Analysis of some Capparis L. accessions from Turkey based on IRAP and seed protein patterns

International Journal of Environmental & Agriculture Research (IJOEAR) ISSN [2454-1850] [Vol-2, Issue-1, January- 2016]
Page | 43
Analysis of some Capparis L. accessions from Turkey based on
IRAP and seed protein patterns
Mehmet Çelik1
, Tamer Özcan2
1,2
Istanbul University, Faculty of Science, Department of Biology, Division of Botany, Süleymaniye, Fatih-
Istanbul/TURKEY
Abstract— 15 accessions from 10 different grid square of Turkey were analysed based on IRAP and seed protein patterns
in order to observe the genetic diversity in the gene pool of Capparis. High levels of polymorphisms were detected with IRAP
primers (93%) and seed protein electrophoresis (55.5%). Specific delineation between C. spinosa and C. ovata, and
segregations of the accessions related to infraspecific status and eco-geographical distributions were presented in the
dendrograms and PCA analysis. Significantly correlation between IRAP markers and seed protein profiles of the specimens
was detected (p< 0.0001). Combination of genomic/proteomic marker systems may be useful approach for determining the
broad genetic diversity in gene pool of Capparis, identification of the germplasms and ecologically tolerant genotypes in
breeding programs.
Keywords— Capparis, IRAP, seed protein, variation, genetic resources.
I. INTRODUCTION
Genus Capparis as evergreen shrubs, small trees and lianas in the family Capparaceae occur over a wide range of habitat in
the tropical and subtropical regions of the world comprising 350 species approximately. In the unrevised APG II system, it is
included in Brassicaceace. Capparis spinosa L., C. ovata Desf., C.leucophylla DC., C. mucronifolia Boiss., C. cartillaginea
Decne, C. decidua (Fosk) Edgew. are the common species in Mediterranean, Balkans and West Asian countries. Five species
are native for Mediterranean region (Inocencio, 2006). The plant as a straggling shrubs has simple entire leaves, with or
without stipular spines. Flowers showy, with 4 sepals, 4 petals, very many free stamens and an ovary borne on a stipe
becoming much elongated in fruit. Fruit is a berry-like, manyseeded capsule (Coode,1965). C. ovata andC. spinosa as native
species have large distributional patterns in Turkey with three accepted varieties for each species. Capparis has been used
since the ancient times as medicinal plant and food. Many species have recorded uses in herbalism and folk medicine.The
number of papers published on this topic so far.The fruits rich in micronutrients and flower buds are widely used pickled as a
vegetable condiment (Aktan et al. 1981). Alkaloids, lipids, flavonoids, glucosinolates, cancer preventing agents and
biopesticides were detected in biochemical analysis on Capparis. Antitumoral activity was detected in the extracts from the
flower buds containing antioxidants compounds in some species (Venugopal et al. 2011). Antiproliferative, antifungal and
HIV-1 reverse transcriptase inhibitory activities of a protein in the seeds of Capparis spinosa(Lam & Ng 2009), anti-
inflammatory and anti-thrombotic activities in the buds and fruits of Capparis ovata (Bektaş et al. 2012), and antidiabetic
and antioxidant activities in Capparis decidua (Zia-Ul-Haqet al. 2011) were also reported. Many studies on the flavanoid
contents (Ferheenet al. 2013), proximate compositions and fatty acid contents (Özcan & Akgül 1998; Vyas et al. 2009),
mineral compositions (Özcan, 2005) and organic acids of the fruits (Ren et al. 2012), glucosinolates, fatty acid, sterol, and
tocopherol composition of seed oils from Capparis species (Matthaus & Özcan 2005) were previously reported. The extracts
obtained from the leaves, roots and dry offshoots are used in cosmetic preparates, additives in perfumery and as regenerative
agent in hair loss. On the other hand, Capparis from arid regions are highly useful in reforestation and landscape gardening
in addition to preserve agricultural land and prevent soil erosion with large extensive root systems that penetrate deepley into
the ground.Capparis as a salt tolerant plant flourishing also in saline hard planes can adapt harsh environmental and climatic
conditions and are cultivated in some mariginal fields such as arid and semi-arid regions as alternative crop plants. Some
species and varieties as economic plants have been cultivated in Mediterranean countries including Spain, Morocco, Italy,
Turkey and Greece. For efficient use of the genetic resources of Capparis, molecular marker assisted breeding programs
which select the eligible genes distributing among the populations growing in various habitat conditions are needed to
improve the cultivars with high product potential. This genus is also important from taxonomical point of view, because the
existence of six varieties from two species in Turkey reflect high intraspecific variability. Therefore, observation within and
among populational variations, delimitation at infraspecific level, and determination of taxonomical and phylogeographical
relations much strictly are fundamental for understanding evolutionary process in addition to development of conservation

