2014-Yeo-A Multiplex Two-Color Real-Time PCR Method(1)

A Multiplex Two-Color Real-Time PCR Method for
Quality-Controlled Molecular Diagnostic Testing of FFPE
Samples
Jiyoun Yeo1
, Erin L. Crawford1
, Thomas M. Blomquist1
, Lauren M. Stanoszek1
, Rachel E. Dannemiller1
,
Jill Zyrek2
, Luis E. De Las Casas2
, Sadik A. Khuder1
, James C. Willey1,2
*
1 Division of Pulmonary/Critical Care and Sleep Medicine, Department of Medicine, University of Toledo Health Sciences Campus, Toledo, Ohio, United States of America,
2 Department of Pathology, University of Toledo Health Sciences Campus, Toledo, Ohio, United States of America
Abstract
Background: Reverse transcription quantitative real-time PCR (RT-qPCR) tests support personalized cancer treatment
through more clinically meaningful diagnosis. However, samples obtained through standard clinical pathology procedures
are formalin-fixed, paraffin-embedded (FFPE) and yield small samples with low integrity RNA containing PCR interfering
substances. RT-qPCR tests able to assess FFPE samples with quality control and inter-laboratory reproducibility are needed.
Methods: We developed an RT-qPCR method by which 1) each gene was measured relative to a known number of its
respective competitive internal standard molecules to control for interfering substances, 2) two-color fluorometric
hydrolysis probes enabled analysis on a real-time platform, 3) external standards controlled for variation in probe
fluorescence intensity, and 4) pre-amplification maximized signal from FFPE RNA samples. Reagents were developed for
four genes comprised by a previously reported lung cancer diagnostic test (LCDT) then subjected to analytical validation
using synthetic native templates as test articles to assess linearity, signal-to-analyte response, lower detection threshold,
imprecision and accuracy. Fitness of this method and these reagents for clinical testing was assessed in FFPE normal (N = 10)
and malignant (N = 10) lung samples.
Results: Reagents for each of four genes, MYC, E2F1, CDKN1A and ACTB comprised by the LCDT had acceptable linearity
(R2
.0.99), signal-to-analyte response (slope 1.060.05), lower detection threshold (,10 molecules) and imprecision (CV ,
20%). Poisson analysis confirmed accuracy of internal standard concentrations. Internal standards controlled for
experimentally introduced interference, prevented false-negatives and enabled pre-amplification to increase signal without
altering measured values. In the fitness for purpose testing of this two-color fluorometric LCDT using surgical FFPE samples,
the diagnostic accuracy was 93% which was similar to that previously reported for analysis of fresh samples.
Conclusions: This quality-controlled two-color fluorometric RT-qPCR approach will facilitate the development of reliable,
robust RT-qPCR-based molecular diagnostic tests in FFPE clinical samples.
Citation: Yeo J, Crawford EL, Blomquist TM, Stanoszek LM, Dannemiller RE, et al. (2014) A Multiplex Two-Color Real-Time PCR Method for Quality-Controlled
Molecular Diagnostic Testing of FFPE Samples. PLoS ONE 9(2): e89395. doi:10.1371/journal.pone.0089395
Editor: Richard C. Willson, University of Houston, United States of America
Received September 20, 2013; Accepted January 20, 2014; Published February 21, 2014
Copyright: ß 2014 Yeo et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was funded by National Institutes of Health grants, CA132806 and CA138397, and the George Isaac Cancer Research Fund. The funders had
no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: Authors James C. Willey, Thomas M. Blomquist, and Erin L. Crawford share royalties from one or more patents that are licensed to
Accugenomics. This does not alter the authors’ adherence to all the PLOS ONE policies on sharing data and materials. No products described in this manuscript
currently are under development by Accugenomics or any other company.
* E-mail: james.willey2@utoledo.edu
Introduction
Reverse transcription quantitative real-time polymerase chain
reaction (RT-qPCR) tests that measure transcript abundance of
selected genes in clinical specimens have been demonstrated to
increase cancer diagnostic accuracy and enable ‘‘personalized
medicine’’ through selection of the most effective treatment for
each cancer [1–3]. However, a key challenge is that current
clinical pathology sample collection and processing procedures
focus on formalin fixation and paraffin embedding (FFPE) and
fresh/fresh-frozen tissues rarely are available for molecular
analysis. FFPE samples are difficult to work with because they
yield RNA that 1) often contains PCR-interfering substances, and
2) is uniformly highly fragmented and often in low abundance [4–
8]. Economic factors prevent changing this workflow to ensure
collection of samples in a form more conducive to molecular
genetic analysis, such as fresh frozen, therefore, there is a need to
develop methods that are sufficiently robust to reliably conduct
molecular genetic analysis in FFPE samples.
One way to address the challenge of interfering substances is to
incorporate quality control in qPCR through measurement of
each analyte relative to a known number of competitive template
internal standard (IS) copies. This quality control method is
recommended by regulatory agencies, including the EPA [9], ISO
PLOS ONE | www.plosone.org 1 February 2014 | Volume 9 | Issue 2 | e89395

