, followed by a final extension step at 72°C for FIG 1 Evolutionary reconstruction of homologues of the GGDEF domain-encoding gene C. sakazakii ATCC BAA-894 ESA_01230 (*) among Cronobacter spp. (A) and of the genus Cronobacter (B) using 0.5 Mb of syntenic whole-genome nucleotide sequences (20). Evolutionary analyses were conducted in MEGA5 (18). Evolutionary history was inferred using the neighbor-joining method. Bootstrap consensus tree inferred from 1,000 replicates. Evolutionary distances were computed using the maximum composite likelihood method, and units are the numbers of base substitutions per site. TABLE 1 Cronobacter species-specific cgcA PCR primers used in this study Primera Sequence Amplicon size (bp) Species identification Cdm-469Rb CCACATGGCCGATATGCACGCC Cdub-40F GATACCTCTCTGGGCCGCAGC 430 C. dublinensis Cmuy-209F TTCTTCAGGCGGAGCTGACCT 260 C. muytjensii Cmstu-825Fc GGTGGCSGGGTATGACAAAGAC Ctur-1036R TCGCCATCGAGTGCAGCGTAT 211 C. turicensis Cuni-1133R GAAACAGGCTGTCCGGTCACG 308 C. universalis Csak-1317R GGCGGACGAAGCCTCAGAGAGT 492 C. sakazakii Cmal-1410R GGTGACCACACCTTCAGGCAGA 585 C. malonaticus a The numbers comprising each primer name indicate the 5= bp location within the aligned nucleotide sequence of cgcA (see Fig. S1 in the supplemental material). b The PCR primer Cdm-469R was used in multiplex reactions, with primers Cdub-40F and Cmuy-209F identifying C. dublinensis and C. muytjensii strains, respectively. c The PCR primer Cmstu-825F was used in multiplex reactions, with primers Ctur-1036R, Cuni-1133R, Csak-1317R, and Cmal-1410R identifying C. malonaticus, C. sakazakii, C. turicensis, and C. universalis strains, respectively. Cronobacter Species-Specific GGDEF Multiplex PCR Assay January 2013 Volume 79 Number 2 aem.asm.org 735 onJanuary2,2013byFDABiosciencesLibraryhttp://aem.asm.org/Downloadedfrom
- 4. five min. PCR amplicons were subjected to agarose gel electropho- resis using 1.5% Tris-borate-EDTA (TBE; Invitrogen, Carlsbad, CA) agarose gels in a RunOne (Embi Tec, San Diego, CA) hori- zontal electrophoresis unit and were photographed with transil- luminated UV light using a Bio-Rad Molecular Imager Gel Chem Doc XR imaging system (Bio-Rad Laboratories, Hercules, CA). Examples of the cgcA PCR assay results for type strains of Cronobacter are shown in Fig. 3. Because C. condimenti is recently described and the taxonomic description is based on a single iso- late, this species was not included in these studies. The multiplex PCR assay was evaluated by interrogating a collection of 305 well- characterized Cronobacter strains (5, 9, 10, 19, 20; Grim et al., submitted), which included 15 strains of C. dublinensis, two strains of C. universalis, 12 strains of C. muytjensii, 11 strains of C. turicensis, 231 strains of C. sakazakii, and 34 strains of C. malonati- cus. The strain collection included isolates from clinical (69 strains), food (144 strains), environmental (63 strains), fly (18 strains), and unknown (11 strains) sources which were obtained from diverse geographic locations worldwide. These isolates were initially characterized biochemically according to Iversen et al. (5) and later confirmed using the species-specific rpoB PCR assays as described by Stoop et al. (12). Additionally, this collection of iso- lates was subjected to RepF1B plasmidotyping (9) and molecular serogrouping (10, 11), the results of which further corroborated the rpoB-based PCR species identification for each strain. The multiplex cgcA PCR assay correctly identified (100%) the species identity of the 305 Cronobacter isolates. These results confirm the species specificity of the cgcA multiplex PCR assay. To test for exclusivity, 20 non-Cronobacter strains, which included Entero- bacter amnigenus, Enterobacter aerogenes, Enterobacter gergoviae, Enterobacter asburiae, Enterobacter cancerogenus, Enterobacter clo- acae, Enterobacter cloacae subsp. dissolvans, Enterobacter helveti- cus, Enterobacter pulveris, Enterobacter turicencis, Citrobacter koseri, Pantoea agglomerans, Erwinia carotovora, Kluyvera interme- dia, Listeria monocytogenes, Escherichia coli O157:H7, and Salmo- nella enterica subsp. enterica serovar Enteritidis, were assayed, and all were negative using these PCR primers. In conclusion, this study demonstrates that the Cronobacter multiplex cgcA PCR assay can be used to identify Cronobacter strains in a single reaction. The PCR assay described in this report was found to be 100% specific (305/305 correctly identified as Cronobacter sp. strains) and 100% sensitive (did not identify 20/20 non-Cronobacter species). Its main advantage over the currently used rpoB PCR method is that species identity of C. sakazakii and C. malonaticus can be accomplished in a single reaction as op- posed to two separate PCRs. The assay reported here will be a valuable tool for identifying suspected Cronobacter isolates from clinical, environmental, and food-borne outbreak and surveil- lance investigations, quickly and precisely. ACKNOWLEDGMENTS L. A. Lindsey was a recipient of a 2011 National Association for Equal Opportunity in Higher Education internship program fellowship, Wash- ington, DC. C. Lee, L. Trach, and J. A. Sadowski were supported by the Joint Institute of Food Safety and Applied Nutrition student internship program, University of Maryland, College Park, MD. REFERENCES 1. Gosney MA, Martin MV, Wright AE, Gallagher M. 2006. Enterobacter sakazakii in the mouths of stroke patients and its association with aspira- tion pneumonia. Eur. J. Intern. Med. 17:185–188. 2. Nazarowec-White M, Farber JM. 1997. Enterobacter sakazakii: a review. Int. J. Food Microbiol. 34:103–113. 3. Yan QQ, Condell O, Power KA, Butler F, Tall BD, Fanning S. 2012. Cronobacter species (formerly known as Enterobacter sakazakii) in pow- dered infant formula: a review of our current understanding of the biology of this bacterium. J. Appl. Microbiol. 113:1–15. 4. Pava-Ripoll M, Pearson REG, Miller AK, Ziobro GC. 2012. Prevalence and relative risk of Cronobacter spp., Salmonella spp. and Listeria monocy- togenes associated with the body surface and the guts of individual filth flies. Appl. Environ. Microbiol. 78:7891–7902. 5. Iversen C, Mullane N, McCardell B, Tall BD, Lehner A, Fanning S, Stephan R, Joosten H. 2008. Cronobacter gen. nov., a new genus to ac- commodate the biogroups of Enterobacter sakazakii, and proposal of Cronobacter sakazakii gen. nov., comb. nov., Cronobacter malonaticus sp. nov., Cronobacter turicensis sp. nov., Cronobacter muytjensii sp. nov., Cronobacter dublinensis sp. nov., Cronobacter genomospecies 1, and of three subspecies, Cronobacter dublinensis subsp. dublinensis subsp. nov., Cronobacter dublinensis subsp. lausannensis subsp. nov. and Cronobacter dublinensis subsp. lactaridi subsp. nov. Int. J. Syst. Evol. Microbiol. 58: 1442–1447. 6. Joseph S, Cetinkaya E, Drahovska H, Ababneh QO, Levican A, Figueras MJ, Forsythe SJ. 2011. Cronobacter condimenti sp. nov., isolated from spiced meat, and Cronobacter universalis sp. nov., a novel species designa- FIG 2 Schematic map of cgcA showing locations of PCR primers. The smallest ticks on the scale indicate 50-bp nucleotide positions, with larger ticks indicating 100-bp and 1-kbp nucleotide positions. See Table 1 for an explanation of primer names and nucleotide positions. FIG 3 Representative gel image of Cronobacter species-specific GGDEF mul- tiplex PCR. Lanes 1 and 10, TrackIt 100-bp DNA ladder (Invitrogen); lane 2, C. dublinensis strain LMG 23823T; lane 3, C. universalis strain NCTC 9529; lane 4, C. muytjensii strain ATCC 51329; lane 5, C. malonaticus strain LMG 23826T; lane 6, C. sakazakii strain BAA-894; lane 7, C. turicensis strain z3032; lane 8, Enterobacter helveticus strain z513; lane 9, no-DNA-template control. Five mi- croliters of each PCR (amplicons) was subjected to gel electrophoresis using 1.5% agarose gels and visualized with ethidium bromide (at a final concentra- tion of 0.5 g/ml). Carter et al. 736 aem.asm.org Applied and Environmental Microbiology onJanuary2,2013byFDABiosciencesLibraryhttp://aem.asm.org/Downloadedfrom
