![© 2004 Humana Press Inc.
999 Riverview Drive, Suite 208
Totowa, New Jersey 07512
www.humanapress.com
All rights reserved. No part of this book may be reproduced, stored in a retrieval system, or transmitted in
any form or by any means, electronic, mechanical, photocopying, microfilming, recording, or otherwise
without written permission from the Publisher. Methods in Molecular BiologyTM
is a trademark of The
Humana Press Inc.
All papers, comments, opinions, conclusions, or recommendations are those of the author(s), and do not
necessarily reflect the views of the publisher.
This publication is printed on acid-free paper. '
ANSI Z39.48-1984 (American Standards Institute)
Permanence of Paper for Printed Library Materials.
Cover design by Patricia F. Cleary.
For additional copies, pricing for bulk purchases, and/or information about other Humana titles, contact
Humana at the above address or at any of the following numbers: Tel.: 973-256-1699; Fax: 973-256-8341;
E-mail: humana@humanapr.com; or visit our Website: www.humanapress.com
Photocopy Authorization Policy:
Authorization to photocopy items for internal or personal use, or the internal or personal use of specific
clients, is granted by Humana Press Inc., provided that the base fee of US $25.00 per copy is paid directly
to the Copyright Clearance Center at 222 Rosewood Drive, Danvers, MA 01923. For those organizations
that have been granted a photocopy license from the CCC, a separate system of payment has been arranged
and is acceptable to Humana Press Inc. The fee code for users of the Transactional Reporting Service is:
[1-58829-117-0/04 $25.00].
Printed in the United States of America. 10 9 8 7 6 5 4 3 2 1
E-ISBN 1-59259-766-1
Library of Congress Cataloging-in-Publication Data
Public health microbiology : methods and protocols / edited by John F.T. Spencer, Alicia L. Ragout de
Spencer.
p. ; cm. -- (Methods in molecular biology, ISSN 1064-3745 ; v. 268)
Includes bibliographical references and index.
ISBN 1-58829-117-0 (alk. paper)
1. Diagnostic microbiology. [DNLM: 1. Environmental Microbiology. 2. Microbiological Techniques.
QW 55 P976 2004] I. Spencer, J. F. T. II. Ragout de Spencer, Alicia L. III. Methods in molecular biology
(Clifton, N.J.) ;v. 268.
QR67.P83 2004
616.9'041--dc22
2003025016](https://image.slidesharecdn.com/2163603-250516031204-710a5b06/85/Public-Health-Microbiology-Methods-And-Protocols-1st-Edition-Rustam-I-Aminov-9-320.jpg)
![Tetracyline Resistance Genes 5
2. Materials
1. Depending on the type of samples used for PCR analysis, genomic DNA can be isolated
using the kits from Mo Bio Laboratories (Solana Beach, CA, www.mobio.com):
a. From tissues, bones, and cell cultures: UltraClean™ Tissue DNA Kit.
b. From whole blood: UltraClean BloodSpin Kit or UltraClean™ Blood DNA Kit.
c. From plant tissue: UltraClean Plant DNA Kit.
d. From soil samples: UltraClean Soil DNA Kit.
e. From water and urine samples: UltraClean Water DNA Kit.
f. From fecal samples: UltraClean DRY Soil DNA Kit for fecal samples.
g. From microorganisms: UltraClean Microbial DNA Kit.
h. From forensic samples: UltraClean Forensic DNA Kit.
Additional equipment for genomic DNA isolation using these kits includes a vortex with
a flat-bed pan for processing of multiple samples and a microcentrifuge.
2. PCR primers for detection of the RPP genes (Table 1) or tetracycline efflux pump genes
of Gram-negative bacteria (TEPGNB) (Table 2) are synthesized commercially on a
50-nmol scale (high performance liquid chromatography [HPLC] purified). For PCR-
denaturing gradient gel electrophoresis (DGGE) analysis, the forward or reverse primer
is synthesized with a GC clamp (CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGC
ACGGGGGG) attached to the 5'-end.
3. Takara Ex Taq™ DNA polymerase kit (Takara Shuzo, Japan).
4. Agarose gel electrophoresis buffer: 45 mM tris-borate, 1 mM EDTA, pH 8.0. This buffer
should not require pH adjustment. The 10X stock is stored at room temperature and is
used at a working strength of 0.5X.
5. Agarose gel sample loading buffer (6X): 40% (w/v) sucrose in water and 0.5% (w/v)
Orange G (Sigma). This dye migrates as a DNA fragment of approx 50 bp.
6. Agarose gel stain solution: 0.5 mg/L (w/v) ethidium bromide in water. Alternatively, for
faster results, the fluorescent dye GelStarº (FMC Bioproducts, Rockland, ME) can be
incorporated into the agarose gels at a 1:10,000 dilution (v/v).
7. 100-bp DNA Ladder (Promega).
8. DGGE buffer: 40 mM Tris-acetate, 1 mM EDTA, pH 8.0. The 50X stock solution is
stored at room temperature and is used at a working strength of 1X.
9. DGGE sample loading buffer: 0.05% bromophenol blue, 0.05% xylene cyanol, and 70%
glycerol in sterile nanopure water.
10. GelBond PAG gel support films (FMC Bioproducts).
11. Freshly prepared silver stain solution: 0.1% AgNO3 in ddH2O.
12. Developing solution: 0.01% NaBH4 and 0.4% v/v formaldehyde in 1.5% w/v NaOH.
13. QuantiTect SYBR Green PCR kit (Qiagen, Germany) or other high-sensitivity real-time
PCR kits based on quantification of amplified DNA by binding the SYBR Green fluores-
cent dye.
14. Control strains to generate the standard curves for quantification of tetracycline resis-
tance genes in the environmental samples or for determining the copy number of tetracy-
cline resistance genes in microbial cells (Table 3). These strains are also used as controls
in PCR and PCR-DGGE.
15 QIAquick Gel Extraction Kit (Qiagen).](https://image.slidesharecdn.com/2163603-250516031204-710a5b06/85/Public-Health-Microbiology-Methods-And-Protocols-1st-Edition-Rustam-I-Aminov-25-320.jpg)
![6 Aminov et al.
