Basic and Advanced Practical Biochemistry.ppt

Suez Canal University
Faculty of Science
Zoology Department
Basic and Advanced Practical
Biochemistry
(BAPB)

Section 1
Basic Medical
Analysis (BMA)
(Blood & Urine)
Section 2
Molecular & Clinical
Analysis (MCA)
Practical Physiology Course at a
Glance

SECTION 1
LABORATORY
INSTRUMENTATIONS

Laboratory Instrumentation
 Development of novel modern medical
instrumentation requires the combination of
many traditional disciplines including biology,
optics, mechanics, mathematics, electronics
and chemistry.
 Labware and Scientific Instruments describes
a category of devices that are used to test,
analyze, control, calibrate, display and record
data in laboratory and other testing situations.

 The major families within labware and scientific
instruments are:
1. Analytical Instruments (AI)
2. Chromatography Instruments (CI)
3. Environmental Instruments (EI)
4. Lab And Test Equipment (LTE)
5. Sample Preparation (SP)
6. Separation Devices (SD)
7. Sensing & Measurement Instruments (SMI)
8. Spectrometers (SPC)

 Clinical and research labware and scientific
instruments are physical products used to assist in
experimentation, research, or other laboratory
activities:
1. Autosamplers, Autoclaves And Sterilizers
2. Baths And Circulators
3. Biological Safety Cabinets
4. Degassers, Digesters And Diluters
5. Heating Mantles, Clean Benches, Hoods, Incubators
6. Balances, Mixers, Ovens, Pipettes And Tubing, Vials And
Syringes

Micropipettes (variable and fixed)/Tips

Blood collection tubes with push caps/Disposable
Syringes, Vacuum blood test tubes

Glass slides and covers, Eppendorf tubes, Test tubes and
racks

Laboratory balance, Laboratory Microscope, UV-
Visible Spectrophotometer, Refrigerated Centrifuge.

Fully automated cell counter, PCR Thermal Cycler

DNA & Protein Electrophoresis Set

Enzyme-Linked Immuno-Sorbent Assay Set

High Performance Liquid Chromatography (HPLC)

SECTION 2
BASIC MEDICAL ANALYSIS
(BMA)
(HEMATOLOGY)

Basic Medical Analysis (Haematology)
1. Blood
1. Blood
• Blood is a "circulating tissue" of the body.
•Blood components
•Functions of blood
55%
45%

2. Production of
2. Production of Blood
Blood Cells
Cells
 Blood
Blood cell production is called
cell production is called
hematopoiesis
hematopoiesis and occurs in both
and occurs in both
the
the liver
liver and the
and the spleen
spleen of the fetus.
of the fetus.
After birth, blood cells are
After birth, blood cells are
produced in the spongy tissue
produced in the spongy tissue
bones, the
bones, the bone marrow
bone marrow.
.
 The bone marrow produces stem
cells which are the "parent cells,"
for more mature blood cells. Stem
cells respond to chemical signals
(cytokines) produced by the body
to increase the number of a specific
population of circulating blood
cells which are needed.

3. Complete Blood Count (CBC)
• The CBC is a laboratory test that is performed on a
small amount of blood usually taken from an arm
vein.
• The CBC is a useful screening and diagnostic test
that is often done as part of a routine physical
examination.
• It can provide valuable information about:
1. The blood and blood-forming tissues. (bone marrow).
2. Abnormal results can indicate the presence of a
variety of conditions-including anemias, leukemias,
and infections.

• A complete blood count is actually a series of tests in
which:
1. WBCs—these cells fight infection, immune
responses (total & differential leukocytes).
2. RBCs—these cells contain hemoglobin.
3. Hemoglobin (Hb)—the red protein in the RBCs.
4. Hematocrit (Ht)—is a measure of the percentage
of red blood cells to the total blood volume.
5. Platelet—these stop bleeding by helping to form
blood clots.
3. Complete Blood Count (CBC)

4. Red Blood Cells (RBCs)
• RBCs (Erythrocytes) are the most plentiful cells in the
blood. They give the blood its red color and are
primarily responsible for carrying oxygen to tissues.
• The life span of each RBC is about 120 days.
• RBCs should in fact be referred to as "corpuscles"
rather than cells.
• Erythrocytes consist mainly of hemoglobin and
stroma.
• In 2007 it was reported that erythrocytes also play a
part in the body's immune response (Hb…….Free
Radicals…..Pathogens).

5. Red Blood Cells Experiments
A. The hematocrit (Ht or HCT)
• The hematocrit (Ht or HCT) or packed cells volume
(PCV) are measures of the proportion of blood
volume that is occupied by RBCs, WBCs & Plt.
• It is normally 45 ± 7 (38-52%) for males and 42 ± 5
(37-47%) for females.
• The volume of packed blood cells, divided by the total
volume of the blood sample gives the PCV.

Hematocrit Ruler
Hematocrit Centrifuge

Elevated Ht:
(1) Polycythemia
(2) Thrombocythemia
(3) Dehydration concentrates the blood and then
increasing the hematocrit.

Lowered Ht:
(1) Hematocrit values decrease when the size or
number of red cells decreases. This is most
common in anemia, but other conditions have
similar effects such as liver disease, and cancers
affecting the bone marrow.
(2) Hydration (e.g. pregnant women have extra fluid,
which dilutes the blood, decreasing the
hematocrit).

B. Haemoglobin Content (Hb)
• Hb is the iron-containing
oxygen-transport metalloprotein
in the red blood cells.
• The name hemoglobin is the
concatenation of heme and
globin.
• It is normally 13.5-17.5 g/dL for
males and 12 -16 g/dL for
females.

Determination of Haemoglobin Content (Hb)
Haemoglobinmeter
Spectrophotometer

C. RBCs Count
• The red blood cell (RBC) count determines the
total number of red cells (erythrocytes) in a sample
of blood.
• Methods:
(1) Manual using haemocytometer
(2) Automated using cell counter (Haematology
Automated Analyzer).

C. RBCs Count (Haemocytometer)
A haemocytometer. The
two semi-reflective
rectangles are the counting
chambers.
The parts of the
hemocytometer (as viewed
from the side) are identified.

C. RBCs Count (Haemocytometer)
1/5 mm
1/20 mm
RBCs Counting chamber

The total number of small squares observed is 16 x 5 = 80.
If X is the total number of blood cells observed in 80 squares, the
average number of blood cells present in each small square will be
X/80
The area of each square = 1/20 x 1/20 sq. mm.
The volume of each small square = 1/20 x 1/20 x 1/10 = 1/4000
cu mm.
1/4000 cu mm contains X/80 cells,
1cu mm will have (X x 4000)/80 cells
But the fluid has been diluted 200 times
The cells present per cu mm in the blood = (X x 4000 x 200)/80
=X x 104
Calculations

D. Blood Groups
• A blood group ((Name Tags)) is a classification of blood
based on the presence or absence of inherited antigenic
substances (Agglutinogens) on the surface of RBCs.
(Agglutinins).
• These antigens (A, B, D) may be proteins, carbohydrates,
glycoproteins or glycolipids, depending on the blood group
system.
• In the routine preparation of blood for transfusion in a
blood bank, the presence or absence the immunogenic blood
group antigens, the A antigen, the B antigen and the RhD
antigen are always determined for all recipient and donor
blood.