Page | 44
strategies. Apart from many published works using morphological descriptors, limited number of studies for estimating the
genetic diversity of Capparis species were published using molecular markers including RAPD (Vyas et al. 2009; Abdel-
Mawgood et al. 2010; Kumar et al. 2013), AFLP (Inocencio et al. 2005) and ISSRs (Saifi et al. 2011; Bhoyar et al. 2012)
which are very promising genetic markers for caper identification and population genetic studies. Genomic sequences of
novel 18S ribosomal RNA (Banaras et al. 2012) and newly isolated beta-tubulin genes (Aman et al. 2013) have been also
used in the phylogenetic relations of some species including Capparis.In a genetic diversity observations of some Turkish
Capparis populations based on RAPD markers, genetic distances among the populations were very low and greater
intraspecific variation in C. spinosa L. than C. ovata Desf. was recently reported from Turkey (Özbek & Kara 2013). Inter-
Retrotransposons Amplified Polymorphisms (IRAPs) as an alternative valuable retrotransposon-based markers are also used
to detect genotypes, measure diversity or reconstruct phylogeny (Flavell et al. 1999; Kalendar et al. 1999; Kumar &
Hirochika 2001). As mobile genetic elements, the copy number of retrotransposons was reported to vary even among closely
related plant taxa (Leigh et al. 2003; Tenaillon et al. 2011). Retrotransposons are divided into two groups depending on the
presence/absence of long terminal repeats (LTRs). Within the LTR retrotransposons, two subclasses, Ty1-copia and the Ty3-
gypsy, are particularly abundant and well analyzed in plants at different taxonomical categories (Park et al. 2007; Ma et al.
2008). Retrotransposon based molecular markers are excellent tools for detecting genetic diversity within a species (Kolano
et al. 2013) and genomic changes associated with retrotransposon activity in abiotic stress conditions (Fan et al. 2014). There
are many applications of multiple retrotransposon families for genetic analysis such as mapping, fingerprinting and marker-
assisted selection and evolutionary studies. But no any study was reported on the usage of retrotransposons for detecting of
genetic diversity of Capparis. On the other hand, protein electrophoresis has been widely used in germplasm discrimination
(Iqbal et al. 2003) and evaluation of agronomic traits (Ghafoor & Ahmad 2005)based on genetic differences in seed storage
protein comparison. Variations of quantitative traits are significantly associated with protein sub-units expressed by
individual genes or gene clusters scattered throughout the genome. Observation on the correlation of DNA-based markers
and protein patterns provide useful and reliable tools in the comparative genomics/proteomics as expressional fingerprinting
of the germplasms. There is a need to use some reliable and reproducible marker combinations to understand the relations
and circumscriptions of Capparis taxa much strictly, which have probably great variability in Anatolian gene pool. In the
framework of this study, it was aimed to determine infrageneric variations and geographical relations within Capparis
accessions collected from its native range in Turkey based on IRAP and seed protein band patterns, in addition to contribute
molecular identification of the germplasm collection representing different habitat conditions.
II. MATERIAL AND METHOD
2.1 Plant material
Capparis L. specimens including two species and 4 varieties were collected from 4–5 individual plant from each native
populations distributed in A1, A4, A6, B1, B4, C1, C2, C3, C6, C7 according to the grid system of Turkey in the period of
between June and August (Table 1).
TABLE 1
ORIGINS OF CAPPARIS ACCESSIONS
No. of specimen Location / Grid square Taxa
1 Ankara to Beypazarı / A4 C. ovata Desf. herbacea Willd.
2 Konya to Aksaray / B4 C .ovata Desf.var.canescens (coss.) Heywood.
3 Amasya /A6 C. ovata Desf. herbacea Willd.
4 Şanlıurfa to Bozova / C7 C .ovata Desf.var. palaestina Zoh.
5 Antalya to Muratpaşa / C3 C. spinosa L.var. spinosa Zoh.
6 İzmir to Balçova / B1 C. ovata Desf. herbacea Willd.
7 Marmara Ereğlisi to Kınalı / A1 C .ovata Desf.var.canescens (coss.) Heywood.
8 Burdur / C3 C. ovata Desf. herbacea Willd.
9 Bodrum to Aydın (S3) / C1 C. spinosa L.var. spinosa Zoh.
10 Antalya to Kemer (S6) / C3 C. spinosa L.var. spinosa Zoh.
11 Antalya to Isparta (S5) / C3 C. spinosa L.var. spinosa Zoh.
12 Kahramanmaraş / C6 C. spinosa L.var. spinosa Zoh.
13 Balıkesir to Sarımsaklı (S2) / B1 C .ovata Desf.var.canescens (coss.) Heywood.
14 Marmaris to Muğla (S4) / C2 C. spinosa L.var. spinosa Zoh.
15 Balıkesir to Burhaniye / B1 C .ovata Desf.var.canescens (coss.) Heywood.
S2-6 represent the localities from which seed samples also collected. S1 (C. spinosa var.spinosa) was collected additional
locality from B1

Page | 45
Herbarium materials were prepared from the specimens and determined using Flora of Turkey. Leaves and some fruit
samples of the accessions also transported to the laboratory in polypropylene bags and kept in deep -freezer (-18 ̊C) until the
analysis performed.
2.2 DNA analysis
Genomic DNA isolation was carried out on the leaf samples of 15 Capparis accessions by using CTAB method (Doyle
andDoyle 1987). DNA concentrations of the samples were detected in nanodrop spectrophotometer (BioSpec-nano;
Shimadzu-Biotech). 1 µl DNA samples run on polyacrylamide gel (1.5 %), died with ethidium bromide and visualized under
UV (BIORAD, Molecular Imager®
, ChemiDocTM
XRS+ with Image LabTM
Software). PCR reaction was firstly carried out
using 13 IRAP primers on the DNA sample of a Capparis accession. 5 primers (LTR 1; LTR 4; LTR 5; LTR 6 ve LTR 7)
showing high polymorphism were selected and applied on the genomic DNA of 15 Capparis accessions (Table 2).
Amplification reaction was carried out in 25 µl volume including 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 0.4
mM dNTP mixture (dATP, dGTP, dCTP ve dTTP), 0,4mM for each IRAP primer, 50 ng genomic DNA and 2U Taq DNA
polimerase (Invitrogen). An optimized program (Kalender et al. 2010) was used in PCR reaction (Thermocycler Model-
9700, Perkin-Elmer, Boston, MA, USA). After denaturation of genomic DNA at 95˚C for 3 min., PCR reaction comprise of
35 cycle at 95 ˚C for 15 sec., 55˚C for 30 sec., 72˚C for 3 min. and 72˚C for 10 min. as last extension reaction. Amplification
products obtained from each primer run on polyacrylamide gel (1.5 %) at 80 v., died with ethidium bromide and visualized
under UV at gel documentation and image analyse system (BIORAD, Molecular Imager®
, ChemiDocTM
XRS+ with Image
LabTM
Software).
TABLE 2
THE LIST OF IRAP PRIMERS SELECTED, THEIR NUCLEOTIDE SEQUENCES, THE NUMBER OF LOCI, RANGE OF
BASE PAIRS, NUMBER AND PERCENT OF POLYMORPHIC BANDS
No Primer Nucleotide sequences (5’-3’)
Position
and
orientation
Range of
amplified
bands per
sample
Number
of total
loci
Size (bp)
of
fragment
Number of
Polymorphic
loci
Polymorphic
loci (%)
1 LTR 1 ACCCCTTGAGCTAACTTTTGGGGTAAG 1282 →1308 1-5 6 500-1150 5 83.3
2 LTR 4 AGCCTGAAAGTGTTGGGTTGTCG 1111 ←1133 4-12 18 170-1250 18 100
3 LTR 5 CTGGCATTTCCATTGTCGTCGATGC 971 ← 995 3-14 17 300-2250 17 100
4 LTR 6 GCATCAGCCTGGACCAGTCCTCGTCC 586 ← 611 3-8 15 800-5100 15 100
5 LTR 7 CACTCAAATTTTGGCAGCAGCGGATC 460 →486 5-11 15 270-1500 11 73.3
2.3 Isolation and determination of total protein from seed samples
Specimens were pulverised in liquid nitrogen and homogenised with 1 ml extraction buffer at +4 ̊C (1 M Sükroz, 10 mM
HEPES pH 7.0, 5 mM MgCl2, 1 mM EDTA, 10 mM 2 -merkaptoetanol, 0.1 mM PMSF ve 5 mM Benzamidin) and protease
inhibitor (Sigma) for each 1 g samples. Homogenate including all protein fraction in 1.5 ml eppendorf were santrifuged in
cooled microfuge (at +4 ̊C) at 13 000 rpm for 5 min. All supernatants were taken into eppendorfs. Bradford method was
applied for determination of total protein amounts. After preparing BSA standart (Catalog Number P0914), samples in
microplates were measured at ELISA spectrophotometer at 595 nm wavelength. Total protein concentrations were calculated
based on standart curve.
2.4 SDS Page Gel Electrophoresis
BioRad protean 2 gel system was used. After preparing of resolving and stacking gel according to the protocol, resolving gel
was poured into instrument with using pipette. N-butanol was added with 2 mm high onto the gel for occuring smooth
polymerisation surface. N-butanol removed after polymerisation and glasses washed with H2O. Stacking gel are added and
leaved for polymerisation. Equal amounts of protein samples mixed with 2 x sample stacking buffer (0.125 M Tris, %4 SDS,
% 20 gliserol, %10 2-merkaptoetanol, pH 6.8), and denaturated at 95 o
C’de 5 min. The plates are washed with running