Table 1
PCR Primers Targeting the Ribosomal Protection Protein Genes
PCR annealing
Class Sequence temperature Amplicon size
Primer pair targeted 5'3' (°C) (bp)
TetB/P-FW TetB P AAAACTTATTATATTATAGTG 46 169
TetB/P-RV TGGAGTATCAATAATATTCAC
TetM-FW TetM ACAGAAAGCTTATTATATAAC 55 171
TetM-RV TGGCGTGTCTATGATGTTCAC
TetO-FW TetO ACGGARAGTTTATTGTATACC 60 171
TetO-RV TGGCGTATCTATAATGTTGAC
TetQ-FW TetQ AGAATCTGCTGTTTGCCAGTG 63 169
TetQ-RV CGGAGTGTCAATGATATTGCA
TetS-FW TetS GAAAGCTTACTATACAGTAGC 50 169
TetS-RV AGGAGTATCTACAATATTTAC
TetT-FW TetT AAGGTTTATTATATAAAAGTG 46 169
TetT-RV AGGTGTATCTATGATATTTAC
TetW-FW TetW GAGAGCCTGCTATATGCCAGC 64 168
TetW-RV GGGCGTATCCACAATGTTAAC
Tet32-FW Tet32 TCGACCTACAGCGTGTTTACC 62 277
Tet32-RV CTAATAGTTCATCGCTTCCGG
3. Methods
3.1 Genomic DNA Isolation
Genomic DNA of sufficient purity for PCR amplification can be isolated using the
corresponding kits from Mo Bio (see Materials and Notes 1 and 2). Alternatively, if
there are difficulties in obtaining these kits, total genomic DNA can be isolated using
the following protocol:
1. To 200 mg of material (microbial or cell culture pellet, soil, plant tissue, or other sample),
in a 2-mL screw-top cryogen storage propylene plastic tube, add 0.1 g zirconium beads
(0.1-mm diameter), 700 μL lysis solution (50 mM Tris-HCl, 10 mM EDTA, 2% sodium
dodecyl sulfate [SDS], pH 8.0), and 700 μL Tris-buffered phenol, pH 8.0.
2. Shake the tubes (“homogenize” setting on a Mini Bead-Beater-8» [Biospec Products,
Bartlesville, OK]) for 1 min and chill on ice for 2 min.
3. Repeat the previous step twice.
4. Centrifuge the tubes in a tabletop centrifuge at 10,000g for 5 min.
5. Transfer the upper water phase to a 2-mL microcentrifuge tube and extract with phenol-
chloroform-isoamyl alcohol (25:24:1) twice or until the interphase is clear.
6. Precipitate with ethanol, wash with 70% ethanol, dry, and dissolve in 50 μL of TE buffer
(10 mM Tris-HCl, 1 mM EDTA, pH 8.0) with 10 μg/mL RNaseA.
3.2. Conventional PCR Detection of RPP Genes
1. On ice, combine the following components of the PCR mixture in a 200-μL thin-walled
PCR tube: 25 pmol of each primer, 1X ExTaq reaction buffer, 100 μM of each](https://image.slidesharecdn.com/2163603-250516031204-710a5b06/85/Public-Health-Microbiology-Methods-And-Protocols-1st-Edition-Rustam-I-Aminov-26-320.jpg)
![Antimicrobial Resistance Genes in S. enterica 17
tance (R)-type ACSSuT are often associated with the presence of two class 1 integrons,
containing gene cassettes of 1.0 and 1.2 kbp. The former gene cassette contains ant(3')-
1a, conferring resistance to aminoglycoside antibiotics, streptomycin, and specti-
nomycin; the 1.2-kbp gene cassette contains a blaPSE-1 gene, encoding a `-lactamase
enzyme conferring resistance to `-lactam antibiotics including ampicillin. Fine genetic
mapping studies have located these structures to the chromosome of S. Typhimurium
DT104 within a highly conserved 10-kbp XbaI DNA fragment (13-15). This chromo-
somal region has been described as a multiresistant gene cluster consisting of two
integrons flanking an R-plasmid (16). Molecular analysis of antimicrobial resistance
indicated that the same gene cassettes accounted for MDR-DT104 isolates from diverse
geographical regions (14,17-20).
The inserted gene cassettes described above may be recovered by DNA amplifica-
tion using the previously characterized Int1 F and Int1 R primer set (2) (Table 1). In a
standard polymerase chain reaction (PCR), the complete amplification of any inserted
gene cassette(s) within a class 1 integron structure can be successfully achieved. A
typical result, for a DT104 isolate of R-type ACSSuT, is shown in Fig. 2 (lane 1). Two
intensely ethidium bromide-stained DNA fragments corresponding to the 1.0- and 1.2-
kbp amplicons outlined previously are detected after conventional agarose gel electro-
phoresis. These structures accounted for three (ASSu) of the five resistance traits
normally associated with MDR-DT104 isolates (see below). Larger amplicons (approx
1.6 kbp [Fig. 2, lane 2]) have also been identified in S. Typhimurium isolates includ-
ing phage types DT170a and -193. The amplicon shown in Fig. 2 (lane 2) contained
two resistance genes, dfrI and aadA, fused in a classical head-to-tail fashion (15).
Chloramphenicol acetyl transferases (CATs) are the enzymes most frequently
reaponsible for resistance to chloramphenicol. However nonenzymatic mechanisms
have also been described including efflux pumps, membrane transporter impermeabil-
ity, and ribosomal modifications. A cmlA gene found in MDR-DT104 and recently
described by Briggs and Fratamico (14) encodes an exporter enzyme and not the more
common acetyltransferase. The floR gene, which belongs to the MDR efflux pump
family of proteins, was described (16) and is responsible for cross-resistance to
chloramphenicol and florfenicol. The floR gene is located downstream of the integron
containing the ant (3)-1a gene cassette. Distal to the floR gene are the tetRA genes
(class G tetracyclines). Tetracycline resistance arises as a result of the production of
an efflux pump. These resistance determinants are located on the integrated R-plas-
mid, outlined above.
The R-type pattern ACSSuT can therefore be accounted for by the presence of this
conserved MDR locus on a 10-kpb Xba1 digested DNA fragment. However, addi-
tional resistances to trimethoprim and fluoroquinolones are now being encountered in
MDR-DT104 isolates (15). Trimethoprim resistance can arise owing to the presence
of a nonconjugative but mobilizable 4.6-MDa plasmid, which can also encode resis-
tance to sulphonamides (SuTp). Genes associated with trimethoprim resistance (includ-
ing those of the dfr gene family), expressing a dihydrofolate reductase enzyme, have
also been found in integrons (15). Considering the nature of integrons, this presents an
opportunity for trimethoprim resistance determinants to become chromosomally inte-](https://image.slidesharecdn.com/2163603-250516031204-710a5b06/85/Public-Health-Microbiology-Methods-And-Protocols-1st-Edition-Rustam-I-Aminov-36-320.jpg)
![Antimicrobial Resistance Genes in S. enterica 25
The solutions required are as follows:
1. Hybridization buffer: 5X SSC (1:4 dilution of 20X SSC), 1% blocking solution (from
kit), 0.1% (w/v) N-lauroyl-sarcosine, 0.02% (w/v) SDS.
