DNA_and_inheritance.ppt
- 2. Things to find out: • What is DNA? • The Genetic Code • The Human Genome
- 3. Diversity of Life • All biological systems are composed of the same types of molecules • Similar organization principles are used at the cellular level
- 4. The Cell • Basic component of life • Two main categories, prokarytic and eukaryotic cells • Differences in the nucleus
- 5. • Prokaryotes: no defined nucleus and a simplified internal structure • Eukaryotes: membrane limited nucleus and complicated internal structure • Three branches of life
- 6. • Genetic material is located in nucleus • The genetic information is stored in Deoxyribonucleic acid, DNA • DNA contains the information needed to build an individual
- 7. What is DNA needed for? • Genetic information is transferred from DNA and converted to protein •RNA molecules work as messengers •Proteins are the biological workers
- 8. •Information of the DNA is copied to a RNA molecule in transcription •RNA directs the protein synthesis in a translation •Protein’s 3D structure determines it’s function •Information transfer only in one direction
- 9. DNA (Deoxyribo Nucleic Acid) •a polymer of nucleotide monomers •2’-deoxyribose sugar •Four bases: •Adenine, A •Guanine, G •Thymine, T •Cytosine, C Sugar part Base part
- 10. Four bases... Purine bases • Adenine and guanine • Two carbon rings Pyrimidine bases • Thymine and cytosine • A single carbon ring
- 11. DNA chains • Nucleotides are joined with phosphodiesteri bond • Sequence of bases vary genetic information • Extremely long chains!
- 12. DNA Molecules • Two polynucleotide chains are joined • Double helix, twisted in right handed way • Full circle in every 10 bases
- 13. •”ladder-structure” –Bases = steps –Sugars and phosphates = supporting pilars •Two nucleotide chains run in opposite directions chemical direction (5´-3´)
- 14. Complementary Pairing • Bases pair with other bases • Space between the chains is limited Purines with two carbon rings pair only with single ring pyrimidines A + T G + C • Complementary pairing is vital for the use and storage of the genetic information! •Interaction is stabilized by hydrogen bonds
- 15. The Genetic Code • Describes how nucleotide sequence is converted to protein sequence • Unit of three nucleotides = a codon • A codon codes for a specific amino acid (structural component of protein)
- 16. • The four bases can form 64 different codons • 20 amino acids are found from the nature • Regulatory codons
- 17. Frame 1 Met F P P S G S T G L I P P S H F Q A R P L S T L P R Met A P T W L S D I P L V Q Frame 2 C F H L Q V P L G Stop F P P P T F K L G P F Q L C Q E W L P P G S Q T F P W S N Frame 1 G L D Q G N V Stop E P G G S H S W Q S Stop K G P S L K V G G G N Q P S G T Stop R W K H •Right reading frame is obligatory! •Part of the sequence from psoriasis associated gene HCR • Three different reading frames can be used, but only one is the right one •Translate tools are found from the internet atgtttccac cttcaggttc cactgggctg attcccccct cccactttca agctcggccc ctttcaactc tgccaagaat ggctcccacc tggctctcag acattcccct ggtccaaccc The right one
- 18. DNA chromatin chromatin fibers fibers connected to chromosome scaffold Condenced scaffold Chromosome
- 19. Genes • A gene: DNA sequence that is needed to encode amino acid sequence of a protein • Composed of exons, introns and different control elements • Exon – protein coding sequence • Intron – intervening sequence
- 20. • Genes vary a lot in size: Humans: average 3000bp largest 2.4 million bp •Genes are separated by sequences with unknown function •Only one strand of the DNA carries biological information template strand •Potential to store biological information is enormous
- 21. That’s all for this time!
- 22. The Human Genome and Inheritance
- 23. • 3 billion base pairs • about 22 000 genes • Only 2 % of the DNA encode proteins • Genes include exons and introns • Beside coding areas also additional secuences are found • 50 % repeated sequences (”junk DNA”) The Human genome... The different types of sequences that make up the total DNA of a human cell
- 24. • 23 chromosome pairs 46 chromosomes • 44 autosomes, 2 sex chromosomes • X and Y –chromosomes • XX female • XY Male
- 25. Chromosomes carrying the same genes are called homologous
- 26. Mutations • Alterations in DNA sequence • Some are part of normal DNA variation • Caused by chemical and physiological agents and errors in DNA replication • Cells can repaire some mistakes • If not repaired changes in DNA sequence are made permanent by DNA replication
- 27. Point mutations: Single base mutations: 1. Missense mutation: leads to an amino acid change 2. Silent mutation: does not change the amino acid 3. Nonsense mutation: causes premature stop-codon
- 28. • Frameshift mutations: insertion/deletion dublication translocation Altered reading frame Severe impacts on protein structure
- 29. Passing on the genetic information: • Information passed on in the sexual reproduction • Needed for new characteristics to develop • Offspring recieve genes by inheriting chromosomes
- 30. Two important terms... Phenotype: The outlook of an organism Genotype: The genetic information written in DNA ATGTTTCCACCTTCAGGTTCC ACTGGGCTGATTCCCCCCTC C CACTTTCAAGCTCGGCCCCT T TCAACTCAGAGAGGCGGCTA GACACCCAGAGACCTCAAGT GACCATGTGGGAACGGGATG GCCAAGAATGGCTCCCACC T GGCTCTCAGACATTCCCCT GGTCCAACCCCCAGGCCAT CAAGATGTCTCAGAGAGGC GGCTAGACACCCAGAGACC TCAAGTGACCATGTGGGAA CGGGATGTTTCCAGTGACA GGCA Genotype Phenotypes Genotype
- 31. All somatic cells • 23 chromosome pairs (46 chromosomes) • Diploid cells, 2n Sperm cell • 23 chromosomes • Haploid cell, n Egg cell • 23 chromosomes • Haploid cell, n Fertilization: n n + Fertilized egg • 2n • 46 chromosomes
- 32. A chromosome pare: • A locus • An allele
- 33. Mitosis • Division of somatic cells • Products two daughter cells from one parent cell • The number of chromosomes does not change • DNA duplicates before entering the mitosis • Takes 1-2 hours
- 34. Meiosis • Only in gamete formation • One diploidic parent cell produces four haploid gametosytes • Mature gametocytes have 23 chromosomes (n)
- 35. • Chromatids change parts between homologous chromatids during the meiosis • Causes redistribution of heridary material between the homologous chromosomes number of genes doesn’t change new allele combinations are formed Crossing over:
- 37. Inherited diseases • DNA mutations are significant in development of diseases • Inherited diseases are caused by mutations passed from a parent to a offspring • Monogenic diseases: disease is caused by one mutation in one gene • Multifactiorial diseases: disease is caused by interaction of different mutations and environmental factors • Mendelian inheritance: Presence or absence of the phenotype depends on the genotype at a single locus
- 38. • Dominant character: only one allele needed to cause the phenotype (heterozygous) • Recessive character: both allels needed to cause the phenotype (homozygous)
- 40. Autosomal dominant inheritance: Aa aa Aa Aa aa
- 42. X-chromosome linked recessive inheritance:
- 43. X-chromosome linked dominant inheritance: