Abstract image of a woman sitting on books and studying on a laptop

New Progress in Pyrosequencing for DNA Methylation

QIAGEN, profile picture
QIAGEN

The document discusses advancements in pyrosequencing technology for automated DNA methylation analysis, highlighting challenges such as insufficient read lengths and incomplete bisulfite conversion. It introduces the PyroMark Q48 Autoprep and emphasizes its potential in overcoming these bottlenecks for epigenetic research. Additionally, it outlines the workflow for sample preparation and data analysis critical for reliable quantification of DNA methylation.

Health & Medicine
1 of 55
Downloaded 89 times
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
Sample to Insight New progress in Pyrosequencing for automated single base resolution DNA methylation analysis for epigenetic research Gerald Schock, Ph.D. Associate Director Pyrosequencing QIAGEN GmbH New progress in Pyrosequencing for epigentic applications 1
Sample to Insight 2 QIAGEN products shown here are intended for molecular biology applications. These products are not intended for the diagnosis, prevention or treatment of a disease. For up-to-date licensing information and product-specific disclaimers, see the respective QIAGEN kit handbook or user manual. QIAGEN kit handbooks and user manuals are available at www.QIAGEN.com or can be requested from QIAGEN Technical Services or your local distributor. Legal disclaimer New progress in Pyrosequencing for epigentic applications
Sample to Insight Outline New progress in Pyrosequencing for epigentic applications 3 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
Sample to Insight Outline New progress in Pyrosequencing for epigentic applications 4 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
Sample to Insight Challenges in Pyrosequencing DNA methylation analysis 5 Current challenges observed during Pyrosequencing analysis Insufficient read length Issues sequencing through homopolymer T sequences Challenging assay optimization Incomplete bisulfite conversion Tedious ssDNA preparation Genomic sequence TTCGCGATTGAATTCGAAAGACTCTCTTCGGCGGATGAAAGTCGTTATCTCTTGGTTGGTTGAGTTATAGTCTT New progress in Pyrosequencing for epigentic applications
Sample to Insight Outline New progress in Pyrosequencing for epigentic applications 6 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
Sample to Insight Pyrosequencing – principle and key features New progress in Pyrosequencing for epigentic applications 7 .Based on SEQUENCING-by-SYNTHESIS Principle* • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides * Ronaghi, M., Uhlén, M., Nyrén, P. (1998) A sequencing method based on real-time pyrophosphate. Science. 281:363. Step 1 Hybridization of a sequencing primer Step 2-4 Addition of dNTP, conversion into light signal, degradation of nucleotides Step 5 Pyrogram generation and data analysis
Sample to Insight Pyrosequencing – principle and key features New progress in Pyrosequencing for epigentic applications 8 Sequencing through unknown regions Sequencing through unknown regions .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides
Sample to Insight Pyrosequencing – principle and key features New progress in Pyrosequencing for epigentic applications 9 A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP Sequencing through unknown regions .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides
Sample to Insight Pyrosequencing – principle and key features New progress in Pyrosequencing for epigentic applications 10 A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP Sequencing through unknown regions .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides QIAGEN webinar: New progress in Pyrosequencing for automated quantitative analysis of bi- or multi-allelic sequence variations Recorded sessions: View online at www.qiagen.com
Sample to Insight Pyrosequencing – principle and key features New progress in Pyrosequencing for epigentic applications 11 Insertions / Deletions - - - - - - - : 56% ATCTGCC: 44% C: 57% T: 43% A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP Insertions / Deletions - - - - - - -: 56% ATCTGCC: 44% C: 57% T: 43% Sequencing through unknown regions .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides
Sample to Insight Pyrosequencing – principle and key features New progress in Pyrosequencing for epigentic applications 12 A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP Insertions / Deletions - - - - - - -: 56% ATCTGCC: 44% C: 57% T: 43% DNA methylation of multiple CpG sites Sequencing through unknown regions DNA methylation of multiple CpG sites .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides
Sample to Insight Pyrosequencing – principle and key features New progress in Pyrosequencing for epigentic applications 13 DNA methylation of multiple CpG sites A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP Insertions / Deletions - - - - - - -: 56% ATCTGCC: 44% C: 57% T: 43% DNA methylation of multiple CpG sites Sequencing through unknown regions .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides
Sample to Insight QIAGEN’s Pyrosequencing solutions for DNA methylation analysis 14 • PAXgene Blood DNA Tube • QIAamp Kits • AllPrep RNA/ DNA Kits • EpiTect Fast DNA Kits • EpiTect Fast LyseAll Kits • EpiTect Fast FFPE Kits • PyroMark Assay Design SW • PyroMark PCR Kit • PyroMark Q24 Advanced • PyroMark Q24 Advanced Reagents • PyroMark Q48 Autoprep • PyroMark Q48 Advanced Reagents Sample collection &/ stabilization DNA purification Assay design Bisulfite conversion Pre- amplification Pyro- sequencing PyroMark Assay Design SW PyroMark Q48 Advanced Kit PyroMark PCR Kit PyroMark Q48 Autoprep New progress in Pyrosequencing for epigentic applications
Sample to Insight Pyrosequencing workflow – Assay design New progress in Pyrosequencing for epigentic applications 15 Assay design • Two PCR primers (one is biotinylated) o Biotin-labeled strand is isolated using Vacuum Prep Workstation • Sequencing primer o Placed in front of region of interest o Annealed to single-stranded DNA before Pyrosequencing reaction PCR primer Region of interest PCR primer Sequencing primer DNA purification Bisulfite conversion Pre- amplification Assay design ssDNA preparation Pyro- sequencing
Sample to Insight Pyrosequencing workflow - PCR New progress in Pyrosequencing for epigentic applications 16 PCR / RT-PCR • Can use any PCR machine • PyroMark PCR Kit / PyroMark OneStep RT-PCR Kit • Amplify relevant region by PCR (up to 500 bp) • Can use very short PCR products if desired (i.e. degraded DNA) • One primer has to be biotinylated DNA purification Bisulfite conversion Pre- amplification Assay design ssDNA preparation Pyro- sequencing
Sample to Insight Pyrosequencing workflow – Template preparation New progress in Pyrosequencing for epigentic applications 17 Template preparation • Separates biotinylated PCR strand from unbiotinylated strand and PCR primers • Streptavidin-coated Sepharose beads used for binding biotinylated PCR strand • Immobilization and separation by using o Sepharose beads and vacuum prep workstation (PyroMark Q96 ID, Q24, Q24 Adv) o Magnetic Sepharose beads (PyroMark Q48 Autoprep) DNA purification Bisulfite conversion Pre- amplification Assay design ssDNA preparation Pyro- sequencing
Sample to Insight Pyrosequencing workflow – Template preparation New progress in Pyrosequencing for epigentic applications 18 Annealing of Sequencing primer • Sequencing primer only binds to biotinylated PCR strand • ssDNA is needed for binding • Binding done o Manually (PyroMark Q96 ID, Q24, Q24 Adv) o Automated (PyroMark Q48 Autoprep) DNA purification Bisulfite conversion Pre- amplification Assay design ssDNA preparation Pyro- sequencing Sequencing primer
