philogenetic tree
Download as PPTX, PDF11 likes3,559 views
1. Phylogenetic trees show the evolutionary relationships among species or other taxonomic groups based on similarities and differences in physical or genetic characteristics. 2. Early representations of phylogenetic trees date back to 1840, but Charles Darwin popularized the concept of an evolutionary "tree" in his 1859 book On the Origin of Species. 3. There are two main types of phylogenetic trees - rooted trees which make assumptions about a common ancestor, and unrooted trees which do not.
philogenetic tree
- 1. 1
- 3. Contents History Parts of the phylogenetic Tree How to read a phylogenetic Tree Types of Phylogenetic Tree Construction of Phylogenetic Tree A search engine for phylogenetic tree databases Limitations Of Phylogenetic tree Applications 2
- 4. What is phylogenetic tree? • Dendogram. • Branching diagram. • Showing the inferred evolutionary relationship. 3
- 6. History: • Early representations of "branching" phylogenetic trees include a "paleontological chart" showing the geological relationships among plants and animals in the book Elementary Geology, by Edward Hitchcock in 1840. • Charles Darwin in 1859 also produced one of the first illustrations and crucially popularized the notion of an evolutionary "tree" in his seminal book The Origin of Species. 5
- 7. Parts of the phylogenetic Tree • Represent current day species, groups of descendant taxa.leaves • Represent the common ancestor of those descendants.Nodes • The edges connect nodes to nodes and nodes to leaves.Edges Leaves Nodes Edges Fig: phylogenetic Tree 6
- 8. How to read a phylogenetic Tree The Horizonal dimension gives the amount of genetic change. The bar at the bottom of the figure provides a scale for this. The vertical dimension in this figure has no meaning Amount Of change The units of branch length are usually nucleotide substitutions per site 7
- 9. Types of Phylogenetic Tree Rooted Tree: 1. Make inferences about the most common ancestor of the leaves or branches of the tree. 2. Most commonly the root is referred to as an “outgroup”. Unrooted Tree: 1. Make an illustration about the leaves or branches, 2. But not make assumption regarding a common ancestor. 8
- 10. The Bifurcating Tree A tree that bifurcates has a maximum of 2 descendants arising from each of the interior nodes. 9
- 11. The Multi-furcating Tree A tree that multi-furcates has multiple descendants arising from each of the interior nodes. 10
- 12. Construction of Phylogenetic Tree: Phylogenetic Tree Character based methods Distance based methods 11
- 13. Character based methods: Use the aligned characters, such as DNA or protein sequences, directly during tree inference Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA Species C TTCACTAGACCTGTGGTCCA Species D TTGACCAGACCTGTGGTCCG Species E TTGACCAGTTCTCTAGTTCG Example: 1. Parsimony 2. Maximum likelihood 12
- 14. Distance based methods: Transform the sequence data into pairwise distances and then use the matrix during tree building A B C D E Species A ---- 0.20 0.50 0.45 0.40 Species B 0.23 ---- 0.40 0.55 0.50 Species C 0.87 0.59 ---- 0.15 0.40 Species D 0.73 1.12 0.17 ---- 0.25 Species E 0.59 0.89 0.61 0.31 ---- Example: 1. UPGMA 2. Neighbor-joining 13
- 15. Computational Method: Data type Distance Charecter Parsimony Maximum Likelihood Minumum Evulation list Square. Upgma neighbor-joining 14
- 16. UPGMA: Abbreviation of “Unweighted Pair Group Method with Arithmetic Mean”. Originally developed for numeric taxonomy in 1958 by Sokal and Michener. Simplest algorithm for tree construction, so it's fast!. 15
- 17. Example of UPGMA New average Distance between C and AB is: C to AB = (60 + 50) / 2 = 55 Distance between D and AB is: D to AB = (100 + 90) / 2 = 95 Distance between E and AB is: E to AB = (90 + 80) / 2 = 85 13 16
- 18. A search engine for phylogenetic tree databases TreeBASE (Piel, Donoghue, & Sanderson, 1996) 17
- 19. TreeBASE capabilities • Search by 1. taxon 2. author 3. citation 4. study accession number 5. matrix accession number 6. structure (topology) • Tree surfing 18
- 20. TreeBASE limitations • Taxonomic name consistency • Querying 1.Few options 2.Does not exploit classification 1.Can’t identify ancestors/descendants • Visualization • Clustering and aggregation (supertrees) 19
- 21. PhyloFinder 20
- 22. • A search engine for tree databases 1. Not a database • Allows powerful phylogenetic queries 1. Handles synonymous taxonomic names (via TBMap) 2. Handles misspellings. 3. Exploits taxonomic classification 4. Offers precise options for identifying different types of subtrees and metrics for identifying similar trees. 5. Provides a visualization tool with links to GenBank and TBMap. • Fast 1. Efficient storage and filtering PhyloFinder capabilities 21
- 23. Limitations Of Phylogenetic tree 1. Inaccurate evolutionary history 2. The data used is little noisy 3. Problem facing in single type of character basing 4. Homoplasy would be unlikely from natural selection 5. Length of branch doesn’t mean the timing passed 22
- 24. Applications: • Find out the evolutionary history . • Can measure phylogenetic diversity using phylogenetic trees . • Search for natural products . • Infectious bacteria and viruses to trace their evolutionary histories. 23
- 25. 24
- 26. 25