precisionFDA
Download as PPTX, PDF0 likes634 views
The document outlines the collaborative work of the FDA's Office of Health Informatics on Next Generation Sequencing (NGS)-based genetic testing, detailing both upstream processes such as clinician orders and sample collection, and downstream processes involving outcome discussions. It emphasizes the importance of analytical benchmarking to assess the reproducibility and accuracy of tests, as well as the support for community engagement via the PrecisionFDA platform. Additionally, it highlights the collaborative efforts of over 450 organizations in advancing genetic testing technologies.
precisionFDA
- 1. Joint work with many colleagues at FDA precision.fda.gov | precisionFDA@fda.hhs.gov | @precisionFDA Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics Officer Director, FDA’s Office of Health Informatics David Litwack, PhD Policy Advisor FDA’s Center for Devices and Radiological Health Elaine R. Johanson Deputy, FDA Chief Health Informatics Officer Deputy Director, FDA’s Office of Health Informatics
- 3. Genetic test (upstream) Clinician orders test/services for patient, collects sample Sample preparation and sequencing Core processing (Mapping, Variation Calling) Special processing (Annotation, Filtering, Interpretation) + (downstream) Clinician discusses outcome with patient NGS-based Genetic Test (end-to-end product)
- 4. Initial Focus Genotype Location 9: C → G mutation ... File with variants (VCF) " You are at risk for X outcome. " Report Predicted Outcome Analytical Benchmark Clinical Benchmark
- 5. Initial Focus – Analytic Benchmarking •Assess reproducibility of a test •Assess accuracy using reference samples •Assess agreement with other methods •Assess test performance on synthetic data
- 6. Features Private or community areas Data Apps Comparisons Notes
- 24. >930 members from >450 organizations
- 26. Thank You! precision.fda.gov | precisionFDA@fda.hhs.gov | @precisionFDA
- 27. Backup Slides precision.fda.gov | precisionFDA@fda.hhs.gov | @precisionFDA
- 29. We are all unique … AGCATCGATGCAGAAGATTACAACATAAAAAGATTACACGCGATCCGCTC … … AGCATCGATGCATAAGATTACAAGATAAAAAGATTACACGCGATCCGCTC … … AGCATCGATGCATAAGATTACAACATAAAAAGATTACATGCGATCCGCTC … … AGCATCGCTGCAGAAGATTACAACATAAAAAGATTACATGCGATCCGCTC … reference David Taha Elaine
- 33. Add new Feature (Discussion) New Feature
Editor's Notes
- #2: Thank you for having me here today…
- #3: Help researchers evaluate next generation sequencing (NGS) technologies that will be used in diagnostic tests
- #27: Thank you for having me here today…
- #28: Thank you for having me here today…
- #32: PrecisionFDA solution is cost effective, scalable (or elastic), sustainable, and computationally advanced… Image source: http://adsoftheworld.com/media/outdoor/denver_water_channel?size=_original
- #33: Additionally, precisionFDA offers community members the appropriate and auditable levels of security and governance control. For example, the platform will address HIPAA and HITECH, will conform to clinical compliance capabilities established by the College of American Pathologists (CAP), and will protect submitters’ intellectual property, while enabling collaborative interaction within the community. SOC 1,3 controls safeguarding customer data ISO27001 a widely-adopted global security standard that outlines the requirements for information security management systems ISO9001 a global standard for managing the quality of products and services FISMA Federal Information Security Management Act HIPAA U.S. Health Insurance Portability and Accountability Act Cloud Platform for Evaluating NGS-Based Diagnostic Test Pipelines FedRAMP a government-wide program that provides a standardized approach to security assessment, authorization, and continuous monitoring for cloud products and services dbGaP security best-practices established by the NCBI for data sets included in its Database of Genotypes and Phenotypes (dbGaP), such as The Cancer Genome Atlas GCP/GLP Good Clinical Practices (“GCP”), Good Laboratory Practices (“GLP”), and 21 C.F.R. Part 11 are used by organizations who use and submit genomic data to the United States Food and Drug Administration. CLIA Clinical Laboratory Improvement Amendments of 1988 establish quality standards for all laboratory testing to ensure the validity and reliability and timeliness of laboratory examinations and procedures, handling of specimens, and reporting of results. CAP The College of American Pathologists publishes a comprehensive set of accreditation checklists for laboratory improvement based on more than 50 years of insight and pathology expertise.