Sample to Insight Measuring frequencies in sequence variations New progress in Pyrosequencing for epigentic applications 19 Example: DNA methylation analysis .A G T T A C G A C A.Sequence to be analyzed: .After bisulfite conversion: .A G T T A C G A C A .A G T T A C m G A C A.and .A G T T A T G A T A .A G T T A C m G A T A.and .Analyzed sequence: X .A .G .T .A .A.T/C .T.T G .A
Sample to Insight Measuring frequencies in sequence variations New progress in Pyrosequencing for epigentic applications 20 Example: DNA methylation analysis .A G T T A C G A C A .A G T T A C G A C A .A G T T A C m G A C A.and .A G T T A T G A T A .A G T T A C m G A T A.and .A .G .T.A .A.T .C .C .T.G .27% .Nucleotides added: X .A .G .T .A .A.T/C .T.T G .A .A .Sequence to be analyzed: .After bisulfite conversion: .Analyzed sequence: Ratio T:C
Sample to Insight Measuring frequencies in sequence variations 21 Quantitative peak heights to measure allele frequencies Wasson et al. 2002. Assessing allele frequencies of single nucleotide polymorphisms in DNA pools by Pyrosequencing technology. Biotechniques. 32:1144–1152. New progress in Pyrosequencing for epigentic applications Even as little as 2% of one allele in 98% of the other could be detected
Sample to Insight Measuring frequencies in sequence variations New progress in Pyrosequencing for epigentic applications 22 Example: DNA methylation analysis .A G T T A C G A C A .A G T T A C G A C A .A G T T A C m G A C A.and .A G T T A T G A T A .A G T T A C m G A T A.and .A .G .T.A .A.T .C .C .T.G .27% .Nucleotides added: X .A .G .T .A .A.T/C .T.T G .A .A .Sequence to be analyzed: .After bisulfite conversion: .Analyzed sequence: Ratio T:C
Sample to Insight Measuring frequencies in sequence variations New progress in Pyrosequencing for epigentic applications 23 Example: DNA methylation analysis .A G T T A C G A C A .A G T T A C G A C A .A G T T A C m G A C A.and .A G T T A T G A T A .A G T T A C m G A T A.and .A .G .T.A .A.T .C .C .T.G .27% X .A .G .T .A .A.T/C .T.T G .A .A.Nucleotides added: .After bisulfite conversion: .Analyzed sequence: .Sequence to be analyzed: Ratio T:C
Sample to Insight Measuring frequencies in sequence variations New progress in Pyrosequencing for epigentic applications 24 Example: DNA methylation analysis Ratio T:C C=0% T=100% .A G T T A C G A C A .A G T T A C G A C A .A G T T A C m G A C A.and .A G T T A T G A T A .A G T T A C m G A T A.and .A .G .T.A .A.T .C .C .T.G .27% .Built-in quality control: successful bisulfite conversion X .A .G .T .A .A.T/C .T.T G .A .A.Nucleotides added: .After bisulfite conversion: .Analyzed sequence: .Sequence to be analyzed:
Sample to Insight Improving bisulfite conversion efficiency New progress in Pyrosequencing for epigentic applications 25 Superior bisulfite conversion. Following bisulfite conversion of genomic DNA using the EpiTect Fast DNA Bisulfite Kit or a kit from Supplier Z, unconverted genomic DNA and bisulfite converted DNA were coamplified and then sequenced by Pyrosequencing. EpiTect Fast Kits showed better results when a limited amount of DNA was analyzed (10 ng). DNA purification Bisulfite conversion Pre- amplification Assay design ssDNA preparation Pyro- sequencing EpiTect Fast Bisulfite conversion Complete conversion ensures reliable quantification of DNA methylation
Sample to Insight Outline New progress in Pyrosequencing for epigentic applications 3 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
Sample to Insight Outline New progress in Pyrosequencing for epigentic applications 27 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
Sample to Insight Advanced Pyrosequencing Technology 28 Advanced Pyrosequencing addresses main bottlenecks in conventional Pyrosequencing New progress in Pyrosequencing for epigentic applications Insufficient read length Issues sequencing through homopolymer T sequences Challenging assay optimization Incomplete bisulfite conversion Tedious ssDNA preparation Genomic sequence TTCGCGATTGAATTCGAAAGACTCTCTTCGGCGGATGAAAGTCGTTATCTCTTGGTTGGTTGAGTTATAGTCTT
Sample to Insight Effects of low level incomplete bisulfite conversion 29 Sample: unmethylated DNA C T C T C AgDNA G A C G A T T T T T T A G A T G A Tafter bis. ideally C Cm U Cm T C Bisulfite conversion PCR New progress in Pyrosequencing for epigentic applications
Sample to Insight Effects of low level incomplete bisulfite conversion 30 Sample: unmethylated DNA C T C T C AgDNA G A C G A T T T T T T A G A T G A Tafter bis. ideally T T T T T A G A T G A T C T T T T A G A T G A T T T C T T A G A T G A T T T T T C A G A T G A T after bis. reality ~99.5% after bis. reality ~0.1% after bis. reality ~0.1% after bis. reality ~0.1% New progress in Pyrosequencing for epigentic applications After bisulfite conversion, some C nucleotides in some molecules remain unconverted. Conversion efficiency of EpiTect Kits is around 99.4–99.6%. Other kits show conversion efficiencies of 95–98%. Incomplete bisulfite conversion may affect Pyrosequencing results
Sample to Insight Effects of low level incomplete bisulfite conversion 31 Sample: unmethylated DNA (conventional Pyrosequencing) C T C T C A T T T T T A gDNA G A C G A T G A T G A T C T T T T A G A T G A T T T C T T A G A T G A T T T T T C A G A T G A T after bis. reality ~99.5% after bis. reality ~0.1% after bis. reality ~0.1% after bis. reality ~0.1% T T T T T A G A T G A Tafter bis. ideally x% T A G A T C G A T single peak 5x peak wrong calculation peak deviations New progress in Pyrosequencing for epigentic applications
Sample to Insight Multiple dispensations act as “catch up” in Advanced Pyrosequencing 32 Sample: unmethylated DNA (Advanced Pyrosequencing) 0% T A G A T C G T T T T T A G A T G A T C T T T T A G A T G A T T T C T T A G A T G A T T T T T C A G A T G A T A T single peak 5x peak +C +T less peak deviations → longer reads C T C T C AgDNA G A C G A T T T T T T A G A T G A Tafter bis. ideally after bis. reality ~99.5% after bis. reality ~0.1% after bis. reality ~0.1% after bis. reality ~0.1% correct calculation New progress in Pyrosequencing for epigentic applications
Sample to Insight Incomplete bisulfite conversion may result in short read length New progress in Pyrosequencing for epigentic applications 33 Conventional Pyrosequencing analysis of the LOX gene locus PyroMarkQ24 trusted sequence
Sample to Insight Incomplete bisulfite conversion may result in short read length New progress in Pyrosequencing for epigentic applications 34 Conventional Pyrosequencing analysis of the LOX gene locus PyroMarkQ24 trusted sequence uncertain sequence Conventional Pyrosequencing may show uncertain quantification results in long sequencing runs
Sample to Insight Incomplete bisulfite conversion may result in short read length New progress in Pyrosequencing for epigentic applications 35 Conventional Pyrosequencing analysis of the LOX gene locus PyroMarkQ24 trusted sequence uncertain sequence Increasing peak deviation from expected signals in late sequence positions
Sample to Insight Advanced Pyrosequencing increases read length and trust New progress in Pyrosequencing for epigentic applications 36 Conventional vs. Advanced Pyrosequencing analysis of the LOX gene locus PyroMarkQ24PyroMarkQ24Advanced trusted sequence uncertain sequence trusted sequence Advanced Pyrosequencing overcomes issues of low level incomplete bisulfite conversion
Sample to Insight Issues with quantification of CpG methylation in homopolymers 37 Genomic sequence TTCGCGATTGAATTCGAAAGACTCTCTTCGGCGGATGAAAGTCGTTATCTCTTGGTTGGTTGAGTTATAGTCTT After bisulfite conversion TTYGYGATTGAATTYGAAAGATTTTTTTYGGYGGATGAAAGTYGTTATTTTTTGGTTGGTTGAGTTATAGTTTT 8xT if C is not methylated 7xT if C is methylated 6xT 4xT Histogram New progress in Pyrosequencing for epigentic applications Bisulfite conversion in DNA methylation analysis leads to occurrence of poly T stretches
Sample to Insight Outline New progress in Pyrosequencing for epigentic applications 4 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