2. Wash solution A: 2X SSC, 0.1% (w/v) SDS (for 500 mL combine 50 mL 20X SSC, 450 mL
sterile distilled water, and 0.5 g SDS).
3. Wash solution B: 0.1% SSC, 0.1% (w/v) SDS (for 500 mL combine 2.5 mL 20X SSC,
497.5 mL sterile distilled water, and 0.5 g SDS).
4. Buffer 1: maleic acid buffer; 0.1 M maleic acid, 0.15 M NaCl; adjust pH with NaOH to
pH 7.5 (see Note 4).
5. Buffer 2: blocking buffer; dilute 10X blocking solution in buffer 1 (maleic acid buffer) to
1X final concentration.
6. Buffer 3: detection buffer; 0.1 M Tris-HCl, pH 9.5, 0.1 M NaCl, 50 mM MgCl2.
3. Methods
3.1. DNA Extraction
This extraction method is a modification of the procedure described by Versalovic
et al. (23).
1. Grow bacterial cells overnight in 5 mL TSB at 37°C and then pellet by centrifugation at
15,000g for 2 min.
2. Wash the cell pellet with 1 mL of 1 M NaCl followed by 1 mL TE solution (50 mM Tris-
HCl [pH 8.0], 50 mM EDTA) and then resuspend in 0.7 mL TE solution (see Note 5).
Transfer the cells to 1.5-mL Eppendorf tubes.
3. Add 100 μL lysozyme (2 mg/mL) to the cells and incubate at 37°C for 30 min. To com-
plete lysis, add 30 μL of 20% (w/v) SDS and incubate at 65°C for 10 min. This is fol-
lowed by the addition of 60 μL proteinase K (10 mg/mL) and returning the cells to 37°C
for 1 h (see Note 6)
4. The protein must then be extracted from this crude nucleic acid preparation by perform-
ing two phenol/chloroform extractions: Add 800 μL phenol/chloroform/isoamylalcohol
(25:24:1) to the lysate mixture and invert the tubes vigorously for 5 min. Centrifuge the
samples for 5 min at 20,000g and then transfer the top aqueous phase (containing the
DNA) to a new 1.5-mL tube. Repeat the phenol/chloroform extraction on the aqueous
phase.
5. After the second extraction, precipitate the DNA by adding a 1:10 volume of 3 M ammo-
nium acetate and cold 100% ethanol to fill the 1.5-mL Eppendorf tube and place at –20°C
to precipitate overnight (see Note 7).
6. After precipitation, centrifuge the DNA samples at 18,000g for 30 min at 4°C. Wash the
DNA pellet with 70% ethanol, remove all ethanol with a pipet tip, and dry the DNA by
leaving the tubes open on the bench for 5 min. Finally, resuspend in 200 μL 1X TE
solution.
3.2. Polymerase Chain Reaction
3.2.1. Integron and Gene Cassette Amplification
1. Amplification of gene cassettes located between the 5' conserved segment and the 3' con-
served segment of class I integrons is performed in a final volume of 50 μL.](https://image.slidesharecdn.com/2163603-250516031204-710a5b06/85/Public-Health-Microbiology-Methods-And-Protocols-1st-Edition-Rustam-I-Aminov-44-320.jpg)
Public Health Microbiology Methods And Protocols 1st Edition Rustam I Aminov
- 1. Public Health Microbiology Methods And Protocols 1st Edition Rustam I Aminov download https://ebookbell.com/product/public-health-microbiology-methods- and-protocols-1st-edition-rustam-i-aminov-4327206 Explore and download more ebooks at ebookbell.com
- 2. Here are some recommended products that we believe you will be interested in. You can click the link to download. Handbook Of Media For Clinical And Public Health Microbiology 1st Edition Ronald M Atlas https://ebookbell.com/product/handbook-of-media-for-clinical-and- public-health-microbiology-1st-edition-ronald-m-atlas-4747908 Application And Integration Of Omicspowered Diagnostics In Clinical And Public Health Microbiology 1st Ed 2021 Jacob Morangilad Editor https://ebookbell.com/product/application-and-integration-of- omicspowered-diagnostics-in-clinical-and-public-health- microbiology-1st-ed-2021-jacob-morangilad-editor-30396674 Probiotics And Child Gastrointestinal Health Advances In Microbiology Infectious Diseases And Public Health Volume 10 1st Ed Stefano Guandalini https://ebookbell.com/product/probiotics-and-child-gastrointestinal- health-advances-in-microbiology-infectious-diseases-and-public-health- volume-10-1st-ed-stefano-guandalini-10486518 Advances In Microbiology Infectious Diseases And Public Health Volume 17 Gianfranco Donelli https://ebookbell.com/product/advances-in-microbiology-infectious- diseases-and-public-health-volume-17-gianfranco-donelli-50441628
- 3. Advances In Microbiology Infectious Diseases And Public Health Volume 14 1st Ed Gianfranco Donelli https://ebookbell.com/product/advances-in-microbiology-infectious- diseases-and-public-health-volume-14-1st-ed-gianfranco- donelli-22501826 Advances In Microbiology Infectious Diseases And Public Health Volume 15 Gianfranco Donelli https://ebookbell.com/product/advances-in-microbiology-infectious- diseases-and-public-health-volume-15-gianfranco-donelli-28831926 Advances In Microbiology Infectious Diseases And Public Healthvolume 16 Gianfranco Donelli https://ebookbell.com/product/advances-in-microbiology-infectious- diseases-and-public-healthvolume-16-gianfranco-donelli-43056498 Advances In Microbiology Infectious Diseases And Public Health Volume 1 1st Edition Gianfranco Donelli Eds https://ebookbell.com/product/advances-in-microbiology-infectious- diseases-and-public-health-volume-1-1st-edition-gianfranco-donelli- eds-5482886 Advances In Microbiology Infectious Diseases And Public Health Volume 2 1st Edition Gianfranco Donelli Eds https://ebookbell.com/product/advances-in-microbiology-infectious- diseases-and-public-health-volume-2-1st-edition-gianfranco-donelli- eds-5483178