Page | 46
buffer for removing the acrilamide residues before the loading of denaturated protein samples into the plates. The samples
are loaded into the plates and connected to power with 16 mA (80 V) at the start, and raised to 30 mA (160 V). The system
were fixed at 40 mA for 6 hours for separating the protein bands. After the running of marker bant stained with brome phenol
blue edge to 0.5 cm of the gel, electrophoresis are terminated. The gels are taken into Coomassie Brillant Blue for at least
two hours in the shaker. Dying solution are removed and destaining solution replaced continually until the dye removed from
the gel for making apparent the bant patterns. The size of the protein band products of the specimen was estimated from 10 to
170 kDa protein ladder (Thermo Scientific Cat no: 26616 PageRuler Prestained Protein Ladder).
2.5 Statistical analysis
Homologous fragments in the gel patterns obtained with each IRAP primer were scored for the presence (1) or absence (0) to
create binary matrices. Dendrogram based on obtained data for genetic relationships between genotypes was constructed
using the unweighted pair-group method with arithmetic average (UPGMA) and Jaccard coefficient of similarity was
employed in calculation of distance based on the markers resulting from IRAP analysis though the software XLSTAT 2013.5
and MVSP 3.22 (Multivariate Statistics Package). Principle component analysis based on IRAP data was conducted with
statistiXL. Correlation analysis (Pearson) of the accessions based on IRAP data was carried out. Hierarchical cluster analysis
using average linkage (Between Groups) were carried out based on protein band patterns of the seeds with a statistical
package program (SSPS 11.5). Pearson correlation analysis was also performed between matrices (IRAPs/Seed protein)
based on Mantel test to obtain the significance of the correlation coefficient. The p value has been calculated using the
distribution of r(AB) estimated from 10,000 permutations.
III. RESULTS
In the PCR amplification based on 5 IRAP primer having higher number of band scored, 71 band totally were identified
between 170-5100 bp in Capparis accessions collected from 15 different locations represented in 10 grid squares of Anatolia.
66 band of total product are polymorphic (approx. 93 %), while 5 out of total band only are monomorphic. All bands
produced by LTR4, LTR5 and LTR6 are polymorphic (100 %). Gel profile of LTR1 was represented with the lower number
of band scored. Percentage of polymorphic bands for LTR7 calculated at the lower level (73.3 %) (Figs 1,2).
LTR1 LTR4
FIGURE 1 GEL IMAGES OF THE GENOMIC DNA OF 15 CAPPARIS ACCESSIONS BASED ON THE PRIMERS LTR1
AND LTR4. LANE 1, λ / HIND III; LANE 2, 1KB MARKER; LANE 3, 100 BP; LANE 4-18, LTR1 CAPPARIS 1-15;
LANE 19, λ / HIND III; LANE 20, 1 KB MARKER; LANE 21, 100 BP; LANE 21-36, LTR4 CAPPARIS 1-15.
1 2 3 4 5 6 7 8 9 10 11 1213 1415 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 3435 36 3636

Page | 47
LTR5 LTR6 LTR7
FIGURE 2 GEL IMAGES OF THE GENOMIC DNA OF 15 CAPPARIS ACCESSIONS BASED ON THE PRIMERS LTR5,
LTR6 AND LTR7. LANE 1-15, LTR5 CAPPARIS 1-15; LANE 16, 1KB MARKER; LANE 17, 100 BP; LANE 18, λ /
HIND III; LANE 19-33, LTR6 CAPPARIS 1-15; LANE 34, 1KB MARKER; LANE 35; 100 BP; LANE 36-50 LTR7
CAPPARIS 1-15.
The ranges of the sizes of the band scored are between 500 and 1150 for LTR1, 170-1250 for LTR4, 300-2250 for LTR5,
800-5100 for LTR6 and 270-1500 for LTR7 (Table 2). In the UPGMA dendrogram based on IRAPs pattern, the accessions
of C. spinosa and C. ovata were located separately in two main clads. In the first clad, geographically related accessions of
C. spinosa var. spinosa were clustered into two subclads, as Irano-Turanian and Mediterranean populations. Only one
accessions of this taxon was located in the separate clad. The second clad was also divided into two subclade including C.
ovata var. palaestina from C7 grid square in southeastern part of Anatolia and the other accessions of C. ovata. Last subclade
comprising of 8 accessions separated into an A4 population of C. ovata var. herbacea and the other populations of this
species collected from broad range of the distributions including (B1, B1), A6, B1, (C3, A1) and B4 grid squares as distinct
indivudial branches generally, showing broad genetical diversity of this stock. An accession of C. spinosa var. spinosa from
C2 population placed additionally in this group (Figure 3).
FIGURE 3 DENDROGRAM TREE OF 15 CAPPARIS GENOTYPES OBTAINED FROM UPGMA CLUSTER ANALYSIS
USING IRAP LOCI BASED ON JACCARD SIMILARITY COEFFICIENTS
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50