Sample to Insight Improved quantification of CpG methylation in homopolymers 39 PyroMarkQ24PyroMarkQ24Advanced trusted sequence uncertain sequence trusted sequence New progress in Pyrosequencing for epigentic applications PyroMark Q24 Advanced enables reliable quantification of CpG methylation behind and even within a stretch of 8 T nucleotides
Sample to Insight Advanced Pyrosequencing Technology 40 Advanced Pyrosequencing addresses main bottlenecks in conventional Pyrosequencing Advanced Pyrosequencing • Longer Pyrosequencing read length ◦ de novo sequencing ◦ DNA methylation analysis • Increased reliability in quantification of CpG sites and other sequence variations • Increased robustness of assays ◦ Weak sequencing primer binding ◦ Low level incomplete bisulfite conversion • Facilitates easier assay development New progress in Pyrosequencing for epigentic applications
Sample to Insight Advanced Pyrosequencing Technology 41 Optimized software, reagents and instrument firmware working hand-in-hand Advanced Pyrosequencing • Longer Pyrosequencing read length ◦ De novo sequencing ◦ DNA methylation analysis • Increased reliability in quantification of CpG sites and other sequence variations • Increased robustness of assays ◦ Weak sequencing primer binding ◦ Low level incomplete bisulfite conversion • Facilitates easier assay development PyroMark Analysis SW optimized run setup files (e.g. additional dispensations) New progress in Pyrosequencing for epigentic applications
Sample to Insight Advanced Pyrosequencing Technology 42 Optimized software, reagents and instrument firmware working hand-in-hand Advanced Pyrosequencing • Longer Pyrosequencing read length ◦ De novo sequencing ◦ DNA methylation analysis • Increased reliability in quantification of CpG sites and other sequence variations • Increased robustness of assays ◦ Weak sequencing primer binding ◦ Low level incomplete bisulfite conversion • Facilitates easier assay development PyroMark Analysis SW optimized run setup files (e.g. additional dispensations) PyroMark Advanced Reagents optimized nucleotide concentration New progress in Pyrosequencing for epigentic applications
Sample to Insight Advanced Pyrosequencing Technology 43 Optimized software, reagents and instrument firmware working hand-in-hand Advanced Pyrosequencing • Longer Pyrosequencing read length ◦ De novo sequencing ◦ DNA methylation analysis • Increased reliability in quantification of CpG sites and other sequence variations • Increased robustness of assays ◦ Weak sequencing primer binding ◦ Low level incomplete bisulfite conversion • Facilitates easier assay development PyroMark Analysis SW optimized run setup files (e.g. additional dispensations) PyroMark Advanced Reagents optimized nucleotide concentration Instrument firmware optimized dispensation (e.g. double shots) New progress in Pyrosequencing for epigentic applications
Sample to Insight Advanced Pyrosequencing Technology 44 Optimized software, reagents and instrument firmware working hand-in-hand Advanced Pyrosequencing • Longer Pyrosequencing read length ◦ De novo sequencing ◦ DNA methylation analysis • Increased reliability in quantification of CpG sites and other sequence variations • Increased robustness of assays ◦ Weak sequencing primer binding ◦ Low level incomplete bisulfite conversion • Facilitates easier assay development PyroMark Analysis SW optimized run setup files (e.g. additional dispensations) PyroMark Advanced Reagents optimized nucleotide concentration Instrument firmware optimized dispensation (e.g. double shots) PyroMark Analysis SW optimized analysis New progress in Pyrosequencing for epigentic applications
Sample to Insight Advanced Pyrosequencing Technology 45 PyroMark Platforms offering Advanced Pyrosequencing Advanced Pyrosequencing is available on two PyroMark Platforms PyroMark Q24 Advanced PyroMark Q48 Autoprep New progress in Pyrosequencing for epigentic applications
Sample to Insight Outline New progress in Pyrosequencing for epigentic applications 46 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
Sample to Insight PyroMark Q48 Autoprep – Workflow New progress in Pyrosequencing for epigentic applications 47 Workflow comparison of available Pyrosequencing platforms Sample preparation Assay design PCR amplification ssDNA preparation Analysis • PyroMark Q24 Vacuum Workstation • PyroMark Q96 Vacuum Workstation • PyroMark Q24 • PyroMark Q24 Adv. • PyroMark Q96 ID • PyroMark Q48 AutoprepNEW ssDNA preparation and analysis PyroMark Q48 Autoprep: Simplified workflow combined with advanced Pyrosequencing
Sample to Insight PyroMark Q48 Autoprep – Protocol New progress in Pyrosequencing for epigentic applications 48 Automatic template preparation fully integrated in PyroMark Q48 Autoprep workflow Load reagents, nucleotides, buffers Load PCR product & magnetic beads Insert Absorber strip & Disc Load Run files via USB or Ethernet Automatic template preparation Pyro- sequencing Analyze data
Sample to Insight PyroMark Q48 Autoprep – Dimensions & Weight 49 390 mm (L, closed) 300mm(H) 560 mm (L, open) 250 mm (W) Small footprint and low weight (8.5 kg) New progress in Pyrosequencing for epigentic applications Small footprint (1/2 x PyroMark Q24) and low weight (1/3 x PyroMark Q24)
Sample to Insight PyroMark Q48 Autoprep – SW User Interface New progress in Pyrosequencing for epigentic applications 50 Large and easy-to-use touch screen and intuitive instrument SW
Sample to Insight PyroMark Q48 Autoprep offers highest degree of automation 51 Automated protocol steps along the Pyrosequencing workflow Load reagents, nucleotides, buffers Load PCR product & beads Manual template preparation with VPWS Anneal Seq- primer Pyro- sequencing Wash Cartridge & VPWS Load reagents, nucleotides, buffers Load PCR product & magnetic beads Automatic template preparation Anneal Seq- primer Pyro- sequencing PyroMark Q96 MD, Q96 ID, Q24, and Q24 Advanced PyroMark Q48 Autoprep • Multi-step pipette can be used for pipetting beads • Automatic pipetting system can be used manual automated manual/automated • Automatic dispensation of up to 3 Seq primers • Manual dispensation for 4 or more Seq primers • Automatic dispensation of 3 MPD* Mixes *MPD: Multiple Primer Dispensation Wash Cartridge New progress in Pyrosequencing for epigentic applications
Sample to Insight Summary New progress in Pyrosequencing for epigentic applications 52 PyroMark Q48 Autoprep for “Advanced” Pyrosequencing in DNA methylation analysis • Cost-efficient tool for analyzing DNA methylation • Consecutive CpG and CpN sites analyzed independently in a single run • Improved quantification at any sequence position, even at homopolymer T sequences • Direct quality control of bisulfite conversion during the run • Fast processing: 48 samples in minutes • Automated Pyrosequencing through integrated template prep • Low sample input amounts: 1–10 ng • Highly accurate quantification: • LOD: 5% in methylation analysis PyroMark Q48 Autoprep: Simplified workflow combined with advanced Pyrosequencing for longer reads and more accurate methylation analysis
Sample to Insight PyroMark Q48 Autoprep on the web 53 More information about the platform, accessories and reagents are available online New progress in Pyrosequencing for epigentic applications https://www.qiagen.com/de/shop/automated-solutions/sequencers/pyromark-q48-autoprep/ https://www.qiagen.com/de/shop/automated-solutions/sequencers/pyromark-q48-advanced-reagents/
Sample to Insight PyroMark Q48 Autoprep Intro Page 54New progress in Pyrosequencing for epigentic applications https://www.qiagen.com/de/resources/technologies/pyrosequencing-resource-center/
Sample to Insight Challenges in Pyrosequencing DNA methylation analysis 5 Current challenges observed during Pyrosequencing analysis Insufficient read length Issues sequencing through homopolymer T sequences Challenging assay optimization Incomplete bisulfite conversion Tedious ssDNA preparation Genomic sequence TTCGCGATTGAATTCGAAAGACTCTCTTCGGCGGATGAAAGTCGTTATCTCTTGGTTGGTTGAGTTATAGTCTT New progress in Pyrosequencing for epigentic applications