- 7. M E T H O D S I N M O L E C U L A R B I O L O G Y™ John M. Walker, SERIES EDITOR 293. Laser Capture Microdissection: Methods and Protocols, edited by Graeme I. Murray and Stephanie Curran, 2005 292. DNA Viruses: Methods and Protocols, edited by Paul M. Lieberman, 2005 291. Molecular Toxicology Protocols, edited by Phouthone Keohavong and Stephen G. Grant, 2005 290. Basic Cell Culture, Third Edition, edited by Cheryl D. Helgason and Cindy Miller, 2005 289. Epidermal Cells, Methods and Applications, edited by Kursad Turksen, 2004 288. Oligonucleotide Synthesis, Methods and Appli- cations, edited by Piet Herdewijn, 2004 287. Epigenetics Protocols, edited by Trygve O. Tollefsbol, 2004 286. Transgenic Plants: Methods and Protocols, edited by Leandro Peña, 2004 285. Cell Cycle Control and Dysregulation Protocols: Cyclins, Cyclin-Dependent Kinases, and Other Factors, edited by Antonio Giordano and Gaetano Romano, 2004 284. Signal Transduction Protocols, Second Edition, edited by Robert C. Dickson and Michael D. Mendenhall, 2004 283. Bioconjugation Protocols, edited by Christof M. Niemeyer, 2004 282. Apoptosis Methods and Protocols, edited by Hugh J. M. Brady, 2004 281. Checkpoint Controls and Cancer, Volume 2: Activation and Regulation Protocols, edited by Axel H. Schönthal, 2004 280. Checkpoint Controls and Cancer, Volume 1: Reviews and Model Systems, edited by Axel H. Schönthal, 2004 279. Nitric Oxide Protocols, Second Edition, edited by Aviv Hassid, 2004 278. Protein NMR Techniques, Second Edition, edited by A. Kristina Downing, 2004 277. Trinucleotide Repeat Protocols, edited by Yoshinori Kohwi, 2004 276. Capillary Electrophoresis of Proteins and Peptides, edited by Mark A. Strege and Avinash L. Lagu, 2004 275. Chemoinformatics, edited by Jürgen Bajorath, 2004 274. Photosynthesis Research Protocols, edited by Robert Carpentier, 2004 273. Platelets and Megakaryocytes, Volume 2: Perspectives and Techniques, edited by Jonathan M. Gibbins and Martyn P. Mahaut- Smith, 2004 272. Platelets and Megakaryocytes, Volume 1: Functional Assays, edited by Jonathan M. Gibbins and Martyn P. Mahaut-Smith, 2004 271. B Cell Protocols, edited by Hua Gu and Klaus Rajewsky, 2004 270. Parasite Genomics Protocols, edited by Sara E. Melville, 2004 269. Vaccina Virus and Poxvirology: Methods and Protocols,edited by Stuart N. Isaacs, 2004 268. Public Health Microbiology: Methods and Protocols, edited by John F. T. Spencer and Alicia L. Ragout de Spencer, 2004 267. Recombinant Gene Expression: Reviews and Protocols, Second Edition, edited by Paulina Balbas and Argelia Johnson, 2004 266. Genomics, Proteomics, and Clinical Bacteriology: Methods and Reviews, edited by Neil Woodford and Alan Johnson, 2004 265. RNA Interference, Editing, and Modification: Methods and Protocols, edited by Jonatha M. Gott, 2004 264. Protein Arrays: Methods and Protocols, edited by Eric Fung, 2004 263. Flow Cytometry, Second Edition, edited by Teresa S. Hawley and Robert G. Hawley, 2004 262. Genetic Recombination Protocols, edited by Alan S. Waldman, 2004 261. Protein–Protein Interactions: Methods and Applications, edited by Haian Fu, 2004 260. Mobile Genetic Elements: Protocols and Genomic Applications, edited by Wolfgang J. Miller and Pierre Capy, 2004 259. Receptor Signal Transduction Protocols, Second Edition, edited by Gary B. Willars and R. A. John Challiss, 2004 258. Gene Expression Profiling: Methods and Protocols, edited by Richard A. Shimkets, 2004 257. mRNA Processing and Metabolism: Methods and Protocols, edited by Daniel R. Schoenberg, 2004 256. Bacterial Artifical Chromosomes, Volume 2: Functional Studies, edited by Shaying Zhao and Marvin Stodolsky, 2004 255. Bacterial Artifical Chromosomes, Volume 1: Library Construction, Physical Mapping, and Sequencing, edited by Shaying Zhao and Marvin Stodolsky, 2004 254. Germ Cell Protocols, Volume 2: Molecular Embryo Analysis, Live Imaging, Transgenesis, and Cloning, edited by Heide Schatten, 2004 253. Germ Cell Protocols, Volume 1: Sperm and Oocyte Analysis, edited by Heide Schatten, 2004 252. Ribozymes and siRNA Protocols, Second Edition, edited by Mouldy Sioud, 2004 251. HPLC of Peptides and Proteins: Methods and Protocols, edited by Marie-Isabel Aguilar, 2004 250. MAP Kinase Signaling Protocols, edited by Rony Seger, 2004 293 292 291 290 289 288 287 286 285 284 283 282 281 280 279 278 277 276 275 274 273 272 271 270 269 268 267 266 265 264 263 262 261 260 259 258 257 256 255 254 253 252 251 250
- 8. M E T H O D S I N M O L E C U L A R B I O L O G Y™ Public Health Microbiology Methods and Protocols Edited by John F. T. Spencer Alicia L. Ragout de Spencer Planta Piloto de Procesos Industriales Microbiológicos (PROIMI)–CONICET San Miguel de Tucumán, Argentina
- 9. © 2004 Humana Press Inc. 999 Riverview Drive, Suite 208 Totowa, New Jersey 07512 www.humanapress.com All rights reserved. No part of this book may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, microfilming, recording, or otherwise without written permission from the Publisher. Methods in Molecular BiologyTM is a trademark of The Humana Press Inc. All papers, comments, opinions, conclusions, or recommendations are those of the author(s), and do not necessarily reflect the views of the publisher. This publication is printed on acid-free paper. ' ANSI Z39.48-1984 (American Standards Institute) Permanence of Paper for Printed Library Materials. Cover design by Patricia F. Cleary. For additional copies, pricing for bulk purchases, and/or information about other Humana titles, contact Humana at the above address or at any of the following numbers: Tel.: 973-256-1699; Fax: 973-256-8341; E-mail: humana@humanapr.com; or visit our Website: www.humanapress.com Photocopy Authorization Policy: Authorization to photocopy items for internal or personal use, or the internal or personal use of specific clients, is granted by Humana Press Inc., provided that the base fee of US $25.00 per copy is paid directly to the Copyright Clearance Center at 222 Rosewood Drive, Danvers, MA 01923. For those organizations that have been granted a photocopy license from the CCC, a separate system of payment has been arranged and is acceptable to Humana Press Inc. The fee code for users of the Transactional Reporting Service is: [1-58829-117-0/04 $25.00]. Printed in the United States of America. 10 9 8 7 6 5 4 3 2 1 E-ISBN 1-59259-766-1 Library of Congress Cataloging-in-Publication Data Public health microbiology : methods and protocols / edited by John F.T. Spencer, Alicia L. Ragout de Spencer. p. ; cm. -- (Methods in molecular biology, ISSN 1064-3745 ; v. 268) Includes bibliographical references and index. ISBN 1-58829-117-0 (alk. paper) 1. Diagnostic microbiology. [DNLM: 1. Environmental Microbiology. 2. Microbiological Techniques. QW 55 P976 2004] I. Spencer, J. F. T. II. Ragout de Spencer, Alicia L. III. Methods in molecular biology (Clifton, N.J.) ;v. 268. QR67.P83 2004 616.9'041--dc22 2003025016