Page | 48
In the principle component analysis based on five primers producing high percentage of polymorphism show that the first
two axes of this analysis accounted for 53.18 % of the variation in the data. Principle components 1 and 2 explain 34.84 and
18.33 % of total variation, respectively. This analysis defines these relatively distinct groups. Taxonomical and eco-
geographical relations of the accessions were observed in the scatter plot (Figure 4.).
FIGURE 4 PRINCIPLE COMPONENT ANALYSES OF THE ACCESSIONS BASED ON IRAP DATA
Accessions of C. spinosa and C. ovata are clearly segregated in the diagram. One accession of C. spinosa var. spinosa from
C2 population located close to C. ovata accessions.Genetic similarity matrix of the populations using data from the primers
producing highest percentage of polymorphism was demonstrated in Table 3.Corelation coefficient (Pearson) was detected
between 0.113 and 0.961, and significant at p<0.005 and p<0.001 levels in taxonomically and geographically related
accessions. Six accessions of the seeds of Capparis was also analysed for total protein contents and their electrophoretic band
patterns in order to observe taxonomical and geographical relations of the accessions, and to test the correspondance with the
molecular marker results. Total protein amounts were detected between 12.35 % (C.ovata var. canescens) and 16.28 % (C.
spinosa var. spinosa) in the specimens (Table 4). Total number of loci scored is 18 between 15-170 kDa, and 10 of the total
number is polymorphic corresponding to 55.5 % genetic diversity (Figure 5). Monomorphic bands were observed in the
ranges of 65-105 kDa generally. The bands in the 4 accessions from C. spinosa var. spinosa were detected at 35 kDa level
except for two accessions from northern Aegean region of Turkey including C. spinosa var. spinosa and C .ovata var.
canescens. The last both samples produced much condense band patterns at 20 kDa grade compare to other samples. Extra
bands with 17 kDa in C .ovata var. canescens as a difference from C. spinosa var. spinosa were detected in the same cluster.

Page | 49
FIGURE 5 PROTEIN BAND PATTERNS OF 6 CAPPARIS ACCESSIONS
TABLE 3
GENETIC SIMILARITY MATRIX OF CAPPARIS ACCESSIONS BASED ON JACCARD COEFFICIENT
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
1 1
2 0,41 1
3 0,375 0,563 1
4 0,385 0,441 0,324 1
5 0,319 0,357 0,267 0,302 1
6 0,37 0,45 0,349 0,326 0,3 1
7 0,447 0,658 0,537 0,409 0,373 0,479 1
8 0,422 0,595 0,553 0,415 0,347 0,457 0,8 1
9 0,271 0,4 0,366 0,31 0,465 0,28 0,438 0,477 1
10 0,265 0,267 0,295 0,191 0,488 0,327 0,4 0,375 0,658 1
11 0,267 0,238 0,182 0,186 0,553 0,395 0,3 0,271 0,415 0,639 1
12 0,302 0,275 0,244 0,22 0,568 0,372 0,306 0,304 0,462 0,568 0,767 1
13 0,432 0,6 0,371 0,343 0,31 0,514 0,525 0,462 0,286 0,375 0,389 0,4 1
14 0,455 0,513 0,513 0,349 0,5 0,396 0,6 0,619 0,477 0,404 0,419 0,395 0,425 1
15 0,455 0,553 0,475 0,415 0,404 0,558 0,6 0,619 0,413 0,347 0,356 0,333 0,541 0,545 1
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
TABLE 4
TOTAL PROTEIN CONTENTS (%) IN THE SEEDS OF SPECIMENS AND THEIR BANDS SCORED IN
ELECTROPHORESIS
In the hierarchical cluster analysis, a dendrogram was constructed with two main clad (Figure 6). The accessions of C.
spinosa var. spinosa and C .ovata var. canescens from northwestern part of Anatolia were located in the same clad of the
Sample Total protein % Band scored
1 14.93 14
2 12.35 15
3 12.50 13
4 16.28 12
5 14.90 14
6 14.89 15
170
130
100
70
55
40
35
25
15
15

Page | 50
dendrogram. The other geographically related accessions of C. spinosa var. spinosa from the middle and southern part were
placed in the second clad. Only one accession from C1 middle part distribution was located in the separate branch of this
clad. C2 accession was clustered with C3 populations from southern Anatolia as a distinct clad showing close relations with
their locations. Considerable relations between the results obtained from protein band profiles and the geographical
distribution patterns of the accessions was observed. The results from IRAP profiles correspond with the protein data.
Correlations between the matrices of IRAPs and seed protein data were detected at significant level (p < 0.0001; r(AB) =
0.066).
FIGURE 6 UPGMA DENDROGRAM BASED ON TOTAL PROTEIN BAND PATTERNS OF THE SEEDS OF SIX
CAPPARIS ACCESSIONS
IV. DISCUSSION
In the present study, populational segregation in the studied gene pool of Capparis was achieved based on IRAP and total
protein band patterns of the specimens. Investigated traits as a reliable and useful genomic/proteomic marker test which are
significantly correlated with each others reflect different aspects of taxonomical concept. Macro-morphological characters
effected by environmental conditions may have a wide margin of error in traditional classification of Capparis. Some
variations in the habitus from distinct localities were described in the flora of Turkey. Therefore, morphological variability in
diagnostic features obscure taxonomical limits for identification of the varieties of both species native for Turkey. It is
needed much reliable and consistant parameters in order to establish populational and taxonomical relations of this genus. Up
to date, this study is the first to survey of IRAP-based assesment of genetic diversity in the Capparis genome.
Retrotransposon-based molecular markers has great potential in determination and identification of the germplasms,
evolutionary history of a genome and the relationships between taxa in different plant groups and agriculturel crops (Gribbon
et al. 1999). The inter-retrotransposon amplified polymorphism (IRAP) method displays insertional polymorphisms by
amplifying the segments of DNA between two retrotransposons. The copy number of retrotransposons may vary even among
closely related plant taxa (Tenaillon et al. 2011). It is generally accepted that retrotransposons affect genome size,
organization and function (Parisod et al.2009). Many phylogenetic comparisons of populations of retrotransposons,
particularly Ty1-copia-like elements, have been performed within and among related groups of taxa. Large variations in
retrotransposon copy number are observed over relatively short evolutionary time scales and their mode of replication
significantly increases genome size in higher plants. It was reported that at least 50 % maize genome (Shirasu et al. 2000)
and 55 % of Sorghum (Paterson et al. 2009) are composed of retrotransposons. In genetic analysis, usage of multiple
retrotransposon families reveal specific differences of each transposition event in the historic activity. Amplified bands
derived from the newly inserted retrotransposon elements may be polymorphic, appearing only in plant lines in which the
insertions have taken place. Different elements as high-copy-number dispersed sequences may be differently distributed in

Page | 51
the varieties, cultivated forms or wild relatives of Capparis. In Turkey, there are many populations of Capparis all around
Turkey in a wide range of habitat conditions including altitude, climate and regions such as arid, sub-humid and humid areas,
fields, limestone slopes, saline soils, wast and disturbed ground near cultivation etc. As a drought and fire resistant plant, the
deepest root system and wide ecological amplitude allow it to withstand harsh environments range and suitable for
combating desertification and erosion (Sakçalı et al. 2008). Eco-geographical factors may have a significant effect on the
genetic diversity of this genus. Retrotransposons are also considered to be an important factor in genome plasticity (Kidwell
& Lisch 1997). Transcriptional and transpositional activations of transposable elements are mainly induced by abiotic and
biotic stresses (Grandbastien,1998), and the activation has been regarded as the mechanism of genotypic remolding.Capparis
as light loving and salt tolerant plant is well grown under intense light and dry hot conditions on nutrient poor, sandy, drained
and gravely soils. Therefore, it is expected to have high retrotransposon activity in its genome. Insertional dynamics of
transposable elements could promote morphological and karyotypical changes, some of which might be potentially important
for the process of microevolution, allowing species with plastic genomes to survive as new forms or even as new species in
times of rapid climatic change (Belyayev et al.2010). The dendrogram and PCA analysis demostrated that the accessions of
C. spinosa and C. ovata were clearly segregated. First leaving clad from the cluster of C. ovata is var. palaestina which is
well differentiated with morphological traits from the other varieties of C. ovata. Remaining specimens are generally located
in separate branches collected from geographically diverse populations. Distances between the sampling locations are at least
150 km for representing much more genetic diversity in Anatolia. In addition to discrimination at variety level, such
clustering pattern account for spatial and genotypic divergency reflecting adaptation of the varieties to different habitat
conditions. Besides, some intermediate forms in Capparis at specific and infraspecific levels were reported in the previous
studies (Zohary, 1960; Coode, 1965; Higton & Akeroyd 1991). There are also some examples for intermediate types between
C. ovata and C. spinosa in culture conditions (Barbera & Di Lorenzo 1984). In the Flora of Turkey, it was reported that
specimens from C5 population of var. spinosa have leaves intermediate in size between var. spinosa and var. aegyptia. Some
specimens from B1 grid square also seems to be intermediate between var. spinosa and C. ovata Desf. var. canescens (Coss.)
Heywood (Coode, 1965). Additionally, Zohary reports having seen intermediates between var. aegyptia and C. ovata var.
canescens.Some introgressions or collateral cultivations may reveal the existence of local variants. In the PCA analysis based
on IRAP data, one accession of C. spinosa var. spinosa from C2 grid square has occured near C. ovata gene pool. This
accession that may be a transient form located in the IRAP cluster of C. ovata, implying its hybrid origin. In the protein
electrophoresis, this specimen has clustered with the other C. spinosa accessions collected from Mediterranean populations
as a separate clad. Considering distribution range of the varieties of C. spinosa and their morphological features, regarding
accession may be related with var. inermis. Besides, C. spinosa var. aegyptica recorded in Flora Hellenica and Flora of
Turkey in Samos island. It is needed to confirm the existence of this variety from Turkey wih using combined molecular
markers. One accession from northern population of var. spinosa was also clustered with C. ovata var. canescens based on
protein data. Some intermediate populations having hybrid forms were also reported between C. spinosa and C. ovata based
on RAPD analysis and morphological observations (Özbek & Kara 2013),implying that var. canescens may be a variety of C.
spinosa instead of C. ovata. C. spinosa was recognised as a single species without infraspecific categories by some authors
(Jacobs, 1965; Higton & Akeroyd 1991). This species whichhas long been cultivated for its edible buds exhibite broad range
of distribution in Mediterranean basin compare to the other species of Capparis (The Euro+Med PlantBase - the information
resource for Euro-Mediterranean plant diversity). The amount of genetic diversity seems to be related to population size
(Nosrati et al.2012). Therefore, high polymorphism ratios may be expected in this species. Morever, high polymorphisms
and eco-geographicalcorelations within the accessions of C. spinosa var. spinosa were also observed using IRAP and protein
data. On the other hand, C. ovata var. herbacea as the commonest variety in Turkey with high number of polymorphic
fragments in IRAP analysis has been reported to have some intermediate forms with var. palaestina. An accession of var.
herbacea from A6 grid square was placed as a separate clade within the group of C. ovata. This species was clearly
segregated into three subclade including var. palestina, var. herbacea that may be related with cultivated forms and the
others from Mediterranean and Irano-Turanian populations. C. ovata var. palaestina distributing in Mesopotamia is
distinguished from the other 2 varieties by its generally smaller leaves and white-canescent indumentum. This variety which
is well differentiated with morphological characters and molecular assesment from the other varieties of Capparis are the
first separating branch from C. ovata gene pool in the dendrogram. Parallel results with our findings on C. ovata var.
palaestina were reported based on RAPD analysis (Özge & Kara 2013). The amount of genetic diversity within the
populations are influenced by both the breeding system and the evolutionary history of each population. On the other side,
retrotransposons have been demonstrated to provide suitably polymorphic markers for variety identification or breeding
purposes (Vicient et al. 2001; Boyko et al. 2002), and sensitive enough to detect rapid genome changes (Belyayev et

Page | 52
al.2010).Retrotransposon markers are also sufficiently stable to allow their use in mapping projects (Huo et al.2009).
Identification of commercial cultivars, landraces and breeding lines based on IRAP method was demostrated in different
clusters of Linum usitatissimum L. and relatively lower level of polymorphism was reported in breeding lines and the
cultivars compare to wild accessions (Smy´kal et al. 2011). Obtained results proved the sensitivity of IRAP analysis for
discriminating the accessions from diverse populations in addition to specific delineation. In general, PCA analysis of natural
Capparis populations based on IRAP data displayed evident delimitation of both species with representing total variation of
53.18 %. Although genetic distances among 15 Turkish Capparis populations was reported to be very low (Özbek &Kara
2013), high polymorphism detected in the present study may account for the broad genetic base of Capparis in Anatolia,
indicating also high resolution capacity of the IRAP marker. It was also reported that low level of genetic diversity values
within population based on RAPD markers may be explained with the breeding system of Capparis represented by self-
pollination in extremely habitat conditions (Özbek & Kara 2013). Molecular variance analysis using combined data of RAPD
and ISSR showed maxiumum variation within the natural population in Capparis spinosa from trans-Himalayas, followed by
among population (Bhoyar et al. 2012). It will be better to analyse genetic diversity within a population using additional and
combined marker systems. IRAP analysis showed that the method are successful to differentiate the accessions including
varieties of C. spinosa L. and C. ovata Desf.. Morover, high polymorphism within the C. spinosa var. spinose gene pool
represented by various ecotypes was observed by overlapping data obtained from IRAP and protein analysis. Although high
polymorphism ratios were reported in some populations of Capparis from Turkey based on RAPD patterns (74.49 %)
(Özbek & Kara 2013) and North Morocco using ISSR markers (75.51 %) (Saifi et al. 2011), polymorphic fragments
produced by IRAPs primers with 93 % indicate high retrotransposon density within the genome of wild Capparis accessions
which is useful in analysis of genetical structure, marker-assisted selection, populational segregation, genetic diversity within
population and infraspecific delineation. The elucidation of genetic diversityis highly important for genetic improvement as
well. Morever, phylogenetic resolution between closely related germplasm accessions benefits from increasing the number of
polymorphic markers scored. Replicative mechanism of transposition may resulted in a high degreeof heterogeneity and
insertional polymorphism in this genus. It was reported that a retrotransposon that has been active recently in evolutionary
terms will be polymorphic between individuals within a species. Contrary, inactive retrotransposons for a long time which
are less polymorphic at the intra-specific level may be more informative at the inter-specific or higher taxonomic levels
(Leigh et al. 2003). Evolutionarily younger transposition events often result in relatively homogeneous groups of
retroelements (Hill et al.2005). High level of polymorphism within the same varieties may account for dense retrotransposon
activity in Capparis, indicating high adaptation and speciation potential in addition to utility of IRAP markers in taxonomic
and phylogenetic relations of this genus. Obtained results may be applied to all accessions of Capparis in Anatolia as reliable
marker test in order to establish core collections and structure of the germplasms. Earlier molecular marker analyses by
RAPD, AFLP and ISSR showed relatively a low diversity in Capparis. Here, it has been taken advantage of ubiquity and
abundance of LTR retrotransposons in genomic diversification of this genus. It may be better to observe the relation between
seed storage protein patterns and the molecular marker data from taxonomical and phylogenetical points of view as
genomic/proteomic approach. Obtained results may also contribute the identification of the germplasm with high product
potential, disease resistant and ecologically tolerant genotypes in Capparis. A combination of different marker systems can
therefore provide a comprehensive evaluation of the evolutionary history of a genome and the relationships between taxa.
Although great variability in morphological characters of Capparis seeds (Özbek & Kara 2013), reliability of the regarding
results were checked with the seed protein data as a constant tool to characterise the genetic structure of the natural
populations of Capparis. SDS-PAGE of seed storage proteins showed high inter-accession diversity (55.5 %) and some
differentiation on the basis of origin or source. Protein data segregated the accessions according to localities, reflecting also
actual expression profiles for the adaptation to the growing conditions. Remarkable correlation between the protein profiles
and eco-geographical patterns of the germplasms collected from neighbouring regions are also probably due to derived
progenies of the same ancestor. High variability in the protein band patterns of the accessions also indicate the broad genetic
base of Capparis in order to select the germplasm with better quantitative traits in the breeding programmes. Variation at
protein fractions in the vicinity of QTLs may be an indication of genetic variation potentially available to breeding
programmes for improving yield potential. It was reported that variation in 17 quantitative traits of Vigna unguiculata (L.)
Walp are related to seed storage protein patterns as a useful tool for discrimination of the germplasm, expressed by individual
genes or gene clusters scattered in the genome (Iqbal et al. 2003). Some chromosome locations controlling seed storage
proteins were also identified, and assumed that distribution pattern of the genes controlling seed storage protein probably
exists universally among family specific or even all plants and animals (Li et al. 2013). Protein band patterns may be useful
for delimitations at specific and variety level of Capparis accessions. Obtained band profiles also reflect the adaptation of the