More Related Content

PDF
Introduction to next generation sequencing
VHIR Vall d’Hebron Institut de Recerca
 
PDF
Next Generation Sequencing methods
Zohaib HUSSAIN
 
PPTX
RNA-seq differential expression analysis
mikaelhuss
 
PPTX
Protein dna interactions
Mandeep Kaur
 
PDF
Accurate DNA Methylation Analysis with Successful Bisulfite Conversion Webinar
QIAGEN
 
PPTX
Comparative genomics in eukaryotes, organelles
KAUSHAL SAHU
 
PPT
Biomarkers omics 1
Almustaqbal college University
 
PPTX
Metabolic engineering ppt
Satyam singh
 
Introduction to next generation sequencing
VHIR Vall d’Hebron Institut de Recerca
 
Next Generation Sequencing methods
Zohaib HUSSAIN
 
RNA-seq differential expression analysis
mikaelhuss
 
Protein dna interactions
Mandeep Kaur
 
Accurate DNA Methylation Analysis with Successful Bisulfite Conversion Webinar
QIAGEN
 
Comparative genomics in eukaryotes, organelles
KAUSHAL SAHU
 
Biomarkers omics 1
Almustaqbal college University
 
Metabolic engineering ppt
Satyam singh
 

What's hot (20)

PPTX
Introduction to synthetic biology
Gaurav Bohra
 
PPTX
Metabolomics
Sameen Adil
 
PPT
Ion torrent semiconductor sequencing technology
CD Genomics
 
DOCX
Types of PCR
Microbiology
 
PPTX
PCR, RT-PCR and qPCR
All India Institute of Medical Sciences
 
PPTX
Next Generation Sequencing of DNA
maryamshah13
 
PPT
Synthetic biology: Concepts and Applications
USTC, Hefei, PRC
 
PDF
Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...
VHIR Vall d’Hebron Institut de Recerca
 
PPTX
Epigenomics
Adonis Sfera, MD
 
PPTX
Next generation sequencing
Dayananda Salam
 
PPTX
Genomics(functional genomics)
IndrajaDoradla
 
PPTX
Proteomics
Mohit Bharti
 
PDF
454 pyrosequencing @ujjwalsirohi
ujjwal sirohi
 
PPTX
Functional proteomics, methods and tools
KAUSHAL SAHU
 
PPTX
Transcript detection in RNAseq
Denis C. Bauer
 
PPTX
Introduction to Protein Engineering
Theabhi.in
 
PPT
Synthetic Biology
Robert Cormia
 
PDF
Brief Introduction of SILAC
Creative Proteomics
 
PDF
Transcriptomics and metabolomics
Sukhjinder Singh
 
PDF
ChipSeq Data Analysis
COST action BM1006
 
Introduction to synthetic biology
Gaurav Bohra
 
Metabolomics
Sameen Adil
 
Ion torrent semiconductor sequencing technology
CD Genomics
 
Types of PCR
Microbiology
 
PCR, RT-PCR and qPCR
All India Institute of Medical Sciences
 
Next Generation Sequencing of DNA
maryamshah13
 
Synthetic biology: Concepts and Applications
USTC, Hefei, PRC
 
Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...
VHIR Vall d’Hebron Institut de Recerca
 
Epigenomics
Adonis Sfera, MD
 
Next generation sequencing
Dayananda Salam
 
Genomics(functional genomics)
IndrajaDoradla
 
Proteomics
Mohit Bharti
 
454 pyrosequencing @ujjwalsirohi
ujjwal sirohi
 
Functional proteomics, methods and tools
KAUSHAL SAHU
 
Transcript detection in RNAseq
Denis C. Bauer
 
Introduction to Protein Engineering
Theabhi.in
 
Synthetic Biology
Robert Cormia
 
Brief Introduction of SILAC
Creative Proteomics
 
Transcriptomics and metabolomics
Sukhjinder Singh
 
ChipSeq Data Analysis
COST action BM1006
 
Ad

Similar to New Progress in Pyrosequencing for DNA Methylation (20)

PPTX
New Progress in Pyrosequencing for Automated Quantitative Analysis of Bi- or ...
QIAGEN
 
PPT
Pyrosequencing slide presentation rev3.
Robert Bruce
 
PPT
PCR lecture.ppt
NoorKhan428102
 
PDF
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
QIAGEN
 
PPTX
Polymerase Chain Reaction.pptx
ShouvikrijuMallik
 
PDF
Dna Methylation Analysis in a Single Day - Download the Slides
QIAGEN
 
PPTX
InsilicoPCR.pptx
Pranavi Uppuluri
 
PPTX
PCR Methods and applications
Behzad Milani
 
PPTX
overview of the PCR - maha hammady 2025 - Copy.pptx
Maha Hammady Hemdan
 
PDF
pcr.pdf molecular genetics pdf pcr practicale
omniaabdo276
 
PPTX
pcr
ASSEMELZENY
 
PDF
rt-pcr-160517175331.pdf
sumitraDas14
 
PPTX
RT PCR
mah neem mah
 
DOCX
PCR.docx
AakritiKaundal2
 
PDF
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...
Thermo Fisher Scientific
 
PPT
Ihr l12pcr en
Oyonk Bacho
 
PPTX
Lectut btn-202-ppt-l28. variants of pcr-ii
Rishabh Jain
 
PPTX
RNase H2 PCR—A New Technology to Reduce Primer Dimers and Increase Genotyping...
Integrated DNA Technologies
 
PPTX
POLYMERASE CHAIN REACTION(PCR)-subina sunar.pptx
SubinaSunar
 
PDF
nextgenerationsequencing-170606100132.pdf
AkhileshPathak33
 
New Progress in Pyrosequencing for Automated Quantitative Analysis of Bi- or ...
QIAGEN
 
Pyrosequencing slide presentation rev3.
Robert Bruce
 
PCR lecture.ppt
NoorKhan428102
 
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
QIAGEN
 
Polymerase Chain Reaction.pptx
ShouvikrijuMallik
 
Dna Methylation Analysis in a Single Day - Download the Slides
QIAGEN
 
InsilicoPCR.pptx
Pranavi Uppuluri
 
PCR Methods and applications
Behzad Milani
 
overview of the PCR - maha hammady 2025 - Copy.pptx
Maha Hammady Hemdan
 
pcr.pdf molecular genetics pdf pcr practicale
omniaabdo276
 
pcr
ASSEMELZENY
 
rt-pcr-160517175331.pdf
sumitraDas14
 
RT PCR
mah neem mah
 
PCR.docx
AakritiKaundal2
 
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...
Thermo Fisher Scientific
 
Ihr l12pcr en
Oyonk Bacho
 
Lectut btn-202-ppt-l28. variants of pcr-ii
Rishabh Jain
 
RNase H2 PCR—A New Technology to Reduce Primer Dimers and Increase Genotyping...
Integrated DNA Technologies
 
POLYMERASE CHAIN REACTION(PCR)-subina sunar.pptx
SubinaSunar
 
nextgenerationsequencing-170606100132.pdf
AkhileshPathak33
 
Ad

More from QIAGEN (20)

PDF
Using methylation patterns to determine origin of biological material and age
QIAGEN
 
PDF
Take lung cancer research to a new molecular dimension
QIAGEN
 
PDF
The power of a splice
QIAGEN
 
PDF
QIAGEN LNA Tools - Experience truly exceptional RNA Research
QIAGEN
 
PDF
Take your RNA research to the next level with QIAGEN LNA tools!
QIAGEN
 
PDF
An Approach to De-convolution of Mixtures in Touch DNA Samples. Download now!
QIAGEN
 
PDF
Assessment of Y chromosome degradation level using the Investigator® Quantipl...
QIAGEN
 