- 10. v Preface Public Health Microbiology: Methods and Protocols is focused on microorganisms that can present a hazard to human health in the course of everyday life. There are chapters dealing with organisms that are directly pathogenic to humans, including bacteria, viruses, and fungi; on organisms that produce toxins during growth in their natural habitats; on the use of bacteriocins produced by such organisms as lactobacilli and bifidobacteria; as well as several chapters on hazard analysis, the use of disinfectants, microbiological analysis of cosmetics, and microbiological tests for sanitation equipment in food factories. Additional chapters look at the use of animals (mice) in the study of the various characteristics of milk and their relationships with lactic acid bacteria in particular. Other chapters focus on special methods for determining particular components of milk. In particular, in Parts I and II, on bacterial and viral pathogens, special attention is given to methods for PCR detection of genes with resistance to tetracycline, as well as to Salmonella enterica; for identification and typing of Campylobacter coli; for detection of the abundance of enteric viruses, hepatitis A virus, and rotaviruses in sewage, and of bacteriophages infecting the O157:H7 strain of Escherichia coli. Part III offers methods for computerized analysis and typing of fungal isolates, for isolation and enumeration of fungi in foods, and for the determination of aflatoxin and zearalenone. Important pathogens discussed in Part IV include Legionella, amoebae, fungal conidia, and yeasts (by flow cytometry), Cryptosporidium parvum, and Erysipelothrix rhusopathiae. Protocols for the separation of pathogenic organisms from environmental matrices by immunomagnetic methods are also included here. Part V describes methods for spectrophotometric determination of histamine in fish processing and the antimicrobial effects of flavonoids from Tagetes species in Argentina. The uses of animals (mice) in studies of various characteristics of lactobacilli are covered in the six chapters of Part VI, and Part VII includes special methods of analysis. The final part of Public Health Microbiology: Methods and Protocols includes three very important reviews, one on the microflora of the intestinal tract, another on the relation of the spread of pathogens from livestock and poultry production by disposal of manure and similar wastes on agricultural land, and finally, a review of the threat to public health by the prion-based diseases, the several forms of transmissible spongiform encephalopathies, that is, mad cow disease, scrapie in sheep, wasting disease in elk and mule deer, and Creutzfeld-Jacob disease in humans. In actuality, all three animal conditions may be transmissible to humans. Chapters 51 and 52, in particular, should be required reading for all public officials, at all levels of government, who have a responsibility for public health.
- 11. vi Preface The editors wish to thank Dr. Faustino Siñeriz, Director of PROIMI and Head of Secretaría de Ciencia y Técnica (CIUNT) in Tucumán for his consideration in providing facilities and supplies for this work; Pharm. Laura Tereschuk, and Dra. Alejandra Martinez, for valuable assistance in the compilation of this work; Dr. Javier Ochoa, for much useful technical assistance; and finally all the investigator/authors who contributed chapters to our book. John F. T. Spencer Alicia L. Ragout de Spencer
- 12. Contents Preface ..............................................................................................................v Contributors ................................................................................................... xiii PART I BACTERIA 1 Detection of Tetracycline Resistance Genes by PCR Methods Rustam I. Aminov, Joanne C. Chee-Sanford, Natalie Garrigues, Asma Mehboob, and Roderick I. Mackie ......................................... 3 2 Integron Analysis and Genetic Mapping of Antimicrobial Resistance Genes in Salmonella enterica serotype Typhimurium Mairéad Daly and Séamus Fanning .................................................... 15 3 Molecular-Based Identification and Typing of Campylobacter jejuni and C. coli Brigid Lucey, Fiona O’Halloran, and Séamus Fanning ....................... 33 4 Molecular Genotyping Methods and Computerized Analysis for the Study of Salmonella enterica Ana Belén Vivanco, Juan Alvarez, Idoia Laconcha, Nuria López-Molina, Aitor Rementeria, and Javier Garaizar ........ 49 PART II VIRUSES 5 Detection of Infectious Rotaviruses by Flow Cytometry Albert Bosch, Rosa M. Pintó, Jaume Comas, and Francesc-Xavier Abad .............................................................. 61 6 Integrated Cell Culture/PCR for Detection of Enteric Viruses in Environmental Samples Kelly A. Reynolds ................................................................................ 69 7 Abundance in Sewage of Bacteriophages Infecting Escherichia coli O157:H7 Maite Muniesa and Juan Jofre ............................................................ 79 8 Molecular Genotyping of Irish Rotavirus Strains Fiona O’Halloran and Séamus Fanning .............................................. 89 9 Hepatitis A Virus: Molecular Detection and Typing Glòria Sánchez, Cristina Villena, Albert Bosch, and Rosa M. Pintó.... 103 vii