[10], and FDA [11], and is implemented in many FDA-approved
single analyte RT-qPCR tests [12–14].
Multiple gene RT-qPCR tests present an even more complex
quality control challenge that can be addressed by combining the
IS for each of the genes into an internal standards mixture (ISM)
and using an aliquot of this ISM in each experiment, as previously
described [15–17]. Each target gene and loading control gene then
is measured relative to a known number of its respective
competitive template IS molecules in each PCR reaction [18,19].
To address the challenge of analyzing clinical samples that yield
a low amount of RNA, we previously described a competitive
multiplex PCR method, in which all reference and target genes are
first co-amplified with ISM in a first round of PCR, followed by
amplification of individual gene in the second round [20]. This
approach enables reliable measurement of many genes from the
amount of RNA that, without pre-amplification, would be
sufficient for measurement of only a single gene.
The primary goal of this study was to develop a robust RT-
qPCR method for more reliable molecular diagnostic testing of
FFPE samples including those stored in existing large archives. To
meet this need, a method was designed with four elements: 1)
Synthetic competitive IS formulated into an ISM to control for
sub-optimal PCR, including interference with PCR caused by
substances present in FFPE samples [21–23], sub-optimal quantity
or quality of PCR reaction reagents, and inter-well and/or inter-
platform variation in PCR conditions; 2) Fluorometric hydrolysis
probe real-time PCR to enable quantification of short PCR
amplicons (60–80 base pairs) that are optimal for reliable analysis
of FFPE samples; 3) An external standards mixture (ESM) in each
experiment to control for inter-lot and inter-experimental varia-
tion in probe fluorescence intensity; and 4) Reverse transcription
with gene specific primers (GSP) followed by competitive multiplex
pre-amplification to enable measurement of lowly expressed genes
in pauci-cellular samples with degraded and limited amounts of
RNA.
To validate this approach, we developed reagents for measure-
ment of previously reported lung cancer diagnostic test (LCDT)
comprising v-myc avian myelocytomatosis viral oncogene homolog
(MYC), E2F transcription factor 1 (E2F1), and cyclin-dependent
kinase inhibitor 1A (CDKN1A) genes measured relative to actin,
beta (ACTB) [24]. These reagents were subjected to analytical
validation using synthetic templates as test articles and fitness for
the purpose of testing using surgical benign and malignant FFPE
samples according to recommended practices [25].
Materials and Methods
Ethics Statement
Twenty archived surgical FFPE lung tissues that had been
processed according to the standard University of Toledo Medical
Center (UTMC) Department of Pathology practice between 2010
and 2012 were obtained for this study under UTMC IRB #
107790. According to the UTMC IRB # 107790 protocol, each
FFPE sample was assigned a non-identifying number by the
pathologist and transferred to the research laboratory. The link
between the non-identifying number and identifying information
was destroyed by the pathologist immediately following sample
transfer. Accordingly, on March 27, 2013 the UTMC IRB
#107790 protocol was approved by the Chair of the UTMC
Biomedical Institutional Review Board as exempt research and the
requirement to obtain a signed consent/authorization form for use
and disclosure of protected health information was waived as this
research was determined to be minimal risk.
FFPE Sample Preparation
Microtome sections (10 micrometre thickness) were obtained
from each sample. Six strips per sample (1 strip = 4 sections) were
obtained, and each strip was put in one 1.5 ml micro-centrifuge
tube for RNA extraction. Therefore, 24 sections (240 micrometres)
of each sample block were collected for RNA extraction.
RNA Extraction and Reverse Transcription
RNA was extracted from the surgical FFPE samples using the
RNeasy FFPE Kit (Qiagen, Valencia, CA). RNA was treated with
DNase in the RNeasy FFPE Kit RNA extraction protocol in order
to minimize the effect of contaminating genomic DNA. RNA
purity and integrity were assessed using absorbance at 260/
280 nm ratios and RNA integrity number (RIN) scores as detected
on the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa
Clara, CA). The effect of different conditions on reverse
transcription (RT) efficiency, including priming with random
hexamer primers (RHP) or GSP and use of 1 or 5 mg of RNA in
the 30 ml RT reaction, was assessed with three FFPE samples. A
previously described test using the External RNA Control
Consortium (ERCC) standards was used to measure RT efficiency
[26]. After completion of these studies, optimal RT conditions
were selected consisting of a 30 ml RT reaction with 1 mg of RNA,
gene-specific RT primer (the PCR reverse primer) (3 mM), and
SuperScript III First Strand Synthesis System (Life Technologies,
Grand Island, NY).
Primer Design and Testing of Efficiency and Specificity
For each gene (MYC, E2F1, CDKN1A and ACTB) primers were
designed to 1) amplify the shortest possible PCR product size (60–
80 base pairs) and 2) span intron/exon splice junctions to
minimize the effect of residual genomic DNA contamination
(Table 1).
Each candidate primer pair was assessed for efficiency in a
serially diluted mixture of H23 cell line cDNA and ISM using
endpoint PCR. After 35 PCR cycles, products were electropho-
retically separated on an Agilent 2100 Bioanalyzer (Agilent
Technologies, Santa Clara, CA), the electropherogram was
inspected for presence or absence of non-specific products, and
appropriately sized peaks were quantified by densitometry.
Design of Probes and IS Templates
For each gene target, after native template (NT) primers with
sufficient efficiency and specificity were identified, we developed
real-time PCR assays using fluorometric hydrolysis probes [27].
First, a probe for the NT was designed followed by the design of an
IS probe for the same DNA region but with 4–6 base pair
alterations from the NT probe sequence. An IS template with
corresponding alterations was synthesized as described in the
synthesis and purification of standards section below. Use of
multiple base changes in the IS probe ensured specificity of NT
probe (FAM labeled) for the NT and IS probe (Quasar 670
labeled) for the IS. Probes with a fluorescent label at the 59 end
and a Black Hole Quencher at the 39 end (BHQplus, Biosearch
Technologies, Novato, CA) were designed using real-time design
software from the Biosearch Technologies web site (Figure 1A,
Table 1).
Synthesis and Purification of Standards
For each gene, we synthesized an NT (to be used in the ESM)
and an IS via commercial vendor (Life Technologies, Grand
Island, NY). The products of such syntheses are single-stranded
and contain a significant fraction of incompletely synthesized (less
Two-Color RT-qPCR Test for FFPE Samples

than full-length) molecules. Thus, we PCR-amplified each
synthesized NT or IS with GSP to generate completely
synthesized, double-stranded nucleic acid templates. This was
followed by electrophoretic separation of the PCR products on
agarose gel, selection of the correct size band, and purification
from agarose using QIAX II gel extraction kit (Qiagen, Valencia,
CA) (Table 1).
Probe Specificity Test
Specificity of each probe was tested by including it in PCR
assays containing the synthetic NT or IS serially diluted from
10211
M to 10215
M. For each probe, at each NT or IS dilution,
the signal (Cq value: quantification cycle) [28] observed with
amplification in the presence of the non-homologous template was
compared to Cq value observed with amplification in the presence
of the homologous template. The non-specific binding rate was
calculated using 2(2delta Cq)
(delta Cq = non-homologous template
Cq – homologous template Cq) at each dilution. If, at any
concentration, the number of input non-homologous molecules
detected by the probe was more than 10% of the number of
homologous molecules detected, then the probe was re-designed.
Preparation of Internal Standards Mixture (ISM)
Known quantities of the IS for each gene were combined into
an ISM. Use of the ISM rather than individual IS in each
experiment minimized inter-experimental variation [16] as
described in Table S1A in File S1. Six different ISM were
prepared (ISM A–F) containing different concentrations of target
gene IS mixture (MYC, E2F1, CDKN1A) relative to the reference
gene (ACTB) IS.
External Standards Mixture (ESM)
Known quantities of purified synthetic NT and IS for each gene
were combined into an ESM. The ESM was used to control for
Table 1. Sequences of primers, probes, and standard templates for two-color fluorometric real-time measurement.
Primer sequences
Gene Location GenBank accession no. Primer Sequence (59- 39) Size
ACTB Exon 4, 5 NM_001101.3 Forward GCCCTGAGGCACTCTTCCAG 20 bp
Reverse TTTCGTGGATGCCACAGGAC 20 bp
CDKN1A Exon 5, 6 NM_000389.4 Forward CCTGGAGACTCTCAGGGTCG 20 bp
Reverse GCGTTTGGAGTGGTAGAAAT 20 bp
MYC Exon 1, 2 NM_002467.4 Forward AGCTGCTTAGACGCTGGATT 20 bp
Reverse CTAACGTTGAGGGGCATCGT 20 bp
E2F1 Exon 5, 6 NM_005225.2 Forward CTCCTCAGGGCACAGGAA 18 bp
Reverse CGTGGACTCTTCGGAGAACTTTC 23 bp
Probe sequences
Gene Probe Modification 59 39 Sequence (59- 39) Size
ACTB NT probe FAM BHQ plus-1 CCTTCCTTCCTGGGCATG 18 bp
IS probe Quasar 670 BHQ plus-2 CCAACCTTCCAGGGCATC 18 bp
CDKN1A NT probe FAM BHQ plus-1 AAACGGCGGCAGACCAGC 18 bp
IS probe Quasar 670 BHQ plus-2 TTACGGCGGGTGACCAC 17 bp
MYC NT probe FAM BHQ plus-1 TAGTGGAAAACCAGCAGCCT 20 bp
IS probe Quasar 670 BHQ plus-2 ATGTGGAAATCCTGCAGCGA 20 bp
E2F1 NT probe FAM BHQ plus-1 CATCGATCGGGCCTTGTT 18 bp
IS probe Quasar 670 BHQ plus-2 TTCCGATCGTGCCTTCTA 18 bp
NT and IS sequences
Gene Template Sequence (59- 39) Size
ACTB NT GCCCTGAGGCACTCTTCCAGCCTTCCTTCCTGGGCATGG AGTCCTGTGGCATCCACGAAA 60 bp
IS GCCCTGAGGCACTCTTCCAGCCAACCTTCCAGGGCATCG AGTCCTGTGGCATCCACGAAA 60 bp
CDKN1A NT CCTGGAGACTCTCAGGGTCGAAAACGGCGGCAGACCAGC ATGACAGATTTCTACCACTCCAAACGC 66 bp
IS CCTGGAGACTCTCAGGGTCGATTACGGCGGGTGACCACC ATGACAGATTTCTACCACTCCAAACGC 66 bp
MYC NT AGCTGCTTAGACGCTGGATTTTTTTCGGGTAGTGGAAAA CCAGCAGCCTCCCGCGACGATGCCCCTCAACGTTAG 75 bp
IS AGCTGCTTAGACGCTGGATTTTTTTCGGGATGTGGAAAT CCTGCAGCGACCCGCGACGATGCCCCTCAACGTTAG 75 bp
E2F1 NT CTCCTCAGGGCACAGGAAAACATCGATCGGGCCTTGTTT GCTCTTAAGGGAGATCTGAAAGTTCTCCGAAGAGTCCACG 79 bp
IS CTCCTCAGGGCACAGGAAAATTCCGATCGTGCCTTCTAT GCTCTTAAGGGAGATCTGAAAGTTCTCCGAAGAGTCCACG 79 bp
NT: native template. IS: internal standard. BHQ: black hole quencher. Bold: modified nucleotides. Underline: probe binding site.
doi:10.1371/journal.pone.0089395.t001