D. Blood Groups
• The ABO & Rhesus systems are the most important
blood group systems in human blood transfusion.

How to find out your blood group?

E. Erythrocyte Sedimentation Rate (ESR)
• Erythrocyte Sedimentation Rate (ESR) is a
nonspecific screening test for various diseases.
• It is a simple and inexpensive test that measures the
distance that red blood cells have fallen after one
hour in a vertical column of anticoagulated blood
under the influence of gravity.
• The amount of fibrinogen in the blood directly
correlates with the ESR.

• Any condition that increases fibrinogen levels (e.g.,
pregnancy, infections (including TB), diabetes
mellitus, end-stage renal failure, heart disease) may
elevate the ESR.
RBCs Rouleaux

• Purpose: A physician can use ESR to monitor a
person with an associated disease.
• Precautions: The ESR should not be used to screen
healthy persons for disease.
Westergren
and the
Wintrobe
Methods.
Blood +
3.8% Na
citrate (4:1)

Basic and Advanced Practical Biochemistry.ppt

• Normal results: Normal values for the Westergren
method are:
 Men 0 mm/hour-15 mm/hour
 women 0 mm/hour-20 mm/hour
 children 0 mm/hour-10 mm/hour
High values
Any disease that produces plasma protein changes will
increase the ESR. These include acute and chronic
infections, myocardial infarctions and rheumatoid arthritis.
The ESR is also increased in patients suffering from anaemia
Note: If a patient is dehydrated measurement of the ESR
has little value.

F. Detection of Haemin Crystals
Forensic Medicine, Medico-Legal Test

G. Blood Indices (RBC Indices)
• Definition: RBC indices are part of the complete
blood count (CBC) test.
• They are used to help diagnose too few red blood
cells (anemia).
• The indices include:
MCV
MCHC
MCH

1. MCV : is a measure of the average red blood cell
volume (i.e. size).
MCV = Hct (%) x 10 / RBC (in millions / cu.mm.)
normal range = 80 - 97 μ3 .
Increased MCV
Pernicious Anemia
(Addison-Biermer anemia)
(Macrocytic: 150 μ3)
Vit B12 + Folic acid
Decreased MCV
Microcytic Anemia
(60 to 70 μ3)
Iron Deficiency, blood loss

2. MCH : The mean corpuscular hemoglobin, or "mean
cell hemoglobin" (MCH), is a measure of the mass of
hemoglobin contained by a red blood cell.
MCH = Hb (g/dL) x 10 / RBC (in million / cu.mm.)
normal range = 27 - 31 (pg)
Increased MCH
Pernicious Anemia
Decreased MCH
Microcytic Anemia

3. MCHC : The mean corpuscular hemoglobin
concentration, or MCHC, is a measure of the
concentration of hemoglobin in a given volume of
packed red blood cell.
MCHC = Hb (g/dL) x 100 / Hct (%)
normal range = 32 - 36 %
Increased MCHC
Hyperchromic
Anemia
Decreased MCHC
Hypochromic
Anemia

Anemia
Anemia is a deficiency of RBCs and/or hemoglobin.
This results in a reduced ability of blood to transfer
oxygen to the tissues, causing tissue hypoxia.
1. Normocytic Normochromic Anemia
2. Macrocytic Hyperchromic Anemia
3. Microcytic Hypochromic Anemia
Types of Anemia

1. Sickle-cell anemia (is a group of genetic
disorders caused by sickle haemoglobin
2. Warm autoimmune hemolytic anemia.
3. Hereditary spherocytosis (defect in cell
membrane of RBCs).
4. Thalassemia (Mediterranean Anemia:
the genetic defect results in reduced
rate of synthesis of one of the globin
chains that make up hemoglobin; α or β
globin).
Other Types of Anemia

5. G6PD (glucose-6-phosphate dehydrogenase) deficiency Anemia
• G6PD deficiency is an inherited condition in which the body
doesn't have enough of the enzyme glucose-6-phosphate
dehydrogenase, or G6PD, which helps red blood cells (RBCs)
function normally.
• This deficiency can cause hemolytic anemia, usually after
exposure to certain medications, foods, or even infections.
• Heredity disease
Other Types of Anemia

White Blood Cells (WBCs)
• WBCs are part of the body's immune system and
clear the body of harmful material.
• They are produced and reside in the bone marrow
and the lymphatic system and are composed of many
different cell types.
• WBCs defend the body against organisms that cause
infections. They destroy invading bacteria and
viruses ( Free Radicals).
• WBCs are classified or named according to their
structure and function.

White Blood Cells (WBCs)
• The granulocytes have granules that contain enzymes that
are capable of killing microorganisms.
• The granulocytes are called neutrophils, basophils, or
eosinophils according to the types of granules they have.
• Other WBCs contain few or no granules. The Monocytes and
Lymphocytes.
Non- granular Leukocytes Granular Leukocytes

Granular Leukocytes:
1. Neutrophilis
• The major granulocyte is the neutrophils. It is the most
numerous and comprises about 55% of the total adult WBC
count. The neutrophils "eat" bacteria present in the body
and help fight infections.
• The nuclei of the polymorphs have two to five lobes which
may be located centrally or displaced towards the periphery.

2. Eosinophils
• Are larger than the polymorphs and contain either a single
irregular nucleus or two or three nuclei of unequal size. The
cytoplasmic granules have strong affinity with acid dyes like
eosin. They make 1 to 4 % of the total of the WBCs.
• Eosinophils primarily deal with parasitic infections and an
increase in them may indicate such. Eosinophils are also the
predominant inflammatory cells in allergic reactions.

3. Basiophilis
• Basophils are irregular in size and occur very rare in the
normal blood. They make less than 1 % of the total blood
cells. Their nucleus is irregular and single.
• Basophils are chiefly responsible for allergic and antigen
response by releasing the chemical histamine causing
inflammation.

A Granular Leukocytes:
1. Monocytes
• Monocytes are the largest non-granulocytes. Their nuclei are
kidney or horse shoe-shaped. Their cytoplasm is stained clear
blue or grey-blue. They form only 1 % of the total white
blood cells.
• Monocytes share the "vacuum cleaner" (phagocytosis)
function of neutrophils.

A Granular Leukocytes:
2. Lymphocytes
• Lymphocytes are little larger than the red blood cells. The
nucleus is relatively large and round with very small extra-
nuclear cytoplasm and stained blue with basic dyes. They
make about 20-40 % of the total WBCs.
• Lymphocytes are much more common in the lymphatic
system (B, T Cells).

A haemocytometer. The
two semi-reflective
rectangles are the counting
chambers.
The parts of the
hemocytometer (as viewed
from the side) are identified.
WBCs Experiments
1. Enumeration of WBCs by haemocytometer

1. WBCs Count (Haemocytometer)
1 mm
1/4 mm
WBCs & RBCs Counting chamber

1. Enumeration of WBCs by
haemocytometer
Number of WBCs in 1 mL= x /64 x 1/volume
of each small square x 1/dilution
= x /64 x 160 x 20
= x x 50
Where as x = the summation of the counted
number of WBCs in the four squares 4 x 16
= 64.
 Normal range: 4 - 11×103
white blood cells in mL .
 Leukemia the number of leukocytes is higher than
normal. Leucopenia this number is much lower.

2. Differential counts of WBCs using blood film
 The blood film is one of the world’s most widely and
frequently used tests.
 It is used to differentiate between the different types
of WBCs.
 A differential determines the percentage of each of
the five types (Neutrophils, Basophiles, Eosinophils,
Lymphocytes and Monocytes) of mature white blood
cells.

1 2
3 4

Blood film preparation
• Slides should be made from the highest purity, corrosion-
resistant glass; other material such as plastic is mostly not
acceptable.
• Slides are free from scratches; are clean; are free of dust, and
fat (from fingerprints); and are dry.
• Slides must be hydration resistant and, after their sealed
container is opened, should be kept in desiccators.
• They may be plain or have a frosted or coated area for writing.
1. Microscope slide

2. Type of blood sample
• The two types of blood
sample are venous
(anticoagulated) and
capillary, as obtained by
skin puncture (without
anticoagulation).

3. Anticoagulation:
• Acceptable anticoagulant agents are K2EDTA (di-
potassium ethylenediaminetetraacetic acid) or
K3EDTA (tri-potassium ethylenediaminetetraacetic
acid), sodium citrate, and acid citrate-dextrose (ACD).
• Heparin is not recommended because of frequently
developing platelet clumps that interfere with the
morphological interpretation of platelets and platelet
count estimates.
• Heparin also causes the development of a purple/blue
hue on stained films.

K2EDTA & K3EDTA Anticoagulant Agents
• Physical Properties:
•K2EDTA solution is spray-dried on the interior surface of the plastic tubes.
•K3EDTA is a liquid solution in the glass tubes.
•Clinical Properties:
•The International Council for Standardization in Haematology (ICSH) has
recommended K2EDTA as the anticoagulant of choice for blood cell counting
and sizing for the following reasons:
• K3EDTA results in greater RBC shrinkage with increasing EDTA
concentrations (11% shrinkage with 7.5 mg/ml blood).
•K3EDTA is a liquid additive, and therefore, will result in the dilution of the
specimen.

4. Sample storage effects
• Blood samples should be processed as quickly as possible after
collection.
• Significant morphological changes occur on prolonged storage
and are time and temperature dependent.
• Best results are obtained when films are prepared within 2
hours after collection.
• Storage temperatures are as follows: short-term (<8 hours):
preferably at 4°C, but storage at room temperature is
acceptable; long-term: 4°C.
• Always mix blood samples after prolonged storage by a
minimum of 10 complete (180°) inversions.

5. Capillary tubes
• Plastic tubes (unbreakable) are recommended for
placing blood drops onto the slide.
• Glass tubes should be avoided because of the
possibility of breaking, which can cause a biohazard.
• Tubes should be plain and should not contain heparin.

6. Blood volume
• The blood volume used should allow for an
appropriate thickness and 2.5 to 4 cm in length.
• Typically, 30 μL will result in a monolayer of
sufficient size.

7. Position of blood drop
• The position of the blood
drop should be
approximately 1 cm
from the end of the slide
(opposite labeling end).
• Alternatively, a distance
of 1 cm from the label
(or frosted part of the
slide) can be chosen.

8. Spreader
• The spreader should be slightly narrower than the glass slide
to minimize distribution effects. In practice, a second slide is
often used as the spreader.
• The edge of a spreader should always be smooth to ensure
even thickness for the entire width of the blood film.
• Spreaders should be discarded after use.
• The presence of blood cells from a previous specimen on the
spreader edge can cause significant carryover of blood cells,
including malaria parasites in red blood cells and leukemia
white blood cells, into the next blood film.

9. Blood pick-up by
spreader
• As soon as a blood drop has been placed on the slide, the
spreader should be moved slowly backwards at an angle of
approximately 30° to 45° toward the blood drop.
• The drop should spread quickly along the spreader’s edge.
• Once the blood is spread along the entire edge, the spreader
should be moved forward immediately at a steady rate, at a
fairly fast speed, and at a 45° angle until all blood has been
spread into a film.

10. Thickness of blood
film
• The thickness of the blood film is influenced by the
size of the blood drop, the patient’s hemoglobin level,
the angle of the spreader (the greater the angle, the
thicker and shorter the blood film), and the speed of
spreading.
• Compare between thick and thin blood film.

11. Drying of blood film
• Normally, air-drying without forced air circulation is
sufficient.
• In humid conditions, forced air-drying is
recommended, with proper precautions taken for
aerosol formation.
• When forced drying is applied, it is recommended to
do so in biohazard hoods equipped with high-
efficiency particulate air (HEPA) filters.

12. Fixation
• Optimal results are obtained by fixing and staining immediately
after the blood film is completely air-dried.
• Fixation of blood films before staining is recommended, although
many laboratories have a practice of staining immediately after
air-drying of blood films.
• If slides cannot be stained immediately, fixation in methanol is
necessary within 4 hours, but preferably 1 hour after air-drying;
otherwise, the plasma will cause gray/blue background effects.
• Staining and fixing solutions must be as free of water as possible
(<3%) to prevent morphological artifacts.
• If manual staining procedures are used, it is recommended that
slides be immersed in reagent-filled (Coplin) jars rather than
covering slides with staining solution because formation of
precipitate by evaporation may occur (Methanol as a biohazard).

13. Staining
• Blood films are typically stained by Giemsa, and Leishman
stains.
• Example (Leishman method) of commonly used method for
staining of air-dried blood films follow:
• (a) Cover the dry film with Leishman’s stain (Leishman’s
powder 0.15 gm, methyl alcohol 100 cc] for one minute.
• (b) Add an equal amount of buffer solution (disodium
hydrogen phosphate 25 gms, potassium dihydrogen
phosphate 32.5 gms and distilled water 100 cc, 2 cc of this
solution should be added to 100 cc of distilled water) or
distilled water with tap water and mix the two by gentle
blowing.

13. Staining
• (c) Leave it for ten minutes.
• (d) Wash with tap water and allow it to dry.
• (e) Examine the slide under high power or oil
immersion lens and identify the different types of
blood WBCs.

Platelets and Hemostatic Function
• Platelets, or thrombocytes,
are the cells circulating in
the blood that are involved
in the cellular mechanisms
of primary hemostasis
leading to the formation of
blood clots.
• The main function of the platelet is to rush to an area
of injury.
• The platelets will stick to an injured blood vessel wall
and form a plug that temporarily seals off the leak.

• Dysfunction or low levels of platelets leads to
bleeding.
• High levels of platelets may increase the risk of
thrombosis.
• An abnormality or disease of the platelets is called a
thrombocytopathy.
• Platelets originate from megakaryocytes which are
very large cells presents in the bone marrow. The
megakaryocytes break apart and each tiny fragment
forms a platelet.

