Nextgenerationsequencing 131218163555-phpapp02
- 2. Basics of NGS • Fragmentation of DNA into a Library of smaller fragments. • Libraries are then sequenced to be duplicated. • Bioinformatics piece together the small fragments to create a map and reference it to the human genome.
- 3. Differences between methods PCR PCR + SNP Next Gen aCGH arrays* Sequencing Detects aneuploidy no yes yes yes Detects gene defects yes yes yes yes Detects mitotic errors no yes no yes 1-2 month of Preparation yes yes no no Requires affected proband no no yes no Applicable to any case yes yes no yes * Karyomapping using BlueGnome
- 4. Next Generation Sequencing (NGS) Each region of the genome sequenced multiple times Fragmentation GTACCATAGGATACGACTTGCAGCGGCA ATATTGCGTATA Millions of short sequences produced CAGCGGCAGATGATTCGGGGATATTG AGGATACGACTTGCAGCGGCAGATGATT TGCGTATAGG Sequences are compared to the known human CAGATGATTCGGGGATATTGCGTA ACCATAGGATACGACTTGCAGCGGC genome TAGAGTACCATAGGATACGACTTGCAACGGCAGATGATTCGGGGATATTGCGTATAGGCTA Known sequence (CFTR gene chromosome 7) Mutations identified and amount of DNA (aneuploidy) revealed
- 5. Sample Cost 1 819.9811 2 435.7911 3 307.7278 4 243.6961 5 205.2771 6 179.6644 7 161.3697 8 147.6486 9 136.9766 10 128.4391 11 121.4538 12 115.6328 54 65.83035 55 65.57164 56 65.32216 57 65.08144 58 64.84902 59 64.62448 60 64.40742 61 64.19748 62 63.99432 63 63.7976 64 63.60703 900 800 700 600 500 400 300 200 100 0 Chart Title Multiplexing 1 3 5 7 9 111315171921232527293133353739414345474951535557596163 Cost Number of Samples Number of samples Price
- 7. PGD for aneuploidy and gene defects using NGS: Method • With WGA only <10% is sequenced • Solution: enrich the sequences of interest prior to NGS. An aliquot of the WGA product was used to amplify by PCR the CF ΔF508 mutation site on a cell line • The gene was sequenced with a x30 depth • All cells were found to be euploid and homozygotic for ΔF508. • Conclusion: useful for DIRECT mutation analysis and aneuploid D Wells, KKaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (submitted) Rapid genetic analysis of single cells using a next generation sequencing methodology: application to human embryos reveals aneuploidy and DNA sequence mutations
- 8. PGD for aneuploidy and gene defects using NGS: Results Cystic fibrosis gene (CFTR) DF508 mutation sequenced in a single blastomere D Wells, KKaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (submitted) Rapid genetic analysis of single cells using a next generation sequencing methodology: application to human embryos reveals aneuploidy and DNA sequence mutations
- 9. • 38 blastocysts from 13 couples with structural chromosomal abnormalities • Whole genome sequence by Illumina HiSeq2000 • Results: 0.07x depth with average 5.5% genome coverage • 26 (68%) blastocysts euploid, 6 (16%) aneuploid, 4 (11%) unbalanced only, 2 (5%) unbalanced and aneuploid • Highly concordant with SNP array results Yin et al (2013) Biol Reprod 88, 69
- 10. • 21 blastocysts from couples at risk of cystic fibrosis and one of Walker-Warburg syndrome • Whole genome amplification was followed by targeted Taqman amplification of mutation site, sequenced by Ion Torrent and 8 barcoded samples per chip • Real time qPCR used for 24 chromosome aneuploidy testing • 17 (81%) blastocysts euploid, 4 (19%) aneuploid • 100% concordance of mutation status with STR and minisequencing Treff et al (2013) Fertility and Sterility 99, 1377-1384
- 11. PGD for aneuploidy and gene defects using NGS: Results • A homozygotic cell line for ΔF508 was used • The gene was sequenced with a x30 depth • All cells were found to be euploid and homozygotic for ΔF508. • Conclusion: this method can be use for DIRECT mutation analysis and aneuploid • Other methods such as SNPs can only do haplotype analysis D Wells, KKaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (submitted) Rapid genetic analysis of single cells using a next generation sequencing methodology: application to human embryos reveals aneuploidy and DNA sequence mutations
- 12. Summary Next Gene Sequencing Current Advantages: - Same resolution for chromosome abnormalities than aCGH - Detection of mitochondrial DNA: potentially useful - Simultaneous detection of aneuploidy and gene defects Future advantages: - Whole gene sequencing
- 13. Vendors of Next Generation Sequencing Company Models Benchtop Chemistry Roche (454) GS FLX/GS Junior Yes Pyrosequencing Illumina MiSeq/HiSeq/Ge nome Analyzer Yes Sequencing by synthesis Ion Torrent PGM/Proton/SO LiD 4 Yes Semiconductor sequencing PACBio PACBIO RS II No SMRT technology
- 14. Vendors of Next Generation Sequencing or Equivalent Company Models Benchtop Chemistry Oxford Nanopore Technologies GridION System/MinION No Nanopore Sensing RainDance Technologies ThunderStorm System/RDT 1000 Yes High-Throughput/Low- Med Targeted Sequencing Helicos (Bankrupt) N/A N/A N/A Complete Genomics Proprietary Sequencing N/A Proprietary (Long Fragment Reads?)
- 15. Ion Torrent for Aneuploidy Validation • 10 single cells from cell lines with known aneuploidies • 40 embryo cells (previously diagnosed using aCGH) • Calculated amount of sequence from each chromosome • 50/50 (100%) of samples gave a result • 48 separate aneuploidies detected • 100% diagnostic accuracy (in a blinded experiment)
- 16. First baby born from NGS First NGS baby: David Levy A collaboration of Reprogenetics-US and Reprogenetics-UK (Dagan Wells) and Main Line Fertility (Dr. Glassner)
- 17. Helpful tools for NGS • https://genohub.com/next-gen-sequencing-services/