PDF
ICMP MPS SNP Panel for Missing Persons - Michelle Peck et al.
QIAGEN
 
PDF
Exploring the Temperate Leaf Microbiome: From Natural Forests to Controlled E...
QIAGEN
 
PDF
Cancer Research & the Challenges of FFPE Samples – An Introduction
QIAGEN
 
PDF
Introduction to real-Time Quantitative PCR (qPCR) - Download the slides
QIAGEN
 
PDF
The Microbiome of Research Animals : Implications for Reproducibility, Transl...
QIAGEN
 
PDF
Building a large-scale missing persons ID SNP panel - Download the study
QIAGEN
 
PDF
Rapid DNA isolation from diverse plant material for use in Next Generation Se...
QIAGEN
 
PDF
Rapid extraction of high yield, high quality DNA from tissue samples - Downlo...
QIAGEN
 
PDF
Critical Factors for Successful Real-Time PCR: Multiplex PCR
QIAGEN
 
PDF
Practical hints and new solutions for successful real-time PCR studies
QIAGEN
 
PDF
Overcome the challenges of Nucleic acid isolation from PCR inhibitor-rich mic...
QIAGEN
 
PDF
RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...
QIAGEN
 
PDF
Reproducibility, Quality Control and Importance of Automation
QIAGEN
 
Using methylation patterns to determine origin of biological material and age
QIAGEN
 
Take lung cancer research to a new molecular dimension
QIAGEN
 
The power of a splice
QIAGEN
 
QIAGEN LNA Tools - Experience truly exceptional RNA Research
QIAGEN
 
Take your RNA research to the next level with QIAGEN LNA tools!
QIAGEN
 
An Approach to De-convolution of Mixtures in Touch DNA Samples. Download now!
QIAGEN
 
Assessment of Y chromosome degradation level using the Investigator® Quantipl...
QIAGEN
 
ICMP MPS SNP Panel for Missing Persons - Michelle Peck et al.
QIAGEN
 
Exploring the Temperate Leaf Microbiome: From Natural Forests to Controlled E...
QIAGEN
 
Cancer Research & the Challenges of FFPE Samples – An Introduction
QIAGEN
 
Introduction to real-Time Quantitative PCR (qPCR) - Download the slides
QIAGEN
 
The Microbiome of Research Animals : Implications for Reproducibility, Transl...
QIAGEN
 
Building a large-scale missing persons ID SNP panel - Download the study
QIAGEN
 
Rapid DNA isolation from diverse plant material for use in Next Generation Se...
QIAGEN
 
Rapid extraction of high yield, high quality DNA from tissue samples - Downlo...
QIAGEN
 
Critical Factors for Successful Real-Time PCR: Multiplex PCR
QIAGEN
 
Practical hints and new solutions for successful real-time PCR studies
QIAGEN
 
Overcome the challenges of Nucleic acid isolation from PCR inhibitor-rich mic...
QIAGEN
 
RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...
QIAGEN
 
Reproducibility, Quality Control and Importance of Automation
QIAGEN
 

Recently uploaded (20)

PPT
Infections Member of Royal College of Physicians.ppt
Nida Us Sahr
 
PPTX
IMAGING EQUIPMENiiiiìiiiiiTpptxeiuueueur
montesdanielcct01
 
PDF
The Digestive System Science Educational Presentation in Dark Orange, Blue, a...
KeziahLibberFacto
 
PDF
The_EHRA_Book_of_Interventional Electrophysiology.pdf
FransiscaMetta
 
PPTX
NRP and care of Newborn.pptx- APPT presentation about neonatal resuscitation ...
GururajaRamaiah1
 
PPTX
NUCLEAR-MEDICINE-Copy.pptxbabaabahahahaahha
DanielCastilloMontes
 
DOCX
PEADIATRICS NOTES.docx lecture notes for medical students
lenixjeff
 
PPTX
Manage HIV exposed child and a child with HIV infection.pptx
patrishomsafiri
 
PPTX
Radiation Dose Management for Patients in Medical Imaging- Avinesh Shrestha
Avinesh Shrestha
 
PDF
B C German Homoeopathy Medicineby Dr Brij Mohan Prasad
bcgermanhomoeo
 
PDF
Lecture 8- Cornea and Sclera .pdf 5tg year
momen mohammed
 
PPTX
y4d nutrition and diet in pregnancy and postpartum
raunakbasantwani11
 
PDF
Lecture on Anesthesia for ENT surgery 2025pptx.pdf
rahmetbekele236
 
PDF
Transcultural that can help you someday.
jhongarin24
 
PDF
Plant-Based Antimicrobials: A New Hope for Treating Diarrhea in HIV Patients...
publication11
 
PPTX
09. Diabetes in Pregnancy/ gestational.pptx
patrishomsafiri
 
PPT
Dermatology for member of royalcollege.ppt
Nida Us Sahr
 
PDF
SEMEN PREPARATION TECHNIGUES FOR INTRAUTERINE INSEMINATION.pdf
nurhidayati102
 
PDF
OSCE Series ( Questions & Answers ) - Set 6.pdf
Jim Jacob Roy
 
PPTX
Vaccines and immunization including cold chain , Open vial policy.pptx
Dr. Anu Marhatta
 
Infections Member of Royal College of Physicians.ppt
Nida Us Sahr
 
IMAGING EQUIPMENiiiiìiiiiiTpptxeiuueueur
montesdanielcct01
 
The Digestive System Science Educational Presentation in Dark Orange, Blue, a...
KeziahLibberFacto
 
The_EHRA_Book_of_Interventional Electrophysiology.pdf
FransiscaMetta
 
NRP and care of Newborn.pptx- APPT presentation about neonatal resuscitation ...
GururajaRamaiah1
 
NUCLEAR-MEDICINE-Copy.pptxbabaabahahahaahha
DanielCastilloMontes
 
PEADIATRICS NOTES.docx lecture notes for medical students
lenixjeff
 
Manage HIV exposed child and a child with HIV infection.pptx
patrishomsafiri
 
Radiation Dose Management for Patients in Medical Imaging- Avinesh Shrestha
Avinesh Shrestha
 
B C German Homoeopathy Medicineby Dr Brij Mohan Prasad
bcgermanhomoeo
 
Lecture 8- Cornea and Sclera .pdf 5tg year
momen mohammed
 
y4d nutrition and diet in pregnancy and postpartum
raunakbasantwani11
 
Lecture on Anesthesia for ENT surgery 2025pptx.pdf
rahmetbekele236
 
Transcultural that can help you someday.
jhongarin24
 
Plant-Based Antimicrobials: A New Hope for Treating Diarrhea in HIV Patients...
publication11
 
09. Diabetes in Pregnancy/ gestational.pptx
patrishomsafiri
 
Dermatology for member of royalcollege.ppt
Nida Us Sahr
 
SEMEN PREPARATION TECHNIGUES FOR INTRAUTERINE INSEMINATION.pdf
nurhidayati102
 
OSCE Series ( Questions & Answers ) - Set 6.pdf
Jim Jacob Roy
 
Vaccines and immunization including cold chain , Open vial policy.pptx
Dr. Anu Marhatta
 

New Progress in Pyrosequencing for DNA Methylation

  • 1. Sample to Insight New progress in Pyrosequencing for automated single base resolution DNA methylation analysis for epigenetic research Gerald Schock, Ph.D. Associate Director Pyrosequencing QIAGEN GmbH New progress in Pyrosequencing for epigentic applications 1
  • 2. Sample to Insight 2 QIAGEN products shown here are intended for molecular biology applications. These products are not intended for the diagnosis, prevention or treatment of a disease. For up-to-date licensing information and product-specific disclaimers, see the respective QIAGEN kit handbook or user manual. QIAGEN kit handbooks and user manuals are available at www.QIAGEN.com or can be requested from QIAGEN Technical Services or your local distributor. Legal disclaimer New progress in Pyrosequencing for epigentic applications
  • 3. Sample to Insight Outline New progress in Pyrosequencing for epigentic applications 3 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
  • 4. Sample to Insight Outline New progress in Pyrosequencing for epigentic applications 4 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
  • 5. Sample to Insight Challenges in Pyrosequencing DNA methylation analysis 5 Current challenges observed during Pyrosequencing analysis Insufficient read length Issues sequencing through homopolymer T sequences Challenging assay optimization Incomplete bisulfite conversion Tedious ssDNA preparation Genomic sequence TTCGCGATTGAATTCGAAAGACTCTCTTCGGCGGATGAAAGTCGTTATCTCTTGGTTGGTTGAGTTATAGTCTT New progress in Pyrosequencing for epigentic applications
  • 6. Sample to Insight Outline New progress in Pyrosequencing for epigentic applications 6 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
  • 7. Sample to Insight Pyrosequencing – principle and key features New progress in Pyrosequencing for epigentic applications 7 .Based on SEQUENCING-by-SYNTHESIS Principle* • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides * Ronaghi, M., Uhlén, M., Nyrén, P. (1998) A sequencing method based on real-time pyrophosphate. Science. 281:363. Step 1 Hybridization of a sequencing primer Step 2-4 Addition of dNTP, conversion into light signal, degradation of nucleotides Step 5 Pyrogram generation and data analysis
  • 8. Sample to Insight Pyrosequencing – principle and key features New progress in Pyrosequencing for epigentic applications 8 Sequencing through unknown regions Sequencing through unknown regions .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides
  • 9. Sample to Insight Pyrosequencing – principle and key features New progress in Pyrosequencing for epigentic applications 9 A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP Sequencing through unknown regions .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides
  • 10. Sample to Insight Pyrosequencing – principle and key features New progress in Pyrosequencing for epigentic applications 10 A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP Sequencing through unknown regions .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides QIAGEN webinar: New progress in Pyrosequencing for automated quantitative analysis of bi- or multi-allelic sequence variations Recorded sessions: View online at www.qiagen.com
  • 11. Sample to Insight Pyrosequencing – principle and key features New progress in Pyrosequencing for epigentic applications 11 Insertions / Deletions - - - - - - - : 56% ATCTGCC: 44% C: 57% T: 43% A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP Insertions / Deletions - - - - - - -: 56% ATCTGCC: 44% C: 57% T: 43% Sequencing through unknown regions .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides
  • 12. Sample to Insight Pyrosequencing – principle and key features New progress in Pyrosequencing for epigentic applications 12 A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP Insertions / Deletions - - - - - - -: 56% ATCTGCC: 44% C: 57% T: 43% DNA methylation of multiple CpG sites Sequencing through unknown regions DNA methylation of multiple CpG sites .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides
  • 13. Sample to Insight Pyrosequencing – principle and key features New progress in Pyrosequencing for epigentic applications 13 DNA methylation of multiple CpG sites A: 44% C: 0% G: 56% T: 0% Di-, tri- and tetra-allelic mutations / SNP Insertions / Deletions - - - - - - -: 56% ATCTGCC: 44% C: 57% T: 43% DNA methylation of multiple CpG sites Sequencing through unknown regions .Based on SEQUENCING-by-SYNTHESIS Principle • Stepwise synthesis of DNA by addition of nucleotides • Enzyme cascade generates a light signal upon incorporation of nucleotides
  • 14. Sample to Insight QIAGEN’s Pyrosequencing solutions for DNA methylation analysis 14 • PAXgene Blood DNA Tube • QIAamp Kits • AllPrep RNA/ DNA Kits • EpiTect Fast DNA Kits • EpiTect Fast LyseAll Kits • EpiTect Fast FFPE Kits • PyroMark Assay Design SW • PyroMark PCR Kit • PyroMark Q24 Advanced • PyroMark Q24 Advanced Reagents • PyroMark Q48 Autoprep • PyroMark Q48 Advanced Reagents Sample collection &/ stabilization DNA purification Assay design Bisulfite conversion Pre- amplification Pyro- sequencing PyroMark Assay Design SW PyroMark Q48 Advanced Kit PyroMark PCR Kit PyroMark Q48 Autoprep New progress in Pyrosequencing for epigentic applications
  • 15. Sample to Insight Pyrosequencing workflow – Assay design New progress in Pyrosequencing for epigentic applications 15 Assay design • Two PCR primers (one is biotinylated) o Biotin-labeled strand is isolated using Vacuum Prep Workstation • Sequencing primer o Placed in front of region of interest o Annealed to single-stranded DNA before Pyrosequencing reaction PCR primer Region of interest PCR primer Sequencing primer DNA purification Bisulfite conversion Pre- amplification Assay design ssDNA preparation Pyro- sequencing
  • 16. Sample to Insight Pyrosequencing workflow - PCR New progress in Pyrosequencing for epigentic applications 16 PCR / RT-PCR • Can use any PCR machine • PyroMark PCR Kit / PyroMark OneStep RT-PCR Kit • Amplify relevant region by PCR (up to 500 bp) • Can use very short PCR products if desired (i.e. degraded DNA) • One primer has to be biotinylated DNA purification Bisulfite conversion Pre- amplification Assay design ssDNA preparation Pyro- sequencing
  • 17. Sample to Insight Pyrosequencing workflow – Template preparation New progress in Pyrosequencing for epigentic applications 17 Template preparation • Separates biotinylated PCR strand from unbiotinylated strand and PCR primers • Streptavidin-coated Sepharose beads used for binding biotinylated PCR strand • Immobilization and separation by using o Sepharose beads and vacuum prep workstation (PyroMark Q96 ID, Q24, Q24 Adv) o Magnetic Sepharose beads (PyroMark Q48 Autoprep) DNA purification Bisulfite conversion Pre- amplification Assay design ssDNA preparation Pyro- sequencing
  • 18. Sample to Insight Pyrosequencing workflow – Template preparation New progress in Pyrosequencing for epigentic applications 18 Annealing of Sequencing primer • Sequencing primer only binds to biotinylated PCR strand • ssDNA is needed for binding • Binding done o Manually (PyroMark Q96 ID, Q24, Q24 Adv) o Automated (PyroMark Q48 Autoprep) DNA purification Bisulfite conversion Pre- amplification Assay design ssDNA preparation Pyro- sequencing Sequencing primer
  • 19. Sample to Insight Measuring frequencies in sequence variations New progress in Pyrosequencing for epigentic applications 19 Example: DNA methylation analysis .A G T T A C G A C A.Sequence to be analyzed: .After bisulfite conversion: .A G T T A C G A C A .A G T T A C m G A C A.and .A G T T A T G A T A .A G T T A C m G A T A.and .Analyzed sequence: X .A .G .T .A .A.T/C .T.T G .A
  • 20. Sample to Insight Measuring frequencies in sequence variations New progress in Pyrosequencing for epigentic applications 20 Example: DNA methylation analysis .A G T T A C G A C A .A G T T A C G A C A .A G T T A C m G A C A.and .A G T T A T G A T A .A G T T A C m G A T A.and .A .G .T.A .A.T .C .C .T.G .27% .Nucleotides added: X .A .G .T .A .A.T/C .T.T G .A .A .Sequence to be analyzed: .After bisulfite conversion: .Analyzed sequence: Ratio T:C
  • 21. Sample to Insight Measuring frequencies in sequence variations 21 Quantitative peak heights to measure allele frequencies Wasson et al. 2002. Assessing allele frequencies of single nucleotide polymorphisms in DNA pools by Pyrosequencing technology. Biotechniques. 32:1144–1152. New progress in Pyrosequencing for epigentic applications Even as little as 2% of one allele in 98% of the other could be detected
  • 22. Sample to Insight Measuring frequencies in sequence variations New progress in Pyrosequencing for epigentic applications 22 Example: DNA methylation analysis .A G T T A C G A C A .A G T T A C G A C A .A G T T A C m G A C A.and .A G T T A T G A T A .A G T T A C m G A T A.and .A .G .T.A .A.T .C .C .T.G .27% .Nucleotides added: X .A .G .T .A .A.T/C .T.T G .A .A .Sequence to be analyzed: .After bisulfite conversion: .Analyzed sequence: Ratio T:C
  • 23. Sample to Insight Measuring frequencies in sequence variations New progress in Pyrosequencing for epigentic applications 23 Example: DNA methylation analysis .A G T T A C G A C A .A G T T A C G A C A .A G T T A C m G A C A.and .A G T T A T G A T A .A G T T A C m G A T A.and .A .G .T.A .A.T .C .C .T.G .27% X .A .G .T .A .A.T/C .T.T G .A .A.Nucleotides added: .After bisulfite conversion: .Analyzed sequence: .Sequence to be analyzed: Ratio T:C
  • 24. Sample to Insight Measuring frequencies in sequence variations New progress in Pyrosequencing for epigentic applications 24 Example: DNA methylation analysis Ratio T:C C=0% T=100% .A G T T A C G A C A .A G T T A C G A C A .A G T T A C m G A C A.and .A G T T A T G A T A .A G T T A C m G A T A.and .A .G .T.A .A.T .C .C .T.G .27% .Built-in quality control: successful bisulfite conversion X .A .G .T .A .A.T/C .T.T G .A .A.Nucleotides added: .After bisulfite conversion: .Analyzed sequence: .Sequence to be analyzed:
  • 25. Sample to Insight Improving bisulfite conversion efficiency New progress in Pyrosequencing for epigentic applications 25 Superior bisulfite conversion. Following bisulfite conversion of genomic DNA using the EpiTect Fast DNA Bisulfite Kit or a kit from Supplier Z, unconverted genomic DNA and bisulfite converted DNA were coamplified and then sequenced by Pyrosequencing. EpiTect Fast Kits showed better results when a limited amount of DNA was analyzed (10 ng). DNA purification Bisulfite conversion Pre- amplification Assay design ssDNA preparation Pyro- sequencing EpiTect Fast Bisulfite conversion Complete conversion ensures reliable quantification of DNA methylation
  • 26. Sample to Insight Outline New progress in Pyrosequencing for epigentic applications 3 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
  • 27. Sample to Insight Outline New progress in Pyrosequencing for epigentic applications 27 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
  • 28. Sample to Insight Advanced Pyrosequencing Technology 28 Advanced Pyrosequencing addresses main bottlenecks in conventional Pyrosequencing New progress in Pyrosequencing for epigentic applications Insufficient read length Issues sequencing through homopolymer T sequences Challenging assay optimization Incomplete bisulfite conversion Tedious ssDNA preparation Genomic sequence TTCGCGATTGAATTCGAAAGACTCTCTTCGGCGGATGAAAGTCGTTATCTCTTGGTTGGTTGAGTTATAGTCTT
  • 29. Sample to Insight Effects of low level incomplete bisulfite conversion 29 Sample: unmethylated DNA C T C T C AgDNA G A C G A T T T T T T A G A T G A Tafter bis. ideally C Cm U Cm T C Bisulfite conversion PCR New progress in Pyrosequencing for epigentic applications
  • 30. Sample to Insight Effects of low level incomplete bisulfite conversion 30 Sample: unmethylated DNA C T C T C AgDNA G A C G A T T T T T T A G A T G A Tafter bis. ideally T T T T T A G A T G A T C T T T T A G A T G A T T T C T T A G A T G A T T T T T C A G A T G A T after bis. reality ~99.5% after bis. reality ~0.1% after bis. reality ~0.1% after bis. reality ~0.1% New progress in Pyrosequencing for epigentic applications After bisulfite conversion, some C nucleotides in some molecules remain unconverted. Conversion efficiency of EpiTect Kits is around 99.4–99.6%. Other kits show conversion efficiencies of 95–98%. Incomplete bisulfite conversion may affect Pyrosequencing results
  • 31. Sample to Insight Effects of low level incomplete bisulfite conversion 31 Sample: unmethylated DNA (conventional Pyrosequencing) C T C T C A T T T T T A gDNA G A C G A T G A T G A T C T T T T A G A T G A T T T C T T A G A T G A T T T T T C A G A T G A T after bis. reality ~99.5% after bis. reality ~0.1% after bis. reality ~0.1% after bis. reality ~0.1% T T T T T A G A T G A Tafter bis. ideally x% T A G A T C G A T single peak 5x peak wrong calculation peak deviations New progress in Pyrosequencing for epigentic applications
  • 32. Sample to Insight Multiple dispensations act as “catch up” in Advanced Pyrosequencing 32 Sample: unmethylated DNA (Advanced Pyrosequencing) 0% T A G A T C G T T T T T A G A T G A T C T T T T A G A T G A T T T C T T A G A T G A T T T T T C A G A T G A T A T single peak 5x peak +C +T less peak deviations → longer reads C T C T C AgDNA G A C G A T T T T T T A G A T G A Tafter bis. ideally after bis. reality ~99.5% after bis. reality ~0.1% after bis. reality ~0.1% after bis. reality ~0.1% correct calculation New progress in Pyrosequencing for epigentic applications
  • 33. Sample to Insight Incomplete bisulfite conversion may result in short read length New progress in Pyrosequencing for epigentic applications 33 Conventional Pyrosequencing analysis of the LOX gene locus PyroMarkQ24 trusted sequence
  • 34. Sample to Insight Incomplete bisulfite conversion may result in short read length New progress in Pyrosequencing for epigentic applications 34 Conventional Pyrosequencing analysis of the LOX gene locus PyroMarkQ24 trusted sequence uncertain sequence Conventional Pyrosequencing may show uncertain quantification results in long sequencing runs
  • 35. Sample to Insight Incomplete bisulfite conversion may result in short read length New progress in Pyrosequencing for epigentic applications 35 Conventional Pyrosequencing analysis of the LOX gene locus PyroMarkQ24 trusted sequence uncertain sequence Increasing peak deviation from expected signals in late sequence positions
  • 36. Sample to Insight Advanced Pyrosequencing increases read length and trust New progress in Pyrosequencing for epigentic applications 36 Conventional vs. Advanced Pyrosequencing analysis of the LOX gene locus PyroMarkQ24PyroMarkQ24Advanced trusted sequence uncertain sequence trusted sequence Advanced Pyrosequencing overcomes issues of low level incomplete bisulfite conversion
  • 37. Sample to Insight Issues with quantification of CpG methylation in homopolymers 37 Genomic sequence TTCGCGATTGAATTCGAAAGACTCTCTTCGGCGGATGAAAGTCGTTATCTCTTGGTTGGTTGAGTTATAGTCTT After bisulfite conversion TTYGYGATTGAATTYGAAAGATTTTTTTYGGYGGATGAAAGTYGTTATTTTTTGGTTGGTTGAGTTATAGTTTT 8xT if C is not methylated 7xT if C is methylated 6xT 4xT Histogram New progress in Pyrosequencing for epigentic applications Bisulfite conversion in DNA methylation analysis leads to occurrence of poly T stretches
  • 38. Sample to Insight Outline New progress in Pyrosequencing for epigentic applications 4 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
  • 39. Sample to Insight Improved quantification of CpG methylation in homopolymers 39 PyroMarkQ24PyroMarkQ24Advanced trusted sequence uncertain sequence trusted sequence New progress in Pyrosequencing for epigentic applications PyroMark Q24 Advanced enables reliable quantification of CpG methylation behind and even within a stretch of 8 T nucleotides