• After platelets leave the bone marrow they are taken
up by the spleen for storage and released slowly
according to the needs of the body.
• Platelets live for about 8 to 11 days.
Clot
Formation
+ Serotonin
Platelets

Mechanism of blood clot Formation

Common Blood Coagulation Experiments
1. Enumeration of platelets by haemocytometer
Diluent in the
case of platelets
is ammonium
oxalate (1%)
A normal platelet count in a healthy person is
between 150,000 and 400,000 per mm³ of blood.

• A normal platelet count in a healthy person is
between 150,000 and 400,000 per mm³ of blood.
• Low number of platelets (thrombocytopenia), a
person may bleed uncontrollably from either a
large vessel or from capillaries.
• Bleeding into the tissue becomes visible in the form
of a bruise (contusion). Bleeding from capillaries
causes small red dots called petechiae.
• High levels of platelets may increase the risk of
thrombosis.

Sever bruise
Mild bruise
Petechiae

2. Coagulation time (clotting time)
• Coagulation time is the time required for blood to
coagulate or it is the time passes between the start
of bleeding and the formation of a clot.
• A normal coagulation time in a healthy person is
between 3 and 8 min.
• Prolonged in haemophilia and in the presence of
obstructive jaundice, some anaemias and
leukaemias, and some of the infectious diseases.

3. Bleeding time
• It is the time elapsed between the formation of a small
cut and the stoppage of bleeding from the cut blood
vessel.
• The normal range of bleeding time is between 1 and 3
min.
• Significance: this test does not depend on the
coagulation mechanism of blood but on the efficiency
of vasoconstriction of injured vessels. Therefore,
bleeding time is normal in haemophilia and is
prolonged in purpura.

LABORATORY ASSESSMENT OF HEPATIC
DISORDERS
A great deal of insight into the nature and extent of hepatic
injury can often be gained through tests on blood samples.
There are two fundamental types of blood tests that can be
performed.

1- Assessment is based on measuring the functional
capabilities of the liver. This can involve an
evaluation of the liver’s ability to carry out one or
more of its basic physiological functions (e.g., glucose
metabolism, synthesis of certain proteins, excretion of
bilirubin)

The second type of assessment involves a
determination of whether there are abnormally
high levels in the blood of intracellular hepatic
proteins.
The presence of elevated levels of these proteins
in blood is an evidence of liver cell destruction.

Serum Albumin.
Albumin is synthesized in the liver and secreted into
blood. Liver damage can impair the ability of the
liver to synthesize albumin and serum albumin
levels may consequently decrease.
The turnover time for albumin is slow, and as a
result it takes a long time for impaired albumin
synthesis to become evident as changes in serum
albumin. For this reason, serum albumin
measurements are not helpful in assessing acute
hepatotoxicity.
They may assist in the diagnosis of chronic liver
injury, but certain other diseases can alter serum
albumin levels, and the test is therefore not very

Prothrombin Time.:
The liver is responsible for synthesis of most of the
clotting factors, and a decrease in their synthesis
due to liver injury results in prolonged clotting time.
In terms of clinical tests, this appears as an increase
in prothrombin time. Several drugs and certain
diseases also increase prothrombin time.

Serum Bilirubin.
The liver conjugates bilirubin, a normal breakdown
product of the heme from red blood cells, and
secretes the glucuronide conjugate into the bile.
Impairment of normal conjugation and excretion of
bilirubin results in its accumulation in the blood,
leading to jaundice.
Serum bilirubin concentrations may be elevated
from acute hepatocellular injury, cholestatic
injury, or biliary obstruction.

Measurement of Hepatic Enzymes in Serum.
Cells undergoing acute degeneration and injury will
often release intracellular proteins into blood.
The detection of these substances in blood above
normal, base line levels signals cytotoxicity.
This is true for any cell type, and in order for the
presence of intracellular proteins in blood to be
diagnostic for any particular type of cell injury (e.g.,
liver toxicity versus renal toxicity versus cardio
toxicity), the proteins must be associated rather
specifically with a target organ or tissue.

Aminotransferase activities [alanine amino transferase
(ALT) and aspartate amino transferase (AST)], alkaline
phosphatase activity, and gamma glutamyl transferase
transpeptidase (GGTP) are included in nearly all standard
clinical test suites to assess potential hepatotoxicity.

• In alcoholic liver disease, AST activity is usually
greater than ALT activity,
severe hepatic injury can result in dramatic increases in
serum ALT and ALT activities (up to 500 times normal
values), but only modest increases in alkaline phosphatase
activity
Pronounced increases in alkaline phosphatase is
characteristic of cholestatic injury, where increases
in ALT and AST may be limited or nonexistent.

•Serum GGTP is an extremely sensitive indicator of
hepatobiliary effects, and may be elevated simply by
drinking alcoholic beverages. It is not a particularly
specific indicator (it is increased by both hepatocellular
and cholestatic injury) and is best utilized in combination
with other tests.

LABORATORY ASSESSMENT OF CARDIOVASCULAR DISORDERS
ACUTE MYOCARDIAL INFARCTION (AMI)
The heart muscle, or
myocardium, receives its blood
flow from three coronary
arteries. If blood flow from the
coronary arteries to the heart
muscle is restricted, not enough
oxygen reaches the heart.
This is termed ischemia. It can cause chest pain or angina. If
blood flow to a portion of the heart muscle is stopped
entirely, it can cause cell death, necrosis, and heart attack, or
acute myocardial infarction (AMI).

Coronary Artery Disease
Coronary Artery Disease

􀁺What is a Biomarker
A measurable substance or parameter that is an indicator
of an underlying biological or pathophysiological process
Biomarkers in the Cardiac
Patient
In the cellular damage process, troponin leaks from the heart
tissue and is released into the bloodstream. Damage to heart
muscle fibers releases CK-MB into the bloodstream as well.
Other constituents released by damaged heart cells include
lactate dehydrogenase isoenzyme 1 (LD1), aspartate
transaminase (AST), and electrolytes.

Measurement of troponin assays has been a tremendous
boon to clinical diagnosis.
Troponins released from heart muscle remain in the blood
stream from 1 to 14 days after onset of AMI, making them
the preferred marker for detection of an AMI.
Troponins, as cardiac markers, appear to have many
advantages primarily due to their quick release following
heart muscle damage and their longevity in the blood
stream following the heart attack
troponin

is composed of two polypeptide chains, B and M, making up three
forms:
CK-MM, CK-MB, and CK-BB. Distribution of the three isomer
forms of CK varies throughout tissue.
For example, CK-MM (or CK 3) is found mostly in skeletal muscle
tissue, while CK-MB (CK 2) is found mostly in cardiac muscle tissue.
CK-BB (CK 1) is associated with brain and nerve tissue.
Creatine kinase (CK/CPK) is an enzyme expressed in a number of tissues.
Function: it catalyses the conversion of creatine to phosphocreatine degrading ATP
to ADP
(In cardiac as well as other tissues, phosphocreatine serves as an energy reservoir for
the rapid regeneration of ATP)
Creatinine kinase

The window of detection is quite short, lasting no more than
12 to 18 hours after the heart attack occurred, because of
protein degradation mechanisms that eliminate the CK-MB
from the blood
This marker is released into circulation from necrotic heart
muscle. As the heart muscle becomes damaged, this CK
isoenzyme is released into the blood stream and may be
detected for 6 to 18 hours after onset of AMI.

Other used AMI biomarkers are LD and its isoenzymes 1 and 2.
are released into body fluids when those cells become
diseased
An increase in LD isoenzyme activity can indicate leakage
from cells due to cellular injury.
The level of isoenzyme LD1 compared with LD2 has been
used to detect an AMI because of the high concentration of
LD1 in cardiac muscle fibers.
LD isoenzymes begin to leak out of dying heart muscle cells
and are detectable in the serum by 36 hours following a heart
attack.

Normal LD isoenzyme patterns show that LD2 is greater than
LD1.
This enzyme, however, will remain in the blood stream for 4 to 7
days after an AMI, enabling clinicians to detect post-AMI
conditions in patients who have had mild heart attacks

LIPIDS AND LIPOPROTEINS
Lipids are carried in the blood stream by complexes known as
lipoproteins. This is because these lipids are not soluble in the
plasma water. Thus they travel in micelle-like complexes composed
of phospholipids and protein on the outside with cholesterol,
cholesterol esters, and triglycerides on the inside.
cholesterol is the major lipid associated with low density
lipoprotein (LDL) and high-density lipoprotein (HDL), to form
low density lipoprotein cholesterol (LDL-C) and high-density
lipoprotein cholesterol (HDL-C)

The cholesterol form most associated with
cardiovascular problems when in excess is LDL
cholesterol (LDL-C).
While LDL-C is considered harmful when in excess,
the elevation of HDL-C is viewed as a positive
cardiovascular biomarker for a patient. Elevated
HDL-C has a beneficial effect for the vascular
system, due to the role that HDL plays in the body.
HDL removes excess cholesterol from tissues and
routes it to the liver for reprocessing and/or removal.

TEST ONSET PEAK DURATION
CK/CK-MB 3-12 hours 18-24 hours 36-48 hours
Troponins 3-12 hours 18-24 hours Up to 10 days
Myoglobin 1-4 hours 6-7 hours 24 hours
LDH 6-12 hours 24-48 hours 6-8 days
Timing Summary

LABORATORY ASSESSMENT OF RENAL DISORDERS
The kidney plays an essential role in maintaining a number of
vital body functions. Therefore, if a disruption of normal
kidney function is caused by the action of a toxic agent, a
number of serious disease can occur besides a disruption in
blood waste elimination.

Measurement of certain natural endogenous substances in
the blood
can be used to asses glomerular function as well. The
measurement of blood urea nitrogen (BUN) and plasma
creatinin are two endogenous compounds routinely
measured for the clinical assessment of glomerular function.
As glomerular filtration decreases, BUN and plasma
creatinine become more elevated.

Normal BUN ranges from 5 to 25 mg/100 mL, while serum
creatinine ranges from 0.5 to 0.95 mg/mL of serum.
Nephro toxicants may also disrupt the selective
permeability of the glomerular apparatus. Normally the
result is an increase in porosity in the glomerulus; protein
enters the glomerular filtrate and subsequently the urine.

Structure and Function of the
Kidneys
Each kidney contains many tiny
tubules that empty into a cavity
drained by the ureter. Each of the
tubules receives a blood filtrate
from a capillary bed called the
glomerulus
. The tubules and associated
blood vessels thus form the
functioning units of the kidneys,
known as nephrons.

Excretory Systems
• Dispose of metabolic wastes
• Regulate solute concentrations in the body
• Transport epithelia arranged in tubes
• 4 major processes
1. Filtration, pressure-filtering of body fluids producing
a filtrate (water, salts, sugars, amino acids, N-wastes)
2. Reabsorption, reclaiming valuable solutes (glucose,
salts, amino acids) from the filtrate
3. Secretion, addition of larger molecules like toxins and
other excess solutes from the body fluids to the filtrate
4. Excretion, the filtrate leaves the system

Urine analysis is performed to detect abnormal constituents that
indicate a pathological state.
Urine Examination
Physiological and normal constituents of urine:
Normally the urine is composed of 99% water and 1% solids.
Solids are:
A- organic substances: urea, uric acid, creatine, creatinine, amino
acids, lactic acid , vitamins, pigments, enzymes……
B- inorganic substances: NH4, SO4, Ca+2, Cl-, PO4, Co3, Na+,
K+, Mg+2, NO3, Fe, F, silicate…………….

General characteristics of urine:
1. Volume: normally 1.5 – 2 L / Day.
2. Color: urochrome (amber yellow).
3. Transparency: Clear transparent.
4. Odor: faint aromatic odor due to the presence of volatile
organic acid.
5. PH : slightly acidic 5.5 – 6.5.

SOME PATHOLOGICAL CONSTITUENTS OF
URINE
The following parameters are normally not present in
urine:
Glucose: if serum glucose level exceeds the renal glucose
threshold (180 mg/dl), it appears in urine (GLUCOSUREA), as
in diabetes mellitus.
Protein: the presence of protein in urine (PROTEINUREA OR
ALBUMINUREA) can be seen in patients with glomerulonephritis
Blood: blood in urine (HEMATUREA OR HEMOGLOBINUREA)
could be seen in patients with bilharziasis or hemolytic
anemia.

Bile salts: can be seen in patients with Jaundice.
Ketone bodies or Acetone: could appear in urine in late stages
of diabetes mellitus.

Loss of Concentrating & Diluting Ability
In renal disease,
A- The urine becomes less concentrated and urine volume is
often increased, producing the symptoms of polyuria and
nocturia (waking up at night to void).
B- When the number of functioning nephrons is reduced by
disease. The increased filtration in the remaining nephrons
eventually damages them, and thus more nephrons are lost.
loss of so many nephrons that complete renal failure with
oliguria or even anuria results.

Collection of urine specimens
Containers for the collection of urine should be wide-mouthed,
clean and dry. If urine specimen has to be transported for any
length of time it should contain an appropriate preservative to
prevent bacterial overgrowth or hatching of viable ova.
Preservation of urine specimens
_ Urine passed at a clinic and examined immediately does not
require preservation.
_ If urine has been collected to check for the presence of
Schistosoma haematobium ova but it may not be examined
for several hours, it should be acidified with a few drops of
10% acetic acid .

Physical Examination
Color
URINE The normal color of urine is pale yellow.
If it is dark yellow to orange, it indicates some liver
disorder.
If it is white, it shows the presence of pus.
If it is pink to red, it indicates the presence of red blood
cells.
If it is brownish black, it indicates the presence of melanin
If it is blue to green, it is a liver disorder.
Sometimes, due to the intake of some food or medicines
also, one could notice a change in the color or their urine.
The intake of vitamin B capsules gives a dark yellow color
to it, if rimfamycin is taken, it gives an orange tinge to the
urine

Testing for the presence of blood
Elevated erythrocyte counts and haemoglobin levels may
occur in urine:
— after heavy physical exercise;
— in vaginal tract infections;
— in parasitic infections (e.g. schistosomiasis);
— in acute glomerulonephritis;
— in urethritis;
— in patients suffering from certain tumours.
Blood cells are easily seen by microscopic examination after
centrifugation

Reagent strips (dipsticks)
are available with single or
multiple test sections for the
following determinations.
pH - Specific gravity - Sugar
- Haemoglobin (blood)-
Protein- Urobilinogen-
Bilirubin- Ketones
Reagent strips have
enormously simplified
urinalysis but they require
some care. Protection from
moisture, light, chemical
fumes and proper storage is
essential to achieve correct
results.