- 13. viii Contents PART III FUNGI 10 Typing Fungal Isolates: Molecular Methods and Computerized Analysis Aitor Rementeria, Ana Belén Vivanco, Ainara Cadaval, María Teresa Ruesga, Sonia Brena, José Pontón, Guillermo Quindós, and Javier Garaizar ....................................... 117 11 Fungal Isolation and Enumeration in Foods Dante Javier Bueno, Julio Oscar Silva, and Guillermo Oliver ......... 127 12 Determination of Aflatoxins and Zearalenone in Different Culture Media Dante Javier Bueno and Guillermo Oliver ....................................... 133 IV OTHER PATHOGENS 13 Intracellular Multiplication of Legionella Species and the Influence of Amoebae on Their Intracellular Growth in Human Monocytes: Mono Mac 6 Cells and Acanthamoeba castellanii as Suitable In Vitro Models Birgid Neumeister ............................................................................. 141 14 Viability of Amoebae, Fungal Conidia, and Yeasts: Rapid Assessment by Flow Cytometry Judith A. Noble-Wang, Shangtong Zhang, Daniel Price, and Donald G. Ahearn ................................................................. 153 15 Detection and Differentiation of Cryptosporidium Oocysts in Water by PCR-RFLP Lihua Xiao, Altaf A. Lal, and Jianlin Jiang......................................... 163 16 Genotyping of Cryptosporidium parvum With Microsatellite Markers Giovanni Widmer, Xiaochuan Feng, and Sultan Tanriverdi............. 177 17 Immunomagnetic Separation of Pathogenic Organisms From Environmental Matrices Gary P. Yakub and Kathleen L. Stadterman-Knauer......................... 189 18 Detection of Erysipelothrix rhusiopathiae in Clinical and Environmental Samples Silvana G. Fidalgo and Thomas V. Riley ........................................... 199 19 Interaction Between Lactic Acid Bacteria and Gastrointestinal Nematodes of Caprine Origin Diana Draksler, María Cecilia Monferran, and Silvia González...... 207 20 Molecular Detection of Genes Responsible for Cyanobacterial Toxin Production in the Genera Microcystis, Nodularia, and Cylindrospermopsis Brendan P. Burns, Martin L. Saker, Michelle C. Moffitt, and Brett A. Neilan ....................................................................... 213
- 14. PART V BACTERIOCINS AND OTHER INHIBITORS 21 Purification of Antilisterial Bacteriocins Jean-Marc Berjeaud and Yves Cenatiempo ...................................... 225 22 The Hazard Analysis and Critical Control Point System in Food Safety Anavella Gaitan Herrera................................................................... 235 23 Testing Disinfectants in the Food Factory: Phenol Coefficient Method Anavella Gaitan Herrera................................................................... 281 24 Nontraditional Method of Evaluating Disinfectants: With Isolated Microorganisms From the Food Factory Anavella Gaitan Herrera................................................................... 289 25 Microbiological Analysis of Cosmetics Anavella Gaitan Herrera................................................................... 293 26 Helicobacter pylori and Food Products: A Public Health Problem Anavella Gaitan Herrera................................................................... 297 27 Microbiological Test for Sanitation of Equipment in the Food Factory Anavella Gaitan Herrera................................................................... 303 28 Spectrophotometric Determination of Histamine in Fisheries Using an Enzyme Immunoassay Method Tânia L. P. Pessatti, José D. Fontana, and Marcos L. Pessatti .......... 311 29 Flavonoids From Argentine Tagetes (Asteraceae) With Antimicrobial Activity Maria L. Tereschuk, Mario D. Baigorí, Lucia I. C. de Figueroa, and Lidia R. Abdala....................................................................... 317 30 Purification of Bacteriocins Produced by Lactic Acid Bacteria Lucila Saavedra, Patricia Castellano, and Fernando Sesma ............. 331 31 Production of Antimicrobial Substances by Lactic Acid Bacteria I: Determination of Hydrogen Peroxide María Silvina Juárez Tomás, María Claudia Otero, Virginia Ocaña, and María Elena Nader-Macías.......................... 337 32 Production of Antimicrobial Substances by Lactic Acid Bacteria II: Screening Bacteriocin-Producing Strains With Probiotic Purposes and Characterization of a Lactobacillus Bacteriocin Virginia S. Ocaña and María Elena Nader-Macías ........................... 347 33 Statistical Models to Optimize Production of Probiotic Characteristics María Silvina Juárez Tomás, Elena Bru, and María Elena Nader-Macías .................................................... 355 34 Meat-Model System Development for Antibacterial Activity Determination Graciela Vignolo and Patricia Castellano......................................... 367 Contents ix
- 15. PART VI IN VIVO STUDIES IN MICE 35 Colonization Capability of Lactobacilli and Pathogens in the Respiratory Tract of Mice: Microbiological, Cytological, Structural, and Ultrastructural Studies Rosa Cangemi de Gutierrez, Viviana M. Santos, and María Elena Nader-Macías .................................................... 373 36 Effects of Estrogen Administration on the Colonization Capability of Lactobacilli and Escherichia coli in the Urinary Tracts of Mice Clara Silva, Rosario Rey, and María Elena Nader-Macías ................ 387 37 Effect of Lactobacilli Administration in the Vaginal Tract of Mice: Evaluation of Side Effects and Local Immune Response by Local Administration of Selected Strains Elisa Vintiñi, Virginia Ocaña, and María Elena Nader-Macías......... 401 38 Determination of Bacterial Adhesion to Intestinal Mucus Carlos Gusils, Vilma Morata, and Silvia González........................... 411 39 Animal Model for In Vivo Evaluation of Cholesterol Reduction by Lactic Acid Bacteria María Pía Taranto, Gabriela Perdigón, Marta Médici, and Graciela Font de Valdez ........................................................ 417 40 Assessing Survival of Dairy Propionibacteria in Gastrointestinal Conditions and Adherence to Intestinal Epithelia Gabriela Zárate, Silvia González, and Adriana Pérez Chaia ........... 423 PART VII SPECIAL METHODS 41 Bacterial Surface Characteristics Applied to Selection of Probiotic Microorganisms María Claudia Otero, Virginia S. Ocaña, and María Elena Nader-Macías .................................................... 435 42 Adhesion Ability of Lactobacillus to Vaginal Epithelial Cells: Study by Microbiological Methods Virginia S. Ocaña and María Elena Nader-Macías ........................... 441 43 Hydroxylapatite Beads As an Experimental Model to Study the Adhesion of Lactic Acid Bacteria From the Oral Cavity to Hard Tissues María del Carmen Ahumada Ostengo and María Elena Nader-Macías .................................................... 447 44 Microtechnique for Identification of Lactic Acid Bacteria Carlos Gusils, Adriana Pérez Chaia, Guillermo Oliver, and Silvia González ...................................................................... 453 x Contents
