Genetic polymorphisms for cellular and molecular .doc
- 1. Genetic polymorphisms Genetic polymorphisms are different forms of a DNA sequence. " Poly" means many, and "morph" means form. Polymorphisms are a type of genetic diversity within a population's gene pool. They can be used to map (locate) genes such as those causing a disease, and they can help match two samples of DNA to determine if they come from the same source. The DNA sequence of exactly the same region on a chromosome is remarkably similar among chromosomes carried by many different individuals from around the world In randomly chosen segment of human DNA about 1000 base pairs in length, contains (on average), only one base pair that varies between the two homologous chromosomes inherited from the parents (assuming the parents are unrelated)!!! The variant constitutes what is known as genetic polymorphism When a variant is so common that it constitutes more than 1% of chromosomes in the general population Others are in regulatory regions and may also be important in determining phenotype by affecting transcription or mRNA stability Sequence changes may also be located in the coding sequence of genes themselves and result in different protein variants that may lead in turn to different phenotypes Or it can also be changes in one or a few bases in the DNA located between genes or within introns Deletion, duplication, triplication and so on of hundreds of millions of base pairs of DNA Polymorphism ca be caused by: The fact that SNPs are common does not mean that they must be neutral and without effect on health or prolonged existence what it does mean is that any effect of common SNPs must be a delicate altering of disease susceptibility rather than a direct cause of serious illness (As an extension of the Human Genome Project, scientists focus (besides other topics) to identification of millions of SNPs, that are gathered to public databases. It is technically feasible now to type 500 000 SNPs in a single DNA sample, which should accelerate the identification of the alleles responsible for a wide range of common diseases) Within a population, SNPs can be assigned a minor allele frequency — the lowest allele frequency at a locus that is observed in a particular population. For example, two sequenced DNA fragments from different individuals, AAGCCTA to AAGCTTA, contain a difference in a single nucleotide. In this case we say that there are two alleles : C and T 99.9% of the DNA sequence is identical between any two individuals. Of the remaining 0.1% difference, 80% is represented by SNPs SNPs usually have only 2 alleles
- 2. corresponding to the two different bases occupying a particular location in the genome Single nucleotide polymorphism - SNPs (simplest and most common of all polymorphisms) RFLP = restriction fragment length polymorphism Restriction endonucleases are bacterial enzymes that cleave DNA at a specific sequence. They protect bacteria against bacteriophage infection (or perhaps have no function) TAGCCATCGGTA-CGTACTCAATGATCA ATCGGTAGCCATGC-ATGAGTTACTAGT TAGCCATCGGTAAGTACTCAATGATCA ATCGGTAGCCATTCATGAGTTACTAGT presence or absence of inserted or deleted segment… - The other half are multiallelic due to a variable numbers of a segment of DNA that is repeated in tandem at a particular location (Multiallelic indels are further subdivided into microsatellite and minisatellite)Insertion-deletion (indels) polymorphism - Insertion – deletion of between 2 and 100 nucleotides - Half of all indels are referred to as simple because they have only two alleles