Measuring the pH
==pH and crystalline deposits
Determination of the pH of urine is useful for the
identification of crystalline
Deposits. Some crystals are deposited only in acid urine,
others only in alkaline urine
For example:
— acid urine: oxalates, uric acid
— alkaline urine: phosphates, carbonates, ammonium
urates.
Detection and estimation of protein
Elevated protein levels are observed in the urine of patients with:
— urinary schistosomiasis
---chronic renal disease

Detection of ketone bodies
Normal urine does not contain ketone bodies. Acetone and other
ketone bodies may appear in urine
— in severe or untreated diabetes;
— in certain other conditions (dehydration, vomiting, malnutrition,
prolonged starvation and following strenuous exercise).
Appearance of ketone bodies in urine called Ketonuria

Detection of abnormal elements
Principle
Urine contains cells and crystals in suspension that can be
collected by centrifugation or by allowing the urine to stand and
the suspended particles to form a sediment. The resulting
urinary deposit can be examined under the microscope.

Microscopic examination
Using the X 10 objective and with the condenser lowered,
scan the cover slip all over to look for ova of Schistosoma
haematobium when indicated.
Using the X 40 objective and with the condenser lowered or
aperture reduced, scan the cover slip area again and report
any findings as a quantitative value for each high-power field.
The following may be found in urine:
— erythrocytes— leukocytes— epithelial cells— casts—
fungi— crystals
parasite eggs and larvae— Trichomonas vaginalis -
spermatozoa.

Erythrocytes (Fig. 7.9)
Erythrocytes in urine may be:
(a) intact: small yellowish discs,
darker at the edges (8mm);
(b) crenated: spiky edges, reduced
diameter (5–6mm);
(c) swollen: thin circles, increased
diameter (9–10mm).
The shape of the cells often
changes during storage of urine
and does not have any diagnostic
importance.
There are normally very few
erythrocytes in urine.
Note: Erythrocytes may be found in the urine of women if the specimen has
been taken during the menstrual period

Leukocytes
Leukocytes found in urine may be:
(a) intact: clear granular discs, 10–15mm (the nuclei may be
visible);
(b) degenerated: distorted shape, shrunken, less granular;
(c) pus: clumps of numerous degenerated cells.
The presence of many leukocytes, especially in clumps, indicates
a urinary tract infection.

How to express the quantity of erythrocytes and
leukocytes found in urine deposits
Place one drop of urine deposit on a slide and cover with a
coverslip. Using the X 40 objective, examine the deposit
and count the number of erythrocytes and leukocytes per
microscope field.
Report the results as described in Tables

Ureteral and renal pelvic
cells
Medium-sized oval cells
with a distinct nucleus.
If many cells are present
together with leukocytes
and filaments, they may be
from the ureter.
If a few are present, with
no leukocytes, they may be
cells from the renal
pelvis.

Casts
Casts are cylindrical in shape and long, crossing almost the
whole field when examined under the X 40 objective.
Hyaline casts are transparent and slightly shiny; the ends are
rounded or tapered . They may be found in healthy persons
after strenuous muscular effort and have no diagnostic
significance. Number may be increased in dehydration and
proteinuria.

Granular casts are rather short casts filled with large granules,
pale yellow in colour, with rounded ends
The granules come from degenerated epithelial cells from the
tubules of the kidney and have no diagnostic significance.
Granular casts are seen in a wide variety of renal diseases

Blood casts are filled with more or less
degenerated erythrocytes, brownish in
colour They are found in acute kidney
disease. Red cell casts are strongly
suggestive of acute glomerulonephritis
Pus casts are completely filled with
leukocytes (a). Do not confuse with
hyaline casts, which may contain a few
leukocytes (b). Pus casts are found in
patients suffering from kidney infection.

Crystals (Fig. 7.22)
Crystals have regular
geometric shapes (a), unlike
amorphous debris, which is
made up of clumps of small
granules with no definite
shape (b).

Normal
Calcium oxalate (acid urine) (Fig. 7.23)
Size: 10–20mm (a) or about 50mm (b). Shape: envelope-
shaped (a) or peanut-shaped (b). Colour: colourless, very
shiny. A large number of calcium oxalate crystals are seen
in hypercalciuria
Uric acid (acid urine) (Fig. 7.24)
Size: 30–150mm. Shape: varies (square, diamond-
shaped, cubical or rose-shaped).
Colour: yellow or brownish-red
crystalline deposits

Triple phosphates (neutral or alkaline urine) (Fig.
7.25)
Size: 30–150mm. Shape: rectangular (a) or like a fern
leaf or star (b). Colour: colourless, shiny
Urates (alkaline urine) (Fig. 7.26)
Size: about 20mm. Shape: like a cactus (a) or a
bundle of needles (b). Colour: yellow, shiny. Urates
are often found together with phosphates.
Calcium phosphate (neutral or alkaline urine) (Fig.
7.27) Size: 30–40mm. Shape: like a star. Colour:
colourless.

Calcium carbonate (neutral or alkaline urine) (Fig. 7.28)
Size: very small. Shape: similar to millet or corn grains,
grouped in pairs. Colour: colourless. If acetic acid, 10%
solution is added, the crystals dissolve, giving off
bubbles of gas
Calcium sulfate (acid urine) (Fig. 7.29)
Size: 50–100mm. Shape: long prisms or flat
blades, separate or in bundles.
Calcium sulfate crystals can be
distinguished from calcium phosphate
crystals by measuring the pH of the urine.

Amorphous phosphates
(alkaline urine) (Fig. 7.30)
Amorphous phosphates appear
as small, whitish granules,
often scattered. They are
soluble in acetic acid, 10%
solution (one drop per drop of
deposit).
Amorphous urates (acid urine) (Fig.
7.31)
Amorphous urates appear as very
small, yellowish granules, which
are grouped in compact clusters.
They are not soluble in acetic acid,
10% solution dissolve if the urine is
gently heated.
Amorphous debris

Presence of a single crystal of cystine is diagnostic of
cystinuria as cystine is not a constituent of normal urine
Cystine (acid urine) (Fig. 7.32) Size: 30–60mm. Shape:
hexagonal plates.
Colour: colourless, very shiny. Cystine crystals are found
only in fresh urine as they are soluble in ammonia. They
are found in patients with cystinuria, a very rare hereditary
disease

SECTION 3
MOLECULAR &
BIOCHEMICALANALYSIS
(MBA)

Molecular Biology Techniques
A. Proteomic Analysis:
• Proteomics is the large-scale study of proteins,
particularly their structures and functions.
• Proteins are vital parts of living organisms, as they
are the main components of the physiological
pathways of cells.
• The word "proteome" is a portmanteau of
"protein" and "genome".