Page | 53
accessions into growing conditions. High polymorpism of the proteom between and within varieties of Capparis may be
related with retrotransposon activity induced with biotic and abiotic stress conditions. Dynamic of retrotransposons in
Capparis genom may be responsible for producing of some specific additional protein fragments serving well adaptation and
the suitable functions in the stress conditions. Populations of several colonizing species across broad geographic and
environmental ranges have been confirmed to be consisted of genetically similar populations of highly plastic genotypes
(Hermanutz & Weaver 1996). A great evolutionary plasticity is also exist in Capparaceae flowers for adaptation to different
pollinating agents. Six accepted varieties of both Capparis species have very large and interesting distribution patterns in
different climatic and edaphic conditions in Turkey which may reflect its tolerance capacity and the distant geographical
speciation and progressive radiation potential in its native range. It is essential to enforce the protection of natural
populations and to expand the scope of protection of natural populations of Capparis in Anatolia. This study demonstrated
the utility of high-resolution IRAP markers based on the LTRs of retrotransposons and seed protein electrophoresis for
distinguishing Capparis accessions, and confirmed that those markers are highly informative for genetic diversity and
phylogenetic studies. Obtained results from examined traits revealed high level of polymorphism at infraspecific levels in
Capparis. This task awaits further large-scale genetic diversity analysis and establish of gene bank collections of Capparis
populations distributed in the brod range of habitat conditions in Anatolia.
ACKNOWLEDGEMENTS
This study was supported by Research Fund of Istanbul University. Project No:35185. The authors are gratefully
acknowledge to Associate Professor Dr. Yelda Özden Çiftçi and Research Assistant Veysel Süzerer from Gebze Institute of
Technology for her valuable supports in the laboratory works.
REFERENCES
[1] Abdel-Mawgood A.L., Jakse J., Al-Doss A.Ai & Assaeed A.M. (2010) Genetic structure and diversity within and among six
populations of Capparis decidua (forssk.) edgew. From Saudi Arabia. African Journal of Biotechnology 9(38):6256-6263.
[2] Aktan N., Bilgir B & Elgin E. (1981) Pickling product and keeping of capers flower buds. Ege University Agricultural Faculty Journal
18: 259-273.
[3] Aman S.,Iqbal M.,Abbas .S,Banaras S., Awais M., Ahmad I., Shinwari Z.K & Shakeel S.N. (2013) Molecular and comparative
analysis of newly isolated beta-tubulin partial gene sequences from selected medicinal plants. Pakistan Journal of Botany 45(2):507-
512.
[4] Banaras S., Aman S., Zafar M., Khan M., Abbas S., Shinwari Z.K & Shakeel S.N. (2012)Molecular identıfıcation and comparative
analyss of novel 18s ribosomal RNA genomic sequences of a wide range of medicinal plants. Pakistan Journal of Botany 44(6):2021-
2026.
[5] Barbera G & Di Lorenzo R.D. (1984) The caper culture in Italy. Acta Horticulturae 144:167–171.
[6] Bektas N., Arslan R.,Goger F.,Kirimer N & Öztürk Y. (2012) Investigation for anti-inflammatory and anti-thrombotic activities of
methanol extract of Capparis ovata buds and fruits. Journal of Ethnopharmacology 142(1):48-52
[7] elyayev A., Kalendar R., Brodsky L., Nevo E., Schulman A.H & Raskina O. (2010) Transposable elements in a marginal plant
population: temporal fluctuations provide new insights into genome evolution of wild diploid wheat. Mobile DNA1:6.
[8] Bhoyar M.S.,Mishra G.P.,Naik P.K., Murkute A.A & Srivastava R.B. (2012) Genetic Variability Studies Among Natural Populations
of Capparis spinosa from Cold Arid Desert of Trans-Himalayas Using DNA Markers. National Academy Science Letters 35(6):505-
515.
[9] Boyko E., Kalendar R., Korzun V., Korol A., Schulman A.H & Gill B.S. (2002) A high-density cytogenetic map of the Aegilops
tauschii genome incorporating retrotransposons and defence related genes: insights into cereal chromosome structure and function.
Plant Molecular Biology 48:767–790.
[10] Coode M.J.E.(1965) Capparis L..In: Davis P.H. (eds).Flora of Turkey and the East Aegean Islands. Edinburgh University Press,
Edinburgh, pp. 496-498.
[11] Doyle J.J & Doyle J.L. (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19:
11-15.
[12] Fan F., Bowen C., Zhang T., Ding G & Wen X. (2014) LTR-Retrotransposon activation, IRAP marker development and its potential
in genetic diversity assesmentof masson pine (Pinus massoniana). Tree Genetics and Genomes10:213-222.Flavell A.J., Knox M.R.,
Pearce S.R& Ellis T.H.N.(1999) Retrotransposon-based insertion polymorphisms (RBIP) for high-throughput marker analysis. Plant
Journal 16: 643-650.
[13] Ferheen S., Rasool M.A., Imran M., Fareed G., Afza N & Malik A. (2013) Capspinosin, a New Flavonoid from Capparis spinosa.
Journal of Chemical Society of Pakistan 35(3):984-986.
[14] Ghafoor A & Ahmad Z. (2005) Diversity of agronomic traits and total seed protein in black gram Vigna mungo (L.) Hepper.Acta
Biologica Cracoviensia Series Botanica 47(2):69-75.
[15] Grandbastien M.A. (1998) Activation of plant retrotransposons under stress conditions. Trends in Plant Science 3(5):181–187.