- 5. tion for Cronobacter sp. genomospecies 1, recovered from a leg infection water and food ingredients. Int. J. Syst. Evol. Microbiol. 62:1277–1283. 7. Joseph S, Forsythe SJ. 2011. Predominance of Cronobacter sakazakii sequence type 4 in neonatal infections. Emerg. Infect. Dis. 17:1713–1715. 8. Brengi SP, O’Brien SB, Pichel M, Iversen C, Arduino M, Binsztein N, Jensen B, Pagotto F, Ribot EM, Stephan R, Cernela N, Cooper K, Fanning S. 2012. Development and validation of a PulseNet standardized protocol for subtyping isolates of Cronobacter species. Foodborne Pathog. Dis. 9:861–867. 9. Franco AA, Hu L, Grim CJ, Gopinath G, Sathyamoorthy V, Jarvis KG, Lee C, Sadowski J, Kim J, Kothary MH, McCardell BA, Tall BD. 2011. Characterization of putative virulence genes on the related RepFIB plas- mids harbored by Cronobacter spp. Appl. Environ. Microbiol. 77:3255– 3267. 10. Jarvis KG, Grim CJ, Franco AA, Gopinath G, Sathyamoorthy V, Hu L, Sadowski JA, Lee CS, Tall BD. 2011. Molecular characterization of Cronobacter lipopolysaccharide O-antigen gene clusters and development of serotype-specific PCR assays. Appl. Environ. Microbiol. 77:4017–4026. 11. Mullane N, O’Gaora P, Nally JE, Iversen C, Whyte P, Wall PG, Fanning S. 2008. Molecular analysis of the Enterobacter sakazakii O-antigen gene locus. Appl. Environ. Microbiol. 74:3783–3794. 12. Stoop B, Lehner A, Iversen C, Fanning S, Stephan R. 2009. Develop- ment and evaluation of rpoB based PCR systems to differentiate the six proposed species within the genus Cronobacter. Int. J. Food Microbiol. 136:165–168. 13. Sondermann H, Shikuma NJ, Yildiz FH. 2012. You’ve come a long way: c-di-GMP signaling. Curr. Opin. Microbiol. 15:140–146. 14. Reference deleted. 15. Kucerova E, Clifton SW, Xia XQ, Long F, Porwollik S, Fulton L, Fronick C, Minx P, Kyung K, Warren W, Fulton R, Feng D, Wollam A, Shah N, Bhonagiri V, Nash Hallsworth-Pepin KWE, Wilson RK, McClelland M, Forsythe SJ. 2010. Genome sequence of Cronobacter sakazakii BAA-894 and comparative genomic hybridization analysis with other Cronobacter species. PLoS One 5:e9556. doi:10.1371 /journal.pone.0009556. 16. Stephan R, Lehner A, Tischler P, Rattei T. 2011. Complete genome sequence of Cronobacter turicensis LMG 23827, a food-borne pathogen causing deaths in neonates. J. Bacteriol. 193:309–310. 17. Joseph S, Sonbol H, Hariri S, Desai P, McClelland M, Forsythe SJ. 2012. Diversity of the Cronobacter genus as revealed by multilocus sequence typing. J. Clin. Microbiol. 50:3031–3039. 18. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGA5: molecular evolutionary genetics analysis using maximum likeli- hood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28:2731–2739. 19. Kothary MH, McCardell BA, Frazer CD, Deer D, Tall BD. 2007. Characterization of the zinc-containing metalloprotease (zpx) and devel- opment of a species-specific detection method for Enterobacter sakazakii. Appl. Environ. Microbiol. 73:4142–4151. 20. Grim CJ, Kothary MH, Gopinath G, Jarvis KG, Beaubrun JJ, McClelland M, Tall BD, Franco AA. 2012. Identification and character- ization of Cronobacter iron acquisition systems. Appl. Environ. Microbiol. 78:6035–6050. Cronobacter Species-Specific GGDEF Multiplex PCR Assay January 2013 Volume 79 Number 2 aem.asm.org 737 onJanuary2,2013byFDABiosciencesLibraryhttp://aem.asm.org/Downloadedfrom