- 16. 45 Differentiation of Lactic Acid Bacteria Strains by Postelectrophoretic Detection of Esterases Roxana Beatriz Medina, Marta Beatriz Katz, and Silvia González ..... 459 46 Determination of Esterolytic and Lipolytic Activities of Lactic Acid Bacteria Roxana Beatriz Medina, Marta Beatriz Katz, Silvia González, and Guillermo Oliver ................................................................... 465 47 Meat-Model System Development for Proteolytic Activity Determination Graciela Vignolo, Silvina Fadda, Patricia Castellano, and Cecilia Fontana ...................................................................... 471 48 `-Glucuronidase Method to Determine Mastitis Levels in Goat Milk Rubén Oliszewski, Martha Núñez de Kairúz, Silvia González, and Guillermo Oliver ................................................................... 475 49 Differences Between Biogenic Amine Detection by HPLC Methods Using OPA and Dansyl Derivates María R. Alberto, Mario E. Arena, and María C. Manca de Nadra ..... 481 PART VIII REVIEWS 50 Microflora of the Gastrointestinal Tract: A Review Wei-Long Hao and Yuan-Kun Lee..................................................... 491 51 Public Health Implications Related to Spread of Pathogens in Manure From Livestock and Poultry Operations J. Lloyd Spencer and Jiewen Guan ................................................... 503 52 Molecular Aspects of Disease Pathogenesis in the Transmissible Spongiform Encephalopathies Suzette A. Priola and Ina Vorberg .................................................... 517 Index ............................................................................................................ 541 Contents xi
- 17. xiii Contributors FRANCESC-XAVIER ABAD • Enteric Virus Laboratory, Department of Microbiology, School of Biology, University of Barcelona, Barcelona, Spain LIDIA R. ABDALA • Facultad de Ciencias Naturales e Instistuto Miguel Lillo, Universidad Nacional de Tucumán, Tucumán, Argentina DONALD G. AHEARN • Environmental Research Center, Department of Biology, Georgia State University, Atlanta, GA MARÍA R. ALBERTO • Centro de Referencia para Lactobacilos (CERELA)– CONICET, Tucumán, Argentina JUAN ALVAREZ • Departamento de Inmunología, Microbiología y Parasitología, Facultad de Farmacia, Universidad del País Vasco, Vitoria-Gasteiz, España RUSTAM I. AMINOV • Rowett Research Institute, Aberdeen, UK MARIO E. ARENA • Facultad de Bioquímica, Química y Farmacia, Universidad Nacional de Tucumán; CONICET, Tucumán, Argentina JEAN-MARC BERJEAUD • Laboratoire de Microbiologie Fondamentale et Appliquée, Université de Poitiers, Poitiers, France MARIO D. BAIGORÍ • Laboratorio de Microbiología, Planta Piloto de Procesos Industriales Microbiológicos (PROIMI)–CONICET, Tucumán, Argentina ALBERT BOSCH • Enteric Virus Laboratory, Department of Microbiology, School of Biology, University of Barcelona, Barcelona, Spain SONIA BRENA • Departamento de Inmunología, Microbiología y Parasitología, Facultad de Farmacia, Universidad del País Vasco, Lejona, España ELENA BRU • Centro de Referencia para Lactobacilos (CERELA)–CONICET, Tucumán, Argentina DANTE JAVIER BUENO • Centro de Referencia para Lactobacilos (CERELA)–CONICET, Tucumán; Estacíon Experimental Concepción del Uruguay, Instituto Nacional de Tecnología Agropecuaria (INTA), Entre Riós, Argentina BRENDAN P. BURNS • School of Biotechnology and Biomolecular Sciences, Australian Center for Astrobiology, University of New South Wales, Sydney, Australia AINARA CADAVAL • Departamento de Inmunología, Microbiología y Parasitología, Facultad de Farmacia, Universidad del País Vasco, Vitoria-Gasteiz, España ROSA CANGEMI DE GUTIERREZ • Facultad de Bioquímica, Química y Farmacia, Universidad Nacional de Tucumán, Tucumán, Argentina PATRICIA CASTELLANO • Centro de Referencia para Lactobacilos (CERELA)–CONICET, Tucumán, Argentina YVES CENATIEMPO • Laboratoire de Microbiologie Fondamentale et Appliquée, Université de Poitiers, Poitiers, France ADRIANA PÉREZ CHAIA • Centro de Referencia para Lactobacilos (CERELA)–CONICET; Universidad Nacional de Tucumán, Tucumán, Argentina
- 18. JOANNE C. CHEE-SANFORD • Invasive Weed Managment Unit, Agricultural Research Service, United States Department of Agriculture (USDA–ARS), Urbana, IL JAUME COMAS • Flow Cytometry Unit, Serveis Cientificotecnics, University of Barcelona, Spain MAIRÉAD DALY • Molecular Diagnostics Unit, Cork Institute of Technology, Bishoptown, Cork, Ireland LUCIA I. C. DE FIGUEROA • Facultad de Bioquímica, Química y Farmacia, Universidad Nacional de Tucumán; Laboratorio de Levaduras y Hongos Filamentosos, Planta Piloto de Procesos Industriales Microbiológicos (PROIMI)–CONICET, Tucumán, Argentina MARÍA DEL CARMEN AHUMADA OSTENGO • Centro de Referencia para Lactobacilos (CERELA)–CONICET, Tucumán, Argentina DIANA DRAKSLER • Centro de Referencia para Lactobacilos (CERELA)–CONICET, Tucumán, Argentina SILVINA FADDA • Centro de Referencia para Lactobacilos (CERELA)–CONICET, Tucumán, Argentina SÉAMUS FANNING • Centre for Food Safety, Faculties of Agriculture, Medicine, and Veterinary Medicine, University College, Belfiold, Dublin, Ireland XIAOCHUAN FENG • Division of Infectious Diseases, Tufts University School of Veterinary Medicine, North Grafton, MA SILVANA G. FIDALGO • Department of Microbiology, University of Western Australia, Queen Elizabeth II Medical Centre, Western Australia GRACIELA FONT DE VALDEZ • Centro de Referencia para Lactobacilos (CERELA)–CONICET, Tucumán, Argentina CECILIA FONTANA • Centro de Referencia para Lactobacilos (CERELA)–CONICET, Tucumán, Argentina JOSÉ D. FONTANA • Director Técnico, Instituto Técnico do Paraná (TECPAR), Universidad Federal do Paraná, Paraná, Brasil JAVIER GARAIZAR • Departamento de Inmunología, Microbiología y Parasitología, Facultad de Farmacia, Universidad del País Vasco, Vitoria-Gasteiz, España NATALIE GARRIGUES • Department of Veterinary Pathobiology, University of Illinois at Urbana–Champaign, Urbana, IL SILVIA GONZÁLEZ • Centro de Referencia para Lactobacilos (CERELA)–CONICET; Universidad Nacional de Tucumán, Tucumán, Argentina JIEWEN GUAN • Animal Diseases Research Institute/Centre for Plant Quarantine Pests, Canadian Food Inspection Agency, Ottawa, Ontario, Canada CARLOS GUSILS • Centro de Referencia para Lactobacilos (CERELA)–CONICET; Universidad Nacional de Tucumán, Tucumán, Argentina WEI-LONG HAO • Department of Microbiology, National University of Singapore, Singapore ANAVELLA GAITAN HERRERA • Planta Piloto de Procesos Industriales Microbiológicos (PROIMI)–CONICET, Tucumán, Argentina xiv Contributors