inter-experimental variation resulting from 1) instability or
intensity differences of one fluor relative to the other and 2)
software selection of Cq. We prepared a stock ESM with 10211
M
NT/10211
M IS, and then diluted it to two working concentrations
of 10213
M NT/10213
M IS and 10214
M NT/10214
M IS. Each of
these two ESM concentrations was measured in each experiment
and for each gene the average measured Cq difference [NT Cq -
IS Cq] from the two ESM was used to correct the [NT Cq - IS
Cq] value measured in each unknown sample (Table S1B in File
S1, Figure S1 in File S1).
Pre-amplification (1st
round PCR)
The pre-amplification reaction for each sample was prepared in
a 20 ml volume and included 1) 2 ml primer mixture (ACTB, MYC,
E2F1, CDKN1A) with concentration of each primer at 800 nM
(final concentration of each primer in PCR of 80 nM), 2) 1 ml
cDNA sample, 3) 1 ml ISM, and 4) 10 ml TaqMan Universal
Master Mix II (No UNG: Uracil N-Glycosylase, Life Technolo-
gies, Grand Island, NY) with 6 ml RNase-free water. Probes were
not used in the pre-amplification. Cycle parameters were 95uC for
10 min then 18 cycles at 95uC for 15 s and 60uC for 1 min. The
ABI 7500 Fast real-time PCR system was used with standard
mode (software v2.0.6, Life Technologies).
Second-round PCR
Pre-amplified PCR products were diluted 1000-fold with TE
buffer. A 20 ml reaction was prepared for each gene with 1) 1 ml of
diluted pre-amplified product, 2) 2 ml of a primer mixture
containing each primer for each gene at 8 mM (final concentration
of each primer, 800 nM), 3) 2 ml of 2 mM NT probe and 2 ml of
2 mM IS probe (final concentration of each probe, 200 nM), 4)
10 ml TaqMan Universal Master Mix II (No UNG) with 3 ml
Figure 1. Schematic illustration of the probe design (A) and pre-amplification PCR (B). Native template (NT) binding hydrolysis probes
were labeled with FAM. Internal standard (IS) binding hydrolysis probes were labeled with Quasar 670. (A) For each gene, NT and IS had the same
primer binding sites but there was a 4–6 bp difference in probe binding sites. (B) Varying concentrations of internal standards mixture (ISM) relative
to cDNA were used to ensure that NT: IS ratio was .1:10 and ,10:1.
doi:10.1371/journal.pone.0089395.g001

RNase-free water, and subjected to 40 cycles of PCR using the
same cycle parameters as in the pre-amplification. Automatic
threshold was used to determine Cq values (Figure 1B, Figure S1
in File S1).
Calculation of Gene Expression
To quantify the copy number for each gene NT in a cDNA
sample, 1) the [NT Cq - IS Cq]Sample for the unknown sample and
the average [NT Cq - IS Cq] of two concentrations of ESM ([NT
Cq - IS Cq]ESM) were calculated, 2) The corrected delta Cq was
calculated as: [NT Cq - IS Cq]Sample - [NT Cq - IS Cq]ESM, 3)
2(2corrected delta Cq)
was multiplied times the known number of
input IS copies in the reaction to obtain the gene NT copy
number, and 4) each target gene NT value was normalized to the
ACTB loading control gene NT value, and presented as target
gene NT molecules/106
ACTB molecules (Table 2, Table S1B in
File S1).
Accuracy
The concentration of each stock (purified) IS was determined
using densitometric quantification of the appropriately sized peak
after electrophoretic separation on the Agilent Bioanalyzer 2100.
Then the appropriate volume of each IS was combined to make an
ISM. After preparing the ISM, limiting dilution PCR and Poisson
analysis were used to determine the true concentration of each IS
in the ISM. Specifically, the stock ISM solution was serially diluted
to a concentration expected to contain 40, 20, 10, 7, 4, 2, 1, 0.7,
0.4, 0.1 molecules of each IS in each microliter. The expected
frequency of reactions with detectable PCR product at each
dilution was tested with real time PCR using the pre-amplification
method to increase the signal to background ratio (See the above
section: Pre-amplification (1st
round PCR) and second-round
PCR. As an example, when 1 ml of the dilution expected to
contain 0.7 molecules per microliter solution was included in the
PCR, the expected frequency of positive reactions was 50.3% by
Poisson analysis. The nine replicate samples of each dilution for
each gene (ACTB, MYC, E2F1, CDKN1A) were measured. For each
dilution the observed frequency of positive values (true concen-
tration value) was plotted versus the frequency expected if the
concentration determined by Agilent Bioanalyzer 2100 was
correct [29].
Linearity
For each gene, the linearity of the assay was assessed through
serial 10-fold dilution of the external standard stock solution
(10211
M NT/10211
M IS to 10217
M NT/10217
M IS) or serial
dilution keeping IS constant and diluting NT up to 1/80-fold
relative to IS and vice versa. For each dilution series, correlation
coefficient (r2
) and slope (linearity) were calculated.
Imprecision
For each gene, the imprecision was measured as the coefficient
of variation (CV) of the copy number measured at each dilution
used in the linearity test. The CV was calculated as the standard
deviation divided by the mean derived from multiple replicate
measurements (at least three). The average CV across all dilutions
for each gene, and the average CV across all four genes were
calculated.
Table 2. Effect of external standards mixture (ESM) on quality control.
Without ESM correction
ACTB MYC
Sample Day ISM NT Cq IS Cq Raw DCq
Molecules/
Assay NT Cq IS Cq
Raw
DCq
Molecules/
Assay MYC/106
ACTB
SM8 #1 D(212/214) 11.7 13.0 21.3 1.5E+06 16.7 18.5 21.8 2.1E+04 1.4E+04
#2 D(212/214) 11.8 11.3 0.5 4.3E+05 19.7 16.4 3.3 6.0E+02 1.4E+03
E(212/215) 11.7 11.0 0.7 3.7E+05 18.7 19.0 20.2 7.1E+02 1.9E+03
#3 D(212/214) 11.6 10.8 0.8 3.4E+05 19.8 16.9 2.9 8.1E+02 2.4E+03
E(212/215) 12.2 11.2 1.0 3.0E+05 19.8 20.4 20.6 9.0E+02 3.0E+03
#4 D(212/214) 18.0 16.6 1.4 2.3E+05 26.2 24.3 1.9 1.6E+03 7.0E+03
#5 D(212/214) 12.1 13.6 21.5 1.7E+06 20.2 19.7 0.5 4.3E+03 2.5E+03
CV 0.90 1.75 0.99
With ESM correction
SM8 #1 D(212/214) 21.3 22.0 0.7 3.8E+05 21.8 23.0 1.2 2.5E+03 6.6E+03
#2 D(212/214) 0.5 0.0 0.4 4.5E+05 3.3 2.3 1.1 2.9E+03 6.5E+03
E(212/215) 0.7 0.0 0.6 3.8E+05 20.2 2.3 22.5 3.4E+03 8.8E+03
#3 D(212/214) 0.8 20.6 1.4 2.3E+05 2.9 1.7 1.2 2.7E+03 1.2E+04
E(212/215) 1.0 20.6 1.6 2.0E+05 20.6 1.7 22.3 2.9E+03 1.5E+04
#4 D(212/214) 1.4 0.5 0.9 3.3E+05 1.9 0.9 1.1 2.9E+03 8.8E+03
#5 D(212/214) 21.5 22.1 0.6 3.9E+05 0.5 20.5 1.0 3.0E+03 7.7E+03
CV 0.27 0.09 0.32
Inter-day experimental variation without and with ESM.
Note: SM8: surgically removed, formalin-fixed, paraffin-embedded (FFPE) sample 8. ISM D (212/214) contains ACTB IS 10212
M/target gene IS 10214
M that corresponds
to ACTB IS 600000/target gene IS 6000 molecules. ISM E (212/215) contains ACTB IS 600000/target gene IS 600 molecules. Cq: quantification cycle. DCq: quantification
cycle difference of NT and IS: NT Cq - IS Cq. CV: coefficient of variation. NT: native template. IS: internal standard. ISM: internal standards mixture.

Robustness and Interference Tests
The effect of intentionally perturbing PCR conditions was
assessed. Conditions altered included PCR volume and concen-
tration of primer, probe, or EDTA [30]. Samples used for this
analysis were cDNA reverse transcribed from non-FFPE treated
benign lung tissue RNA (Life Technologies, Grand Island, NY) or
FFPE-processed, surgically-removed, malignant lung tissue sample
1 or 8 RNA (SM1, SM8).
EDTA concentration variation. The effect of variation in
PCR EDTA concentration on MYC and ACTB measurement was
assessed in triplicate 20 ml PCR assays containing non-FFPE,
benign lung cDNA pre-amplified with ISM. EDTA concentrations
tested were 0, 0.5, 1, 1.4, 1.8, 2.2, 2.6, 2.8, 3.0, 3.2, 3.4, 3.6 and
4.0 mM.
Effect of ESM on Quality-control
The effect of variation in fluorescence intensity on reliability of
measurement was tested by varying ratio of [labeled probe]/
[unlabeled probe] keeping [total probe] in the PCR constant at
200 nM. PCR assays were conducted for MYC and ACTB
measurement in non-FFPE, benign lung cDNA pre-amplified
with ISM. The IS labeled probe concentration in the PCR was
kept constant while NT labeled probe was diluted with unlabeled
probe to 200, 150, 100, 80, 40, 20, 10, 5, 0 nM or vice versa.
Unlabeled probe was obtained from Life Technologies, Grand
Island, NY.
Inter-day experimental variation without or with ESM was
tested in FFPE sample SM8 cDNA in seven PCR reactions on five
different days. The automatically selected Cq values were used to
measure MYC/106
ACTB.
Statistical Analysis
The transcript abundance value (target gene molecules/106
ACTB molecules) for each LCDT gene was measured in triplicate
and variation was measured as the CV. We used the Student’s t-
test to determine a significant (P,0.05) difference in mean LCDT
value of the malignant group compared to the benign group.
Levene’s test was used to assess the equality of variances in
different samples for Student’s t-test using R program (v 2.15.2).
The receiver operator characteristic (ROC) plot was generated by
GraphPad Prism 6.
Results
Analytical Validation of Primers, Probes, and Internal
Standard Mixtures
Primer efficiency and specificity. Primer efficiency was
determined by PCR analysis of serially diluted IS. For each gene,
at the dilution predicted to contain a single molecule of IS based
on Agilent 2100 concentration analysis, the fraction of measured
replicates that had detectable PCR product was consistent with the
frequency predicted by Poisson analysis (see Accuracy section
below). The Poisson analysis results support the conclusion that the
IS concentration was accurate and that the primers had efficiency
necessary to generate a detectable signal from a single molecule
after 40 cycles [29].
Probe specificity. For the first E2F1 assay design, the NT
probe had .10% non-specific binding, so it was re-designed to
increase the number of changes in IS compared to NT from four
to six base pairs. After the re-design of the E2F1 IS and its
respective probe, non-homologous (non-specific) binding was ,
1% for both NT and IS probes for all genes, more than meeting
our threshold acceptance criteria.
Internal standards mixture accuracy. After the IS were
combined into the ISM, the ISM was serially diluted beyond the
level expected to contain a single molecule in a PCR assay, and the
IS for each of the four genes was PCR-amplified in the PCR assays
containing each ISM concentration. The observed frequency of
the positive result was highly correlated (R2
= 0.94) with the
expected positive frequency predicted by Poisson analysis (Figure 2,
Figure S2 in File S1), indicating that the intended concentration
for each IS in the ISM was accurate.
Analytical Validation of the Competitive Multiplex Two
Color Real-time Method
Linearity. The linearity of the two-color fluorometric assay
was determined by analysis of serial dilutions of synthetic NT and
IS for each gene. In a serial dilution of the stock ESM (a 1/1
mixture of NT/IS) over seven orders of magnitude (from 10211
M
through 10217
M), the correlation coefficient for the measurement
of each gene relative to its respective IS was .0.99, and the
average slope for the signal-to-analyte response was 1.060.05
(Figure 3A, B, Figure S3 in File S1).
To more stringently assess linearity, the NT was serially diluted
relative to a constant IS concentration of 10212
M and the IS was
diluted relative to a constant NT concentration of 10213
M. In the
dilutions with NT/IS or IS/NT ratio of ,10, the average slope for
the four genes (ACTB, E2F1, MYC, CDKN1A) was 1.060.10 in
each set of dilution series. At dilutions with NT/IS or IS/NT .10,
there was a slight deviation of the slope from 1.0 (Figure 3C–E,
Figure S4 in File S1, S5 in File S1).
Imprecision. The imprecision for measurement of the
LCDT genes was measured among both the ESM dilution
samples and the NT/IS dilution samples.
At each serial 10-fold dilution of ESM (10211
M NT/10211
M
IS to 10217
M NT/10217
M IS), the average coefficient of
variation (CV) for measurement of each of the four genes was ,
10% for .60 molecules input (10211
M NT/10211
M IS to 10216
M NT/10216
M IS) and ,30% for .6 molecules input (10211
M
NT/10211
M IS to 10217
M NT/10217
M IS) with little inter-
gene variation (Table S2 in File S1).
Figure 2. Observed compared to expected positive PCR with
limiting dilution. Frequency of observed relative to expected positive
PCR signal was measured. Poisson analysis was used to calculate
expected positive frequency. Results from the average of nine replicates
at each of 10 internal standard mixture dilution points (40, 20, 10, 7, 4, 2,
1, 0.7, 0.4, 0.1 molecules/ml) averaged across the four genes (ACTB, MYC,
E2F1, CDKN1A) were compiled and plotted. Each gene plot is presented
in Figure S2 in File S1.

Figure 3. Observed compared to expected E2F1 NT molecule values measured by two-color fluorometric assay in dilution series
samples. Linearity graphs (A, C, E) and amplification plots of E2F1 (B, D, F). (A, B) Serial dilution of external standards mixture (ESM, 1/1 mixture of NT/
IS) from 10211
M through 10217
M (triplicate measurements, with error bars). (C, D) NT dilution relative to constant IS from 1/1 NT/IS (10212
M) down to
1/80 (NT/IS) (triplicate measurements with error bars). (E, F) IS dilution relative to constant NT from 1/1 NT/IS (10213
M) down to 1/80-fold (one
replicate). NT: native template. IS: internal standard.