Page | 54
[16] Gribbon B.M., Pearce S.R., Kalendar R., Schulman A.H., Paulin L., Jack P.L., Kumar A & Flavell A.J. (1999) Phylogeny and
transpositional activity of Ty1-copia group retrotransposons in cereal genomes. Molecular and General Genetics 261:883–891.
[17] Hermanutz L.A & Weaver S.E. (1996) Agroecotypes or phenotypic plasticity? Comparison of agrestal and ruderal populations of
Solanum ptycanthum. Oecologia 105:271–280.
[18] Hill P., Burford D., Martin D.M.A & Flavell A.J. (2005) Retrotransposon populations of Vicia species with varying genome size.
Molecular Genetics and Genomics 273:371–381
[19] Higton R.N & Akeroyd J.R. (1991) Variation in Capparis spinosa L. in Europe. Flora Europaea 106(2):104–112
[20] Huo H., Conner J.A & Ozias-Akins P. (2009) Genetic mapping of the apospory-specific genomic region in Pennisetum squamulatum
using retrotransposon-based molecular markers. Theoretical and Applied Genetics 119:199–212.
[21] Iqbal M.S.,Ghafoor A.,Qureshi A.S & Ahmad Z. (2003) Genetic dissimilarities in cowpea (Vigna unguiculata (L.) Walp.) for protein
peptides and their significance for quantitative traits loci. Pakistan Journal of Botany 35(3):377-386.
[22] Inocencio C., Cowan R.S., Alcaraz F., Rivera D & Fay M.F. (2005) AFLP fingerprinting in Capparis subgenus capparis related to the
commercial sources of capers. Genet Resources and Crop Evolution 52:137–144.
[23] Inocencio C., Rivera D., Obo´n M.C., Alcaraz F & Barren˜a A. (2006) A systematic revision of Capparis section Capparis
(Capparaceae). Annals of the Missouri Botanical Garden 93(1):122–149.
[24] Jacobs M. (1965) The genus Capparis (Capparaceae) from the Indus to the Pacific. Blumea 12(3):385–541.
[25] Kalendar R,. Grob T., Regina M., Suomeni A & Schulman A .(1999) IRAP and REMAP: two new retrotransposon-based DNA
fingerprinting techniques. Theoretical and Applied Genetics 98: 704–711.
[26] Kidwell M.G & Lisch D. (1997) Transposable elements as sources of variation in animals and plants. Proceeding ofthe National
Academy of Science of the United States of America 94:7704–7711
[27] Kolano B., Bednara E & Weiss-Schneeweiss H .(2013) Isolation and characterization of reverse transcriptase fragments of LTR
retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae). Plant Cell Reports 32:1575–1588.
[28] Kumar A& Hirochika H.(2001) Applications of retrotransposons as genetic tools in plant biology. Trends in Plant Science6: 127–134.
[29] Kumar S., Sharma R., Kumar V.,Vyas G.K & Rathore A. (2013) Combining molecular-marker and chemical analysis of Capparis
decidua (Capparaceae) in the Thar Desert of Western Rajasthan (India). Revista de Biologia Tropical 61(1):311-320.
[30] Lam S.K & Ng T.B. (2009)A protein with antiproliferative, antifungal and HIV-1 reverse transcriptase inhibitory activities from caper
(Capparis spinosa) seeds. Phytomedicine 16(5):444-450
[31] Leigh F., Kalendar E.R., Lea E.V., Lee E.D., Donini E.P & Schulman A.H. (2003) Comparison of the utility of barley retrotransposon
families for genetic analysis by molecular marker techniques.Molecular Genetics and Genomics 269: 464–474.
[32] Li X.,Islam S.,Yang H.A.,Ma W.J.&Yan G.J. (2013) Identification of chromosome regions controlling seed storage proteins of
narrow-leafed lupin (Lupinus angustifolius). Journal of Plant Research 126(3):395-401.
[33] Ma Y., Sun H.Y., Zhao G.L., Dai H.Y., Gao X.Y., Li H & Zhang Z.H .(2008) Isolation and characterization of genomic
retrotransposon sequences from octoploid strawberry (Fragaria ananassa Duch.). Plant Cell Reports 27:499–507
[34] Matthaus B & Özcan M. (2005) Glucosinolates and fatty acid, sterol, and tocopherol composition of seed oils from Capparis spinosa
var. spinosa and Capparis ovata Desf. var. canescens (Coss.) Heywood. Journal of Agricultural and Food Chemistry 53:7137-7141.
[35] Nosrati H., Feizi M.A.H., Mazinani M. & Haghighi A.R. (2012) Effect of population size on genetic variation levels in Capparis
spinosa (Capparaceae) detected by RAPDs. EurAsian Journal of BioScience 6:70–75.
[36] Özbek Ö & Kara A. (2013) Genetic variation in natural populations of Capparis from Turkey, as revealed by RAPD analysis. Plant
Systematics and Evolution 299:1911–1933.
[37] Özcan M & Akgül A. (1998) Influence of species, harvest date and size on composition of capers (Capparis spp.) flower buds.
Nahrung 42:102-105.
[38] Özcan M. (2005) Mineral composition of different part of Capparis ovata Desf. var. canescens (Coss.) Heywood growing wild in
Turkey. Journal of Medicinal Food 8(3):405-407.
[39] Parisod C., Salmon A., Zerjal T., Tenaillon M., Grandbastien M.A & Ainouche M. (2009) Rapid structural and epigenetic
reorganization near transposable elements in hybrid and allopolyploid genomes in Spartina. New Phytologist 184:1003–1015.
[40] Park J.M., Schneeweiss G.M & Weiss-Schneeweiss H. (2007) Diversity and evolution of Ty1-copia and Ty3-gypsy retroelements in
the non-photo synthetic flowering plants Orobanche and Phelipanche (Orobanchaceae). Gene 387:75–86
[41] Paterson A.H, Bowers J.E., Bruggmann R.et al. (2009) The Sorghum bicolor genome and the diversification of grasses. Nature
457:551–556.
[42] Ren Q,X.,Chen W.,Zhao H.J.,Wu Z.B & Zhang H. (2012) Organic acids from Capparis spinosa fruit .Chemistry of Natural
Compounds 48(5):868-869.
[43] Saifi N., Ibijbijen J & Echchgadda G. (2011) Genetic diversity of caper plant (Capparis ssp.) from North Morocco.Journal of Food
Agriculture and Environment 9 (3-4):299-304.
[44] Sakçalı M.S., Bahadır H & Öztürk M. (2008) Eco-Physiology of Capparis spinosa L. : A plant suitable for combating desertification.
Pakistan Journal of Botany 40(4):1481-1486.
[45] Shirasu K., Schulman A.S., Lahaye T & Schulze-Lefert P. (2000) A contiguous 66-kb barley DNA sequence provides evidence for
reversible genome expansion. Genome Research 10:908–915.

Page | 55
[46] Smy´kal P., Bacˇova´-Kerteszova´ N., Kalendar R., Corander J., Schulman A.H & Pavelek M. (2011) Genetic diversity of cultivated
flax (Linum usitatissimum L.) germplasm assessed by retrotransposon-based markers. Theoretical and Applied Genetics122:1385–
1397.
[47] Tenaillon M.I., Hufford M.B., Gaut B.S & Ross-Ibarra J. (2011) Genome size and transposable element content as determined by
highthroughput sequencing in maize and Zea luxurians. Genome Biology and Evolution 3:219–229.
[48] Venugopal Y., Ravindranth A., Kalpana G & Prabhakar P.R.(2011) Anti-tumor activity of Capparis sepiaria on Ehrlich Ascites
Carcinoma in mice. International Journal of Biomedical Research 2:262-71.
[49] Vicient C.M., Kalendar R& Schulman A.H. (2001) Envelope-class retrovirus-like elements are widespread, transcribed and spliced,
and insertionally polymorphic in plants. Genome Research 11:2041– 2049.
[50] Vyas G.K., Sharma R., Kumar V., Sharma T.B & Khandelwal V. (2009) Diversity analysis of Capparis decidua (Forssk.) Edgew.
using biochemical and molecular parameters. Genetic Resources and Crop Evolution 56:905–911.
[51] Zia-Ul-Haq M., Cavar S., Qayum M., Imran I & de Feo V. (2011) Compositional Studies: Antioxidant and Antidiabetic Activities of
Capparis decidua (Forsk.) Edgew. International Journal of Molecular Sciences 12(12):8846-8861.
[52] Zohary M. (1960) The species of Capparis in the Mediterranean and the Near Eastern Countries. Bulletin of the Research Council of
Israel 8D: 49-64.

Analysis of some Capparis L. accessions from Turkey based on IRAP and seed protein patterns

More Related Content

What's hot (20)

Viewers also liked (12)

Similar to Analysis of some Capparis L. accessions from Turkey based on IRAP and seed protein patterns (20)

Recently uploaded (20)

Analysis of some Capparis L. accessions from Turkey based on IRAP and seed protein patterns