- 19. JIANLIN JIANG • Division of Parasitic Diseases, Centers for Disease Control and Prevention, Public Health Service, United States Department of Health and Human Services, Atlanta, GA JUAN JOFRE • Department of Microbiology, Faculty of Biology, University of Barcelona, Barcelona, Spain MARTA BEATRIZ KATZ • Centro de Referencia para Lactobacilos (CERELA)–CONICET, Tucumán, Argentina IDOIA LACONCHA • Departamento de Inmunología, Microbiología y Parasitología, Facultad de Farmacia, Universidad del País Vasco, Vitoria-Gasteiz, España ALTAF A. LAL • Division of Parasitic Diseases, Centers for Disease Control and Prevention, Public Health Service, United States Deparment of Health and Human Services, Atlanta, GA YUAN-KUN LEE • Department of Microbiology, National University of Singapore, Singapore NURIA LÓPEZ-MOLINA • Departamento de Inmunología, Microbiología y Parasitología, Facultad de Farmacia, Universidad del País Vasco, Vitoria- Gasteiz, España BRIGID LUCEY • Molecular Diagnostics Unit, Cork Institute of Technology, Bishoptown, Cork, Ireland RODERICK I. MACKIE • Department of Animal Sciences, University of Illinois at Urbana-Champaign, Urbana, IL MARÍA C. MANCA DE NADRA • Facultad de Bioquímica, Química y Farmacia, Universidad Nacional de Tucumán, Tucumán, Argentina MARTA MÉDICI • Centro de Referencia para Lactobacilos (CERELA)–CONICET, Tucumán, Argentina ROXANA BEATRIZ MEDINA • Centro de Referencia para Lactobacilos (CERELA)–CONICET; Universidad Nacional de Tucumán, Tucumán, Argentina ASMA MEHBOOB • Department of Animal Sciences, University of Illinois at Urbana-Champaign, Urbana, IL MICHELLE C. MOFFITT • School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, Australia MARÍA CECILIA MONFERRAN • Universidad Nacional de Catamarca, Catamarca, Argentina VILMA MORATA • Universidad Nacional de Cuyo, Mendoza, Argentina MAITE MUNIESA • Department of Microbiology, Faculty of Biology, University of Barcelona, Barcelona, Spain MARÍA ELENA NADER-MACÍAS • Centro de Referencia para Lactobacilos (CERELA)–CONICET, Tucumán, Argentina BRETT A. NEILAN • School of Biotechnology and Biomolecular Sciences, Australian Center for Astrobiology, University of New South Wales, Sydney, Australia BIRGID NEUMEISTER • Department Transfusion Medicine, University Hospital of Tuebingen, Tuebingen, Germany Contributors xv
- 20. JUDITH A. NOBLE-WANG • Environmental Research Center, Department of Biology, Georgia State University, Atlanta, GA MARTHA NÚÑEZ DE KAIRÚZ • Centro de Referencia para Lactobacilos (CERELA)–CONICET, Tucumán, Argentina VIRGINIA OCAÑA • Centro de Referencia para Lactobacilos (CERELA)–CONICET, Tucumán, Argentina FIONA O’HALLORAN • Molecular Diagnostics Unit, Cork Institute of Technology, Bishoptown, Cork, Ireland RUBÉN OLISZEWSKI • Centro de Referencia para Lactobacilos (CERELA)–CONICET, Universidad Nacional de Tucumán, Tucumán, Argentina GUILLERMO OLIVER • Centro de Referencia para Lactobacilos (CERELA)– CONICET, Tucumán, Argentina MARÍA CLAUDIA OTERO • Centro de Referencia para Lactobacilos (CERELA)– CONICET, Tucumán, Argentina GABRIELA PERDIGÓN • Centro de Referencia para Lactobacilos (CERELA)– CONICET, Tucumán, Argentina MARCOS L. PESSATTI • Universidade do Vale do Itajaí, Santa Catarina, Brasil TÂNIA L. P. PESSATTI • Universidade do Vale do Itajaí, Santa Catarina, Brasil ROSA M. PINTÓ • Enteric Virus Laboratory, Department of Microbiology, School of Biology, University of Barcelona, Barcelona, Spain JOSÉ PONTÓN • Departamento de Inmunología, Microbiología y Parasitología, Facultad de Farmacia, Universidad del País Vasco, Lejona, España DANIEL PRICE • Interface Research Center, Kennesaw, GA SUZETTE A. PRIOLA • Laboratory of Persistent Viral Diseases, National Institute of Allergy and Infectious Diseases, Rocky Mountain Laboratories, Hamilton, MT GUILLERMO QUINDÓS • Departamento de Inmunología, Microbiología y Parasitología, Facultad de Farmacia, Universidad del País Vasco, Lejona, España AITOR REMENTERIA • Departamento de Inmunología, Microbiología y Parasitología, Facultad de Farmacia, Universidad del País Vasco, Lejona, España ROSARIO REY • Facultad de Bioquímica, Química y Farmacia, Universidad Nacional de Tucumán, Tucumán, Argentina KELLY A. REYNOLDS • University of Arizona, Environmental Research Laboratory, Tuscon, AZ THOMAS V. RILEY • Department of Microbiology, University of Western Australia, Queen Elizabeth II Medical Centre, Western Australia MARÍA TERESA RUESGA • Departamento de Inmunología, Microbiología y Parasitología, Facultad de Farmacia, Universidad del País Vasco, Lejona, España LUCILA SAAVEDRA • Centro de Referencia para Lactobacilos (CERELA)–CONICET, Tucumán, Argentina MARTIN L. SAKER • Departamento de Zoologia e Antropologia, Faculdade de Ciencias, Universidade do Porto, Porto, Portugal xvi Contributors
- 21. GLÒRIA SÁNCHEZ • Enteric Virus Laboratory, Department of Microbiology, School of Biology, University of Barcelona, Barcelona, Spain VIVIANA M. SANTOS • Facultad de Bioquímica, Química y Farmacia, Universidad Nacional de Tucumán, Tucumán, Argentina FERNANDO SESMA • Centro de Referencia para Lactobacilos (CERELA)–CONICET, Tucumán, Argentina CLARA SILVA • Facultad de Bioquímica, Química y Farmacia, Universidad Nacional de Tucumán, Tucumán, Argentina JULIO OSCAR SILVA • Facultad de Bioquímica, Química y Farmacia, Universidad Nacional de Tucumán, Tucumán, Argentina J. LLOYD SPENCER • Animal Diseases Research Institute/Centre for Plant Quarantine Pests, Canadian Food Inspection Agency, Ottawa, Ontario, Canada KATHLEEN L. STADTERMAN-KNAUER • The Knauer Group, Pittsburgh, PA SULTAN TANRIVERDI • Division of Infectious Diseases, Tufts University School of Veterinary Medicine, North Grafton, MA; Department of Pediatric Hematology-Oncology, Study of Medicine, Cukurova University, Adana, Turkey MARÍA