Among the NT/IS dilution samples, the average CV among the
four LCDT genes was calculated for different ranges of dilution.
For an NT dilution from 1/1 to 1/10-fold relative to a constant IS,
the average CV among the four genes was 12%. At dilutions
beyond 1/10, the CV increased, but from 1/1 to 1/80 NT
dilution the average CV was only 20% (Table S3 in File S1).
Similar results were observed for an average CV for each of the
four genes in the IS dilution relative to a constant NT.
Robustness and interference testing. Changing the vol-
umes and/or the concentrations of primers or probes did not lead
to significant differences in expression measurement of MYC or
ACTB in FFPE SM1 cDNA with or without pre-amplification
(Figure S6 in File S1).
As EDTA concentration was increased, Cq value of each of the
four analytes tested in non-FFPE, pre-amplified, benign lung
cDNA (MYC IS and NT, ACTB IS and NT) increased, ultimately
resulting in no signal (Figure 4). However, the MYC NT and ACTB
NT values calculated relative to their respective IS were constant,
and due to the loss of signal for IS at highest EDTA concentration,
no false negative values were reported.
Use of ESM to control for variation in fluorescent labeling
of probe and selection of threshold. The specific activity of
probe labeling with fluor (i.e., [labeled probe]/[total probe]) may
vary between experiments due to freezing and thawing of probes
or due to lot differences, the effect of variation in fluorescence
specific activity on measurement of MYC in benign, non-FFPE
lung cDNA was tested. As the labeled probe concentration
decreased in the reaction, the Cq increased (Figure 5A, C).
However, this potential source of analytical variation was
controlled by correcting the measured lung sample [NT Cq - IS
Cq] values relative to the ESM [NT Cq - IS Cq] values (Figure 5B,
D). The ESM contained a known 1:1 concentration of each NT
and IS that was constant among experiments, any variation in the
observed ESM [NT Cq - IS Cq] relative to the expected value of 0
was attributable to variation in experimental conditions, including
fluorescence intensity.
Another potential source of inter-experimental variation is inter-
experimental variation in selection of Cq threshold. Even when
the Auto Cq mode is used to select automatically the optimal Cq
threshold, there was large inter-experimental variation in NT/IS
Cq difference based on amplification plot and amount of cDNA
loaded (Figure 5E). Thus, whether the threshold was selected
through the automatic method or the manual method, there was
day-to-day variation in the selected Cq threshold setting.
However, because the inter-experimental variation in the Cq
threshold had the same effect on sample Cq and ESM Cq, inter-
experimental variation in sample Cq was controlled by ESM Cq as
described in the previous paragraph. For example, MYC/106
ACTB was measured in FFPE sample SM8 cDNA in seven PCR
replicates on five different days and the Cq threshold value
automatically selected in each PCR was different (Figure 5E)
resulting in high CV of 0.99. However, with the ESM correction,
the CV of measured MYC/106
ACTB was reduced to 0.32 (Table 2).
Fitness for Purpose Testing in FFPE Samples
The histomorphologic diagnosis of benign or malignant FFPE
samples used in this study is presented in Table S4 in File S1. The
RNA yield and purity are presented in Table S5 in File S1.
Optimization of FFPE reverse transcription. Efficiency of
RT with GSP or RHP was assessed in three (two malignant and
one benign) surgical FFPE samples (SM1, SM2, SB1). The average
yield of cDNA from 1 mg RNA was more than 50-fold higher with
GSP. Based on this, analysis of FFPE samples was conducted with
GSP in RT. The RT yield was increased another 4.6-fold by
increasing RNA in RT to 5 mg.
Effect of pre-amplification. Results for analysis of LCDT
genes in sample SM1 with or without pre-amplification were
compared to quantify the increase in signal relative to background
resulting from pre-amplification and to confirm that it did not
significantly alter the result. Importantly, for each gene the signal
was increased (Cq decreased) with pre-amplification. Specifically,
Cq value decreased for ACTB, MYC, E2F1, and CDKN1A by 9, 10,
9 and 10, respectively, following pre-amplification and 1000-fold
dilution of the pre-amplification product prior to second round
amplification. Yet, because each target was measured relative to a
known number of its respective IS molecules, the value measured
with the pre-amplification method was not significantly different
from that measured with the no pre-amplification (Figure S6 in
File S1).
Analysis of MYC, E2F1, CDKN1A and ACTB in FFPE
samples. The comparison of the LCDT index in benign and
malignant surgical FFPE samples is presented in Figure 6A, and
the ROC curve analysis is presented in Figure 6B. Based on the
linearity and imprecision results, for analysis of clinical samples,
we chose to restrict the conditions for calculation of results to1/10
to 10/1-fold difference between the NT and the IS.
Figure 4. Internal standards control for PCR inhibition by
EDTA. MYC and ACTB were measured in the presence of varying EDTA
concentration. (A) Quantification cycle (Cq) values of MYC IS, MYC NT,
ACTB IS, ACTB NT. (B) Molecules of each gene and normalized value of
MYC/106
ACTB molecules (triplicate measurements) analyzed in benign,
non-FFPE lung cDNA reverse transcribed with gene specific primers. NT:
native template. IS: internal standard. FFPE: formalin-fixed, paraffin-
embedded. The asterisk (*) indicates that Cq values were undetermined
by software.

The LCDT optimal cut-off value had 90% specificity and 90%
sensitivity to classify samples as cancer or non-cancer, similar to
previous reports with non-FFPE fine needle aspirate (FNA)
samples [31,32]. The ROC area under the curve was 0.93 with
a 95% confidence interval of 0.82 to 1.04 and the P-value of
Student’s t-test for stratification of malignant from non-malignant
was 0.0061. The average CV among surgical FFPE samples for
measurement of MYC, E2F1, and CDKN1A relative to ACTB was
0.27, 0.41, and 0.26, respectively (Table 3). These data confirm
fitness for purpose of this optimized LCDT test in FFPE samples.
Discussion
Here we report the analytical validation and fitness for purpose
testing of an RT-qPCR method suitable for reliable analysis of
FFPE samples. Key features of this optimized method are
highlighted here.
Internal Standards Provide Quality Control
The endogenous amount (NT) of each of multiple genes was
measured relative to a known number of respective IS molecules.
Each IS amplified with the same efficiency as the NT, and this
controlled for inter-sample variation in PCR interfering substances
and inter-experimental variation in PCR reagent quality or
quantity or thermal cycling conditions as previously described
[30,33,34]. Key to the elimination of inter-experimental variation
when measuring multiple genes was use of the same ISM
comprising a known concentration of IS for each of the genes to
Figure 5. External standards mixture controls for inter-experimental variation in fluor signal or quantification cycle (Cq) selection.
(A–D) Effect of diluting labeled probe with unlabeled probe on measurement of MYC in benign, non-FFPE lung cDNA reverse transcribed with gene
specific primers (triplicate measurements, with error bars). (A, B) NT labeled probe diluted with NT unlabeled probe. (C, D) IS labeled probe diluted
with IS unlabeled probe. (E) Effect of inter-day variation in threshold selection on measurement of MYC and ACTB in surgically removed, FFPE sample
8 (SM8). NT: native template. IS: internal standard. FFPE: formalin-fixed, paraffin-embedded. The asterisk (*) indicates that Cq values were
undetermined by software.