  • 40. Sample to Insight Advanced Pyrosequencing Technology 40 Advanced Pyrosequencing addresses main bottlenecks in conventional Pyrosequencing Advanced Pyrosequencing • Longer Pyrosequencing read length ◦ de novo sequencing ◦ DNA methylation analysis • Increased reliability in quantification of CpG sites and other sequence variations • Increased robustness of assays ◦ Weak sequencing primer binding ◦ Low level incomplete bisulfite conversion • Facilitates easier assay development New progress in Pyrosequencing for epigentic applications
  • 41. Sample to Insight Advanced Pyrosequencing Technology 41 Optimized software, reagents and instrument firmware working hand-in-hand Advanced Pyrosequencing • Longer Pyrosequencing read length ◦ De novo sequencing ◦ DNA methylation analysis • Increased reliability in quantification of CpG sites and other sequence variations • Increased robustness of assays ◦ Weak sequencing primer binding ◦ Low level incomplete bisulfite conversion • Facilitates easier assay development PyroMark Analysis SW optimized run setup files (e.g. additional dispensations) New progress in Pyrosequencing for epigentic applications
  • 42. Sample to Insight Advanced Pyrosequencing Technology 42 Optimized software, reagents and instrument firmware working hand-in-hand Advanced Pyrosequencing • Longer Pyrosequencing read length ◦ De novo sequencing ◦ DNA methylation analysis • Increased reliability in quantification of CpG sites and other sequence variations • Increased robustness of assays ◦ Weak sequencing primer binding ◦ Low level incomplete bisulfite conversion • Facilitates easier assay development PyroMark Analysis SW optimized run setup files (e.g. additional dispensations) PyroMark Advanced Reagents optimized nucleotide concentration New progress in Pyrosequencing for epigentic applications
  • 43. Sample to Insight Advanced Pyrosequencing Technology 43 Optimized software, reagents and instrument firmware working hand-in-hand Advanced Pyrosequencing • Longer Pyrosequencing read length ◦ De novo sequencing ◦ DNA methylation analysis • Increased reliability in quantification of CpG sites and other sequence variations • Increased robustness of assays ◦ Weak sequencing primer binding ◦ Low level incomplete bisulfite conversion • Facilitates easier assay development PyroMark Analysis SW optimized run setup files (e.g. additional dispensations) PyroMark Advanced Reagents optimized nucleotide concentration Instrument firmware optimized dispensation (e.g. double shots) New progress in Pyrosequencing for epigentic applications
  • 44. Sample to Insight Advanced Pyrosequencing Technology 44 Optimized software, reagents and instrument firmware working hand-in-hand Advanced Pyrosequencing • Longer Pyrosequencing read length ◦ De novo sequencing ◦ DNA methylation analysis • Increased reliability in quantification of CpG sites and other sequence variations • Increased robustness of assays ◦ Weak sequencing primer binding ◦ Low level incomplete bisulfite conversion • Facilitates easier assay development PyroMark Analysis SW optimized run setup files (e.g. additional dispensations) PyroMark Advanced Reagents optimized nucleotide concentration Instrument firmware optimized dispensation (e.g. double shots) PyroMark Analysis SW optimized analysis New progress in Pyrosequencing for epigentic applications
  • 45. Sample to Insight Advanced Pyrosequencing Technology 45 PyroMark Platforms offering Advanced Pyrosequencing Advanced Pyrosequencing is available on two PyroMark Platforms PyroMark Q24 Advanced PyroMark Q48 Autoprep New progress in Pyrosequencing for epigentic applications
  • 46. Sample to Insight Outline New progress in Pyrosequencing for epigentic applications 46 Challenges in Pyrosequencing DNA methylation analysis Pyrosequencing technology and workflow "Advanced Pyrosequencing" technology Introduction into the new PyroMark Q48 Autoprep
  • 47. Sample to Insight PyroMark Q48 Autoprep – Workflow New progress in Pyrosequencing for epigentic applications 47 Workflow comparison of available Pyrosequencing platforms Sample preparation Assay design PCR amplification ssDNA preparation Analysis • PyroMark Q24 Vacuum Workstation • PyroMark Q96 Vacuum Workstation • PyroMark Q24 • PyroMark Q24 Adv. • PyroMark Q96 ID • PyroMark Q48 AutoprepNEW ssDNA preparation and analysis PyroMark Q48 Autoprep: Simplified workflow combined with advanced Pyrosequencing
  • 48. Sample to Insight PyroMark Q48 Autoprep – Protocol New progress in Pyrosequencing for epigentic applications 48 Automatic template preparation fully integrated in PyroMark Q48 Autoprep workflow Load reagents, nucleotides, buffers Load PCR product & magnetic beads Insert Absorber strip & Disc Load Run files via USB or Ethernet Automatic template preparation Pyro- sequencing Analyze data
  • 49. Sample to Insight PyroMark Q48 Autoprep – Dimensions & Weight 49 390 mm (L, closed) 300mm(H) 560 mm (L, open) 250 mm (W) Small footprint and low weight (8.5 kg) New progress in Pyrosequencing for epigentic applications Small footprint (1/2 x PyroMark Q24) and low weight (1/3 x PyroMark Q24)
  • 50. Sample to Insight PyroMark Q48 Autoprep – SW User Interface New progress in Pyrosequencing for epigentic applications 50 Large and easy-to-use touch screen and intuitive instrument SW
  • 51. Sample to Insight PyroMark Q48 Autoprep offers highest degree of automation 51 Automated protocol steps along the Pyrosequencing workflow Load reagents, nucleotides, buffers Load PCR product & beads Manual template preparation with VPWS Anneal Seq- primer Pyro- sequencing Wash Cartridge & VPWS Load reagents, nucleotides, buffers Load PCR product & magnetic beads Automatic template preparation Anneal Seq- primer Pyro- sequencing PyroMark Q96 MD, Q96 ID, Q24, and Q24 Advanced PyroMark Q48 Autoprep • Multi-step pipette can be used for pipetting beads • Automatic pipetting system can be used manual automated manual/automated • Automatic dispensation of up to 3 Seq primers • Manual dispensation for 4 or more Seq primers • Automatic dispensation of 3 MPD* Mixes *MPD: Multiple Primer Dispensation Wash Cartridge New progress in Pyrosequencing for epigentic applications
  • 52. Sample to Insight Summary New progress in Pyrosequencing for epigentic applications 52 PyroMark Q48 Autoprep for “Advanced” Pyrosequencing in DNA methylation analysis • Cost-efficient tool for analyzing DNA methylation • Consecutive CpG and CpN sites analyzed independently in a single run • Improved quantification at any sequence position, even at homopolymer T sequences • Direct quality control of bisulfite conversion during the run • Fast processing: 48 samples in minutes • Automated Pyrosequencing through integrated template prep • Low sample input amounts: 1–10 ng • Highly accurate quantification: • LOD: 5% in methylation analysis PyroMark Q48 Autoprep: Simplified workflow combined with advanced Pyrosequencing for longer reads and more accurate methylation analysis
  • 53. Sample to Insight PyroMark Q48 Autoprep on the web 53 More information about the platform, accessories and reagents are available online New progress in Pyrosequencing for epigentic applications https://www.qiagen.com/de/shop/automated-solutions/sequencers/pyromark-q48-autoprep/ https://www.qiagen.com/de/shop/automated-solutions/sequencers/pyromark-q48-advanced-reagents/
  • 54. Sample to Insight PyroMark Q48 Autoprep Intro Page 54New progress in Pyrosequencing for epigentic applications https://www.qiagen.com/de/resources/technologies/pyrosequencing-resource-center/
  • 55. Sample to Insight Challenges in Pyrosequencing DNA methylation analysis 5 Current challenges observed during Pyrosequencing analysis Insufficient read length Issues sequencing through homopolymer T sequences Challenging assay optimization Incomplete bisulfite conversion Tedious ssDNA preparation Genomic sequence TTCGCGATTGAATTCGAAAGACTCTCTTCGGCGGATGAAAGTCGTTATCTCTTGGTTGGTTGAGTTATAGTCTT New progress in Pyrosequencing for epigentic applications