Proteomics uses various technologies such
as:
1. One- and two-dimensional gel electrophoresis
2. Nuclear Magnetic Resonance (NMR)
3. Mass Spectrometry (MS)
4. Amino Acids Sequencing (AAS)
5. de novo structure of protein
6. Protein-protein docking
7. ELISA
8. Protein Microarray
A. Proteomic Analysis:

1. Gel Electrophoresis
• Principle: The movement of charged particles
suspended in a liquid through various media, e.g.
paper, cellulose acetate, gel, and liquid, under the
influence of an applied electric field.
• The various charged particles of a particular
substance migrate in a definite and characteristic
direction—toward either the anode or the cathode
—and at a characteristic speed.

Proteins can be separated largely on the basis of mass by
electrophoresis in a polyacrylamide gel under denaturing
conditions.
The mixture of proteins is first dissolved in a solution of sodium
dodecyl sulfate (SDS), an anionic detergent that disrupts nearly all
noncovalent interactions in native proteins. Mercaptoethanol (2-
thioethanol) or dithiothreitol also is added to reduce disulfide
bonds.
This complex of SDS with a denatured protein has a large net
negative charge that is roughly proportional to the mass of the
protein.
The SDS-protein complexes are then subjected to
electrophoresis. When the electrophoresis is complete, the
proteins in the gel can be visualized by staining them with silver or
a dye such as Coomassie blue, which reveals a series of bands.

Small proteins move rapidly through the gel, whereas large
proteins stay at the top, near the point of application of the
mixture.
Radioactive labels can be detected by placing a sheet of x-ray
film over the gel, a procedure called autoradiography

• SDS–Polyacrylamide Gel Electrophoresis (SDS–PAGE):
• a procedure that revolutionized the analysis of complex
mixtures of proteins.
• The proteins are solubilized by the powerful, negatively
charged detergent sodium dodecyl sulfate (SDS) which
causes proteins to unfold into extended, single polypeptide
chains.
• A reducing agent such as mercaptoethanol is usually added
to break disulfide bonds. The constituent polypeptides are
then electrophoresed through an inert matrix of highly cross-
linked gel of polyacrylamide. The pore size of the gel can be
varied by altering the concentration of polyacrylamide.

Vertical gel
electrophoresis apparatus
Protein analysis using SDS-PAGE
One-dimensional

Applications
Electrophoresis was first used in the clinical laboratory for the
separation of serum proteins. Since then, applications have
been developed to separate serum proteins, isoenzymes (e.g.
creatine kinase, alkaline phosphatase, etc.), haemoglobin
variants and DNA fragments following the polymerase chain
reaction (PCR).
Example 1:-. Electrophoretic separation of serum
creatine kinase enzymes from a normal healthy adult
and from a patient who had a myocardial infarction
24 hours previously. Creatine kinase catalyzes the
reversible transfer of a phosphate from ATP to
creatine to form phosphocreatine and ADP
The reaction is an important part of energy
metabolism in heart muscle, skeletal muscle, and
brain. Three different forms of the dimer exist: BB (or
CK-1) found in brain, MB (or CK-2) found only in
heart, and MM (or CK-3), found only in skeletal and
heart muscle (cathode, -ve; anode, + ve).

Example 2: Serum protein electrophoresis
The principal use of electrophoretic separation of serum
proteins is the identification of monoclonal gammopathies,
The early methods for serum protein electrophoresis used
cellulose acetate as a support medium, but this produced
limited resolution of serum proteins and has largely been
superseded by agarose gel electrophoresis. Serum proteins
are separatedinto the main bands corresponding to albumin,
α_1- globulins, α_2-globulins, Beta-globulins (β1 and β 2)
and gamma globulins.

Visualization following staining with Coomassie
brilliant blue stains is usually adequate to detect
abnormalities,
but densitometric scanning can be used if
quantitative data on the individual fractions is
required, i.e. if a paraprotein is present. Automated
systems for serum protein electrophoresis are now
available.

Isoelectric Focusing:
Proteins can also be separated electrophoretically on the
basis of their relative contents of acidic and basic residues.
The isoelectric point (pl) of a protein is the pH at which its net
charge is zero. At this pH, its electrophoretic mobility is zero.
For example, the pI of cytochrome c, a highly basic electron-
transport protein, is 10.6, whereas that of serum albumin, an
acidic protein in blood, is 4.8.
Suppose that a mixture of proteins undergoes
electrophoresis in a pH gradient in a gel in the absence of
SDS. Each protein will move until it reaches a position in the
gel at which the pH is equal to the pI of the protein.
This method of separating proteins according to their
isoelectric point is called isoelectric focusing

Two-Dimensional Electrophoresis.
Isoelectric focusing can be combined with SDS-PAGE to
obtain very high resolution separations.
A single sample is first subjected to isoelectric focusing.
This single-lane gel is then placed horizontally on top of an
SDS-polyacrylamide slab.
The proteins are thus spread across the top of the
polyacrylamide gel according to how far they migrated
during isoelectric focusing. They then undergo
electrophoresis again in a vertical direction to yield a two
dimensional pattern of spots.
In such a gel, proteins have been separated in the
horizontal direction on the basis of isoelectric point and in
the vertical direction on the basis of mass.

Proteins isolated from cells under different physiological
conditions can be subjected to two-dimensional
electrophoresis, followed by an examination of the intensity
of the signals with mass spectrometric technique.
In this way, particular proteins can be seen to increase or
decrease in concentration in response to the physiological
state.

Two-Dimensional Gel Electrophoresis.
A protein sample is initially fractionated
in one dimension by isoelectric focusing
The isoelectric focusing gel is then
attached to an SDS-polyacrylamide
gel, and electrophoresis is performed in
the second dimension,
Proteins with the same pI are now
separated on the basis of mass.
The proteins were first separated
according to their isoelectric pH in the
horizontal direction and then by their
apparent mass in the vertical direction.

The Mass of a Protein Can Be Precisely Determined by Mass
Spectrometry
Mass spectrometry has been an established analytical technique
in organic chemistry for many years. Until recently, however, the
very low volatility of proteins made mass spectrometry useless for
the investigation of these molecules.
This difficulty has been circumvented by the introduction of
techniques for effectively dispersing proteins and other
macromolecules into the gas phase. These methods are called
matrix-assisted laser desorption-ionization (MALDI) and
electrospray spectrometry.

In this technique, protein ions are generated and then
accelerated through an electrical field (Figure 4.16). They
travel through the flight tube, with the smallest traveling
fastest and arriving at the detector first. Thus, the time of
flight (TOF) in the electrical field is a measure of the mass
(or, more precisely, the mass/charge ratio). Tiny amounts of
biomolecules, as small as a few picomoles (pmol) to
femtomoles (fmol), can be analyzed in this manner

Matrix-assisted laser desorption/ionization-Time of Flight
MALDI-TOF/MS
Q2 Q1
Q0
N2 or Ar
~10-5 Torr
~10-2 Torr
Ion
Mirror
~10-2 Torr lens
Target with
sample
4-anode detector Collision cell
UV beam
TOF chamber
1..4 x 10-7 Torr

2. Protein sequencing
• Proteins are found in every cell and are essential to every
biological process .
• Protein structure is very complex.
Discovering the structures and functions of proteins
1.Understanding cellular processes
2.Discovering novel drugs targeting specific metabolic pathways

Structural components of a protein
N-terminus C-terminus
Peptide bond
side chain

Methods of Protein Sequencing
• Edman degradation reaction
• From the DNA or mRNA sequence encoding
the protein

From the DNA or mRNA sequence encoding the protein

Edman Degradation Method
1. Determining amino acid composition
• Unordered amino acid composition of a protein .
• Facilitate the discovery of errors in the sequencing process.
• Choose which protease to use for digestion of the protein
2. N-terminal amino acid analysis
• To aid the ordering of individual peptide fragments'
sequences into a whole chain,
• The first round of Edman degradation is often contaminated
by impurities and therefore does not give an accurate
determination of the N-terminal amino acid.

3. C-terminal amino acid analysis
• The most common method is to add carboxypeptidases to a
solution of the protein.
4. Edman degradation
• Automated Edman sequencers are now in widespread use,
and are able to sequence peptides up to approximately 50
amino acids long.
Edman Degradation Method

1. Break any disulfide bridges in the protein by oxidizing with
Performic acid.
2. Separate and purify the individual chains of the protein
complex.
3. Determine the amino acid composition of each chain.
4. Determine the terminal amino acids of each chain.
5. Break each chain into fragments under 50 amino acids long.
6. Separate and purify the fragments.
7. Determine the sequence of each fragment.
8. Repeat with a different pattern of cleavage.
9. Construct the sequence of the overall protein.
Procedure of Edman degradation

3. de novo protein structure prediction
 In computational biology, de novo protein structure
prediction is the task of estimating a protein's tertiary
structure (3D) from its sequence alone.

4. Protein Microarray
• A protein microarray is a piece of glass on which different
molecules of protein have been affixed at separate locations
in an ordered manner thus forming a microscopic array.
• These are used to identify protein-protein interactions, to
identify the substrates of protein kinases, or to identify the
targets of biologically active small molecules.
• The most common protein microarray is the antibody
microarray, where antibodies are spotted onto the protein
chip and are used as capture molecules to detect proteins
from cell lysate solutions.

Enzyme-Linked Immuno-Sorbent Assay
(ELISA)
• ELISA is an extremely sensitive biochemical
technique used to detect antibodies or specific
antigens.
• ELISA has been used as a diagnostic tool in
medicine and plant pathology, as well as a
quality control check in various industries.

Enzyme-Linked Immuno-Sorbent Assay
(ELISA)

Direct ELISA: The direct ELISA is a test for the
presence of an antigen in a sample
1 2
6
5
8
7
4
3

Indirect ELISA: The indirect ELISA is a test for the
presence of an antibody in a sample
1 2 3
5
6 4
7 8

B. Genomic Analysis
• Genomics is the study of an organism's entire
genome.
• A major branch of genomics is still concerned with
sequencing the genomes of various organisms.
• The most important tools of genomic analysis are:
1. DNA electrophoresis
2. PCR
3. DNA sequencing
4. Microarrays
5. Bioinformatics

• DNA electrophoresis is an analytical technique used to separate
DNA fragments by size.
• DNA molecules normally migrate from negative to positive
potential due to the net negative charge of the phosphate
backbone of the DNA chain.
• After the separation is completed, the fractions of DNA
fragments of different length are often visualized using a
fluorescent dye specific for DNA, such as ethidium bromide
(Compare Protein Staining).
• Fragment size is usually reported in "nucleotides", "base
pairs" or "kb" (for 1000's of base pairs) depending upon
whether single- or double-stranded DNA has been separated.

• The types of gel most commonly used for DNA electrophoresis
are agarose (for relatively long DNA molecules) and
polyacrylamide (for high resolution of short DNA molecules).
Submarine/Horizontal
Gel Electrophoresis
System
Gel Electrophoresis
Combs

DNA Examination using
ethidium bromide & UV
Light
Results of DNA Analysis

2. Polymerase Chain Reaction (PCR)
• The polymerase chain reaction (PCR) is a biochemistry and
molecular biology technique for amplifying a fragment of
DNA, via enzymatic replication, without using a living
organism (such as E. coli or yeast).
• PCR (an in vitro technique) can be used for amplification of a
single or few copies of a piece of DNA across several orders of
magnitude, generating millions or more copies of the DNA
piece.
• Developed in 1983 by Kary Mullis who awarded the Nobel
Prize in Chemistry in 1993 for his development of the
Polymerase Chain Reaction.

2. Polymerase Chain Reaction (PCR)
• PCR is now a common technique used in medical and
biological research labs for a variety of tasks, such as:
1. The sequencing of genes.
2. The diagnosis of hereditary diseases.
3. The identification of genetic fingerprints (used in
forensics and paternity testing).
4. The detection and diagnosis of infectious diseases.
5. The creation of transgenic organisms.
6. The method is especially useful for searching out
disease organisms that are difficult or impossible to
culture, such as many kinds of bacteria, fungi, and
viruses (HIV, Hepatitis).

PCR Requirements
• PCR, requires several
basic components. These
components are:
1. DNA template
2. Primers.
3. DNA Polymerase.
4. dNTPs.
5. Buffer solution.
6. Thermal cycler.

PCR Cycles
1- Denaturation Step
2- Annealing Step
3- Extension Step

Verification of PCR product on agarose or
polyacrylamide gel

3. Primers
• A primer is a short segment of nucleotides which is
complementary to a section of the DNA which is to be
amplified in the PCR reaction.
• Primers can either be specific to a particular DNA nucleotide
sequence or they can be "universal."
• Universal primers are complementary to nucleotide
sequences which are very common in a particular set of DNA
molecules. Thus, they are able to bind to a wide variety of
DNA templates.
• Examples of bacteria universal primer sequences are:
Forward 5' GATCCTGGC TCAGGATGAAC 3'; Reverse 5’
GGACTACCAGGGTATCTAATC 3'.

3. Primers
• Degenerate Primers which have a number of options at
several positions in the sequence so as to allow annealing to
and amplification of a variety of related sequences.
• e.g.:
5’-TCG AAT TCI CCY AAY TGR CCN T-3’
Y = pYrimidines = C / T (degeneracy = 2X)
R = puRines = A / G (degeneracy = 2X)
I = Inosine = C / G / A / T
N = Nucleotide = C / G / A / T (degeneracy = 4X)

Why... use degenerate primers?
1.To amplify conserved sequences of a gene or
genes from the genome of an organism.
2.To get the nucleotide sequence after
sequencing some amino acids from a protein
of interest.
3. Primers

Basic and Advanced Practical Biochemistry.ppt

More Related Content

Similar to Basic and Advanced Practical Biochemistry.ppt (20)

Recently uploaded (20)

Basic and Advanced Practical Biochemistry.ppt