be measured [16]. The ISM was both stable and simple and
inexpensive to prepare.
Two-color Fluorometric Real-time PCR
For reliable analysis of FFPE samples, it is important to use
primers that yield short PCR products (e.g. 60280 base pairs).
Such products are readily quantified using real-time PCR.
Figure 6. Validation of two-color fluorometric assay in 20 surgically removed, FFPE lung samples. (A) lung cancer diagnostic test (LCDT)
index values by diagnostic class. (B) receiver operator characteristic curve (ROC) of LCDT index.
Table 3. Each gene measurement and lung cancer diagnostic test (LCDT) index in surgically removed, formalin-fixed, paraffin-
embedded lung samples (n = 20).
MYC E2F1 CDKN1A LCDT
Benign AVE SD CV AVE SD CV AVE SD CV
SB1 1.5E+4 1.2E+4 0.83 6.7E+2 3.9E+2 0.58 3.6E+4 1.5E+4 0.41 2.8E+2
SB2 2.1E+4 8.6E+3 0.42 1.3E+3 9.6E+2 0.77 5.8E+4 9.5E+3 0.16 4.5E+2
SB3 4.1E+3 4.9E+2 0.12 2.8E+3 1.0E+3 0.35 3.1E+4 2.2E+3 0.07 3.8E+2
SB4 7.4E+3 1.0E+3 0.14 1.5E+3 4.5E+2 0.30 3.0E+4 2.6E+3 0.09 3.6E+2
SB5 1.8E+3 3.1E+2 0.17 1.4E+3 1.7E+2 0.12 1.1E+4 5.7E+2 0.05 2.4E+2
SB6 3.2E+3 5.7E+2 0.18 1.3E+3 2.7E+2 0.20 4.1E+4 1.0E+4 0.25 1.1E+2
SB7 8.1E+3 2.4E+3 0.30 7.5E+3 3.7E+3 0.49 4.0E+4 1.3E+4 0.32 1.5E+3
SB8 9.5E+3 3.1E+3 0.33 1.3E+3 8.5E+2 0.65 5.4E+4 3.2E+3 0.06 2.3E+2
SB9 6.6E+3 1.2E+3 0.18 7.1E+2 4.8E+2 0.69 2.4E+4 7.4E+3 0.31 2.0E+2
SB10 2.7E+4 6.8E+3 0.26 9.5E+2 6.3E+2 0.66 7.6E+4 2.6E+4 0.35 3.3E+2
AVE 0.29 0.48 0.21
Malignant AVE SD CV AVE SD CV AVE SD CV
SM1 1.5E+4 3.8E+3 0.25 6.1E+3 2.7E+3 0.45 5.1E+4 2.3E+4 0.45 1.8E+3
SM2 7.4E+3 1.6E+3 0.22 8.2E+3 2.3E+3 0.28 2.2E+4 5.5E+3 0.25 2.8E+3
SM3 1.2E+4 4.0E+3 0.33 1.2E+3 5.0E+2 0.43 1.6E+4 4.4E+3 0.28 8.9E+2
SM4 1.4E+4 2.7E+3 0.20 1.2E+3 5.2E+2 0.43 4.4E+4 7.7E+3 0.17 3.8E+2
SM5 1.2E+4 3.1E+3 0.26 1.8E+3 3.5E+2 0.20 1.8E+4 5.1E+3 0.29 1.2E+3
SM6 7.7E+3 1.8E+3 0.23 4.2E+3 1.9E+3 0.45 1.9E+4 3.7E+3 0.20 1.7E+3
SM7 9.3E+3 2.9E+3 0.31 2.0E+4 6.4E+3 0.31 5.0E+4 1.7E+4 0.33 3.8E+3
SM8 9.8E+3 3.4E+3 0.35 2.8E+3 1.3E+3 0.47 3.6E+4 1.4E+4 0.39 7.6E+2
SM9 1.3E+4 1.6E+3 0.12 3.2E+3 1.3E+2 0.04 2.6E+4 8.5E+3 0.33 1.7E+3
SM10 1.0E+4 1.9E+3 0.19 2.4E+3 9.9E+2 0.41 2.9E+4 1.1E+4 0.40 8.7E+2
AVE 0.25 0.35 0.31
Note: SB: surgically removed, benign sample. SM: surgically removed, malignant sample. AVE: average. SD: standard deviation. CV: coefficient of variation.

Competitive PCR analysis involves simultaneous quantification of
each target gene NT and its respective IS. To do this by real-time
PCR requires inclusion of two different sequence-specific probes in
the same PCR reaction, each with a different fluor [12,13,35].
Calculating each NT analyte relative to its respective IS requires
an additional measurement, and, in some studies, this may be
associated with a tendency to increased imprecision [36].
However, as previously reported, the imprecision observed in this
study was less than 10% except for the measurement of very low
copy numbers (,60 copies), at which point imprecision is
determined largely by the natural law governing stochastic
sampling variation rather than method-specific characteristics
[16].
ESM Controlled for Inter-run Variation in Probe
Fluorescence
Multiple different factors may cause inter-experimental varia-
tion in fluor signal detection including variation in fluor
concentration (Figure 5A–D), variation in cycle threshold setting
(Figure 5E), and as yet unknown sources. The use of the ESM
significantly reduced these sources of inter-experimental variation
(Table 2). In addition to use in multiple analyte assays, such as the
one presented here, this approach is applicable to single analyte
two-color fluorometric assays [12,13] and may demonstrate
similar utility if so employed.
Multiplex Pre-amplification was Enabled by Use of
Internal Standards
Using IS in conjunction with multiplex pre-amplification
enabled reliable analysis of even lowly expressed genes in very
small amounts of cDNA. Specifically, it was possible to determine
the starting number of NT molecules, even after two rounds of
PCR, by measuring the NT signal relative to the IS signal (Figure
S6 in File S1). This is because a known number of its respective IS
molecules was included in the pre-amplification reaction for each
gene, and because the NT and IS amplified with the same
efficiency [20].
Competitive multiplex pre-amplification improved measure-
ment of FFPE samples in the following ways. First, cDNA
consumption was reduced. In the multiplex pre-amplification,
reduction in cDNA consumption depends on the number of
targets and reference genes. Thus, in this study involving only
three target genes and a single reference gene, cDNA consumption
was reduced four-fold. We have previously conducted competitive
multiplex pre-amplification with 96 genes, and this enabled a
marked reduction in cDNA required for measurement of each
gene [20,37].
Second, pre-amplification markedly increased signal above the
background signal typically observed in the no template control at
35 Cq. Specifically, with one round of PCR (no pre-amplification)
the Cq for each NT and IS ranged from 20–35. In contrast, using
pre-amplified and 1000-fold diluted samples, the Cq for each NT
and IS after a second round of PCR ranged from 11–26. The
amount of dilution of first round amplification product can be
reduced if necessary to ensure sufficient signal in the second round
for very low input of sample cDNA. Further, for analysis of FNA
FFPE samples with very low input cDNA, the higher signal
following pre-amplification is associated with better precision than
no pre-amplification (data not shown).
Gene Specific Reverse Transcription
We recently reported that use of gene specific priming in RT
increases yield of cDNA by 10–100 fold compared to oligo dT or
random hexamer priming when applied to RNA from human
peripheral blood leukocytes [26]. Because FFPE treatment
typically reduces yield of cDNA from RNA by 100-fold, we
evaluated the utility of gene specific priming relative to random
hexamer priming to increase signal. The more than 50-fold
increase in cDNA yield with gene specific priming RT compared
to random hexamer priming RT observed in this study is
consistent with our results from the prior study with leukocytes.
Fitness of Method for FFPE Sample Analysis
Fitness of this two color fluorometric method for analysis of
FFPE samples was evaluated by measuring a previously described
test for lung cancer diagnosis for non-FFPE FNA samples [31,32]
in a small number of surgical FFPE benign and malignant lung
samples. The results support the utility of this optimized method
for analysis of FFPE samples. Specifically, imprecision was
acceptable, and the optimal cut-off for the LCDT had similar
accuracy in separating benign from malignant compared to what
was reported previously for fresh FNA samples [31,32]. These
results support the conclusion that the method presented here is
suitable for use in a planned clinical validation trial in which the
LCDT will be evaluated for utility to augment cytomorphology in
analysis of FNA cell block FFPE samples.
Summary
Successful analytical validation described here of the quality-
controlled two-color fluorometric real-time PCR method for
analysis of the LCDT in FFPE samples supports use of this
approach in development and implementation of promising RT-
qPCR based diagnostic tests that require analysis of RNA
extracted from FFPE samples.
Supporting Information
File S1 Supporting information. Table S1, (A) Composition
of Internal Standards Mixture (ISM) A–F. (B) Steps to calculate
MYC/106
ACTB value for surgically removed, malignant sample 1
(SM1). To quantify the copy number for each target gene native
template (NT) in a cDNA sample, 1) the DCq: [NT Cq - IS
Cq]Sample for unknown sample and the average of two concen-
trations of ESM DCq: [NT Cq - IS Cq]ESM were calculated, 2)
The corrected delta Cq was calculated as: [NT Cq - IS Cq]Sample -
[NT Cq - IS Cq]ESM, 3) 2(2 corrected delta Cq)
was multiplied times
the known number of input IS copies in the reaction to obtain the
gene NT copy number, and 4) each target gene NT value was
normalized to the ACTB loading control gene NT value, and
presented as target gene NT molecules/106
ACTB molecules. ISM
D (213/215) contains ACTB IS 10213
M/each target gene IS
10215
M that corresponds to ACTB IS 60000/each target gene IS
600 molecules. Figure S1, Schematic plot of experiment set up for
96 well plate. After dilution of pre-amplified PCR product
containing cDNA and internal standards mixture (ISM), an
aliquot of each diluted products was distributed into individual
wells for 2nd
round amplification for each individual gene native
template (NT) and respective internal standard (IS) using gene-
specific primers and probes. ISM C(213/215) was presented in
the figure as an example, containing ACTB IS 10213
M/each
target gene IS 10215
M corresponding to ACTB IS 60000
molecules/each target gene IS 600 molecules. The PCR
amplification plots for ACTB from the two external standard
mixtures (ESM), NT and IS each at 10213
M or NT and IS each at
10214
M, are presented in one plot in the middle. Green is NT
and red is IS in the plot. SM: surgically removed, malignant
sample. NTC: no template control. Figure S2, Observed

compared to expected positive PCR with limiting dilution PCR for
each gene. Pre-amplification method was used for testing 9
replicates. Each of 10 dilution points of internal standards mixture
(ISM) (40, 20, 10, 7, 4, 2, 1, 0.7, 0.4, 0.1 molecules) was multiplex
pre-amplified nine times then observed PCR positivity for each
gene at 2nd
amplification. Figure S3, Observed compared to
expected native template (NT) molecule values measured by two-
color fluorometric assay in external standards mixture (ESM)
dilution series samples. ESM (1/1 mixture of NT and internal
standard (IS)) was serial 10-fold diluted from NT 10211
M/IS
10211
M to NT 10217
M/IS 10217
M and each dilution sample
analyzed in triplicate. Figure S4, Observed compared to expected
native template (NT) molecule values measured by two-color
fluorometric assay in serially diluted synthetic NT relative to
constant synthetic internal standard (IS) dilution series samples.
ACTB, MYC, E2F1, or CDKN1A synthetic NT was serially diluted
relative to constant synthetic IS, starting with 1/1 NT/IS mixture
at 10212
M. A, C, E, G: Linearity from 1/1 to 1/10-fold NT
dilution. B, D, F, H: Linearity from 1/1 to 1/80-fold NT dilution.
We assessed 1/1, 1/2, 1/3, 1/4, 1/5, 1/6, 1/7, 1/8, 1/9, 1/10, 1/
12, 1/14, 1/16, 1/18, 1/20, 1/24, 1/28, 1/32, 1/36, 1/40, 1/48,
1/56, 1/64, 1/72, 1/80-fold dilutions of NT relative to constant
IS. Data were analyzed with triplicate measurement. Figure S5,
Observed compared to expected native template (NT) molecule
values measured by two-color fluorometric assay in serially diluted
synthetic internal standard (IS) relative to constant synthetic NT
dilution series samples. ACTB, MYC, E2F1, or CDKN1A synthetic
IS was serially diluted relative to constant synthetic NT starting
with 1/1 of NT/IS mixture at 10213
M. A, C, E, G: Linearity
from 1/1 to 1/10-fold IS dilution. B, D, F, H: Linearity from 1/1
to 1/80-fold IS dilution. We assessed 1/1, 1/2, 1/3, 1/4, 1/5, 1/
6, 1/7, 1/8, 1/9, 1/10, 1/12, 1/14, 1/16, 1/18, 1/20, 1/24, 1/
28, 1/32, 1/36, 1/40, 1/48, 1/56, 1/64, 1/72, 1/80-fold dilution
of IS relative to constant NT (one replicate measurement). Auto
Cq could not be generated for the 1/56, 1/64, 1/72, 1/80-fold IS
dilutions of ACTB. Table S2, Effect of external standards mixture
(ESM) dilution on precision in measurement of each lung cancer
diagnostic test (LCDT) genes by two-color fluorometric real-time
assay. A serially diluted 1:1 ratio of native template (NT): internal
standard (IS) from 10211
M through 10217
M was analyzed in
triplicate. Table S3, Effect of native template (NT) dilution relative
to internal standard (IS) on precision in measurement of the lung
cancer diagnostic test (LCDT) genes by two-color fluorometric
real-time assay. For each gene serial dilution of synthetic NT up to
1/80-fold relative to constant IS was measured at each dilution. At
each NT dilution points the compiled data across the four genes
(ACTB, MYC, E2F1, CDKN1A) in triplicate measurements were
presented. Figure S6, Effect of PCR reaction conditions on lung
cancer diagnostic test (LCDT) gene expression values measured in
cDNA with or without pre-amplification. A: pre-amplification. B:
no pre-amplification. Surgically removed, formalin-fixed, paraffin-
embedded, malignant sample 1(SM1) reverse transcribed with
gene specific primers was used. The reference optimal PCR
condition was 20 ml reaction volume (2V), 800 nM of primers
(1Pm) and 200 nM of probes (1Pb). To test robustness, we reduced
volume by half, and/or doubled primer or probe concentration in
each of the two conditions (pre-amp or no pre-amp). Table S4,
Histomorphological diagnosis of surgically removed, formalin-
fixed, paraffin-embedded samples. Table S5, Total RNA sample
quantity and purity assessment (A) (n = 20).
(DOCX)
Acknowledgments
The authors thank Xiaolu Zhang for help with discussions, Yasmin Isler
and Theresa Cummins for providing samples.
Author Contributions
Conceived and designed the experiments: JCW JY. Performed the
experiments: JY LMS RED. Analyzed the data: JY ELC TMB SAK
JCW. Contributed reagents/materials/analysis tools: JZ LEDLC. Wrote
the paper: JCW JY.
References
1. Overdevest JB, Theodorescu D, Lee JK (2009) Utilizing the Molecular Gateway:
The Path to Personalized Cancer Management. Clinical Chemistry 55: 684–
697.
2. Poste G, Carbone DP, Parkinson DR, Verweij J, Hewitt SM, et al. (2012)
Leveling the Playing Field: Bringing Development of Biomarkers and Molecular
Diagnostics up to the Standards for Drug Development. Clinical Cancer
Research 18: 1515–1523.
3. Coyle VM, Johnston PG (2010) Genomic markers for decision making: what is
preventing us from using markers? Nature Reviews Clinical Oncology 7: 90–97.
4. Khleif SN, Doroshow JH, Hait WN, Colla A-F-NCB (2010) AACR-FDA-NCI
Cancer Biomarkers Collaborative Consensus Report: Advancing the Use of
Biomarkers in Cancer Drug Development. Clinical Cancer Research 16: 3299–
3318.
5. Antonov J, Goldstein DR, Oberli A, Baltzer A, Pirotta M, et al. (2005) Reliable
gene expression measurements from degraded RNA by quantitative real-time
PCR depend on short amplicons and a proper normalization. Laboratory
Investigation 85: 1040–1050.
6. Chung JY, Braunschweig T, Hewitt SM (2006) Optimization of recovery of
RNA from formalin-fixed, paraffin-embedded tissue. Diagn Mol Pathol 15: 229–
236.
7. Fleige S, Pfaffl MW (2006) RNA integrity and the effect on the real-time qRT-
PCR performance. Mol Aspects Med 27: 126–139.
8. Godfrey TE, Kim SH, Chavira M, Ruff DW, Warren RS, et al. (2000)
Quantitative mRNA expression analysis from formalin-fixed, paraffin-embedded
tissues using 59 nuclease quantitative reverse transcription-polymerase chain
reaction. J Mol Diagn 2: 84–91.
9. Sen K, Fout GS, Haugland R, Moulton C, Grimm A, et al. (2004) Quality
assurance/Quality control Guidance for Laboratories Performing PCR Analyses
on Environmental Samples. United States Evironmental Protection Agency:
EPA 815-B-04–001. Available:http://www.epa.gov/ogwdw/ucmr/ucmr1/
pdfs/guidance_ucmr1_qa-qc.pdf. Accessed. September 2013.
10. Anonymous (2005) Microbiology of food and animal feeding stuffs-Polymerase
chain reaction (PCR) for the detection of food-borne pathogens-General
requirements and definitions. International Organization for Standardization
(ISO): BS EN ISO 22174. https://www.iso.org/obp/ui/#iso:std:iso:22174:ed-
1:v1:en. Accessed September 2013.
11. Sen K, Fout GS, Haugland R, Moulton C, Grimm A, et al. (2010) Draft
Guidance for Industry and Food and Drug Administration staff; Establishing the
Performance Characteristics of in vitro Diagnostic Devices for the Detection of
Clostridium difficile. Health and Human Services, Food and Drug Administration
( F D A ) . A v a i l a b l e : h t t p : / / w w w . f d a . g o v / M e d i c a l D e v i c e s /
DeviceRegulationandGuidance/GuidanceDocuments/ucm234868.htm. Ac-
cessed Sep 2013.
12. Schumacher W, Frick E, Kauselmann M, Maier-Hoyle V, van der Vliet R, et al.
(2007) Fully automated quantification of human immunodeficiency virus (HIV)
type 1 RNA in human plasma by the COBAS (R) AmpliPrep/COBAS (R)
TaqMan (R) system. Journal of Clinical Virology 38: 304–312.
13. Gelderblom HC, Menting S, Beld MG (2006) Clinical performance of the new
Roche COBAS (R) TaqMan HCV test and high pure system for extraction,
detection and quantitation of HCV RNA in plasma and serum. Antiviral
Therapy 11: 95–103.
14. Swanson P, Huang SH, Holzmayer V, Bodelle P, Yamaguchi J, et al. (2006)
Performance of the automated Abbott RealTime (TM) HIV-1 assay on a
genetically diverse panel of specimens from Brazil. Journal of Virological
Methods 134: 237–243.
15. Apostolakos MJ, Schuermann WH, Frampton MW, Utell MJ, Willey JC (1993)
Measurement of gene expression by multiplex competitive polymerase chain
reaction. Anal Biochem 213: 277–284.
16. Canales RD, Luo Y, Willey JC, Austermiller B, Barbacioru CC, et al. (2006)
Evaluation of DNA microarray results with quantitative gene expression
platforms. Nat Biotechnol 24: 1115–1122.
17. Willey JC, Crawford EL, Knight CR, Warner KA, Motten CA, et al. (2004)
Standardized RT-PCR and the standardized expression measurement center.
Methods Mol Biol 258: 13–41.

18. Wang AM, Doyle MV, Mark DF (1989) Quantitation of Messenger-Rna by the
Polymerase Chain-Reaction. Proceedings of the National Academy of Sciences
of the United States of America 86: 9717–9721.
19. Gilliland G, Perrin S, Blanchard K, Bunn HF (1990) Analysis of Cytokine
Messenger-Rna and Dna - Detection and Quantitation by Competitive
Polymerase Chain-Reaction. Proceedings of the National Academy of Sciences
of the United States of America 87: 2725–2729.
20. Crawford EL, Warner KA, Khuder SA, Zahorchak RJ, Willey JC (2002)
Multiplex standardized RT-PCR for expression analysis of many genes in small
samples. Biochem Biophys Res Commun 293: 509–516.
21. Farragher SM, Tanney A, Kennedy RD, Paul Harkin D (2008) RNA expression
analysis from formalin fixed paraffin embedded tissues. Histochem Cell Biol 130:
435–445.
22. Masuda N, Ohnishi T, Kawamoto S, Monden M, Okubo K (1999) Analysis of
chemical modification of RNA from formalin-fixed samples and optimization of
molecular biology applications for such samples. Nucleic Acids Res 27: 4436–
4443.
23. Cronin M, Pho M, Dutta D, Stephans JC, Shak S, et al. (2004) Measurement of
gene expression in archival paraffin-embedded tissues: development and
performance of a 92-gene reverse transcriptase-polymerase chain reaction assay.
Am J Pathol 164: 35–42.
24. DeMuth JP, Jackson CM, Weaver DA, Crawford EL, Durzinsky DS, et al.
(1998) The gene expression index c-myc x E2F-1/p21 is highly predictive of
malignant phenotype in human bronchial epithelial cells. Am J Respir Cell Mol
Biol 19: 18–24.
25. Ellison SLR, Williams AS, (Eds) (2012) Eurachem/CITAC guide: Quantifying
Uncertainty in Analytical Measurement. Available: www.eurachem.org. Ac-
cessed September 2013.
26. Stanoszek LM, Crawford EL, Blomquist TM, Warns JA, Willey PFS, et al.
(2013) Quality Control Methods for Optimal BCR-ABL1 Clinical Testing in
Human Whole Blood Samples. Journal of Molecular Diagnostics 15: 391–400.
27. Heid CA, Stevens J, Livak KJ, Williams PM (1996) Real time quantitative PCR.
Genome Research 6: 986–994.
28. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, et al. (2009) The MIQE
Guidelines: Minimum Information for Publication of Quantitative Real-Time
PCR Experiments. Clinical Chemistry 55: 611–622.
29. Sykes PJ, Neoh SH, Brisco MJ, Hughes E, Condon J, et al. (1992) Quantitation
of targets for PCR by use of limiting dilution. Biotechniques 13: 444–449.
30. Huggett JF, Novak T, Garson JA, Green C, Morris-Jones SD, et al. (2008)
Differential susceptibility of PCR reactions to inhibitors: an important and
unrecognised phenomenon. BMC research notes 1: 70.
31. Warner KA, Crawford EL, Zaher A, Coombs RJ, Elsamaloty H, et al. (2003)
The c-myc x E2F-1/p21 interactive gene expression index augments
cytomorphologic diagnosis of lung cancer in fine-needle aspirate specimens.
J Mol Diagn 5: 176–183.
32. Graves TG, Harr MW, Crawford EL, Willey JC (2006) Stable low-level
expression of p21(WAF1/CIP1) in A549 human bronchogenic carcinoma cell
line-derived clones down-regulates E2F1 mRNA and restores cell proliferation
control. Mol Cancer 5.
33. Sidor IF, Dunn JL, Tsongalis GJ, Carlson J, Frasca S, Jr. (2013) A multiplex real-
time polymerase chain reaction assay with two internal controls for the detection
of Brucella species in tissues, blood, and feces from marine mammals. Journal of
veterinary diagnostic investigation : official publication of the American
Association of Veterinary Laboratory Diagnosticians, Inc 25: 72–81.
34. Tichopad A, Kitchen R, Riedmaier I, Becker C, Stahlberg A, et al. (2009)
Design and Optimization of Reverse-Transcription Quantitative PCR Exper-
iments. Clinical Chemistry 55: 1816–1823.
35. Caliendo AM, Valsamakis A, Bremer JW, Ferreira-Gonzalez A, Granger S, et
al. (2011) Multilaboratory Evaluation of Real-Time PCR Tests for Hepatitis B
Virus DNA Quantification. Journal of Clinical Microbiology 49: 2854–2858.
36. Stenman J, Orpana A (2001) Accuracy in amplification. Nature Biotechnology
19: 1011–1012.
37. Blomquist TM, Crawford EL, Lovett JL, Yeo J, Stanoszek LM, et al. (2013)
Targeted RNA-sequencing with competitive multiplex-PCR amplicon libraries.
PLoS One: ‘‘In press’’.

2014-Yeo-A Multiplex Two-Color Real-Time PCR Method(1)

More Related Content

What's hot (20)

Similar to 2014-Yeo-A Multiplex Two-Color Real-Time PCR Method(1) (20)

2014-Yeo-A Multiplex Two-Color Real-Time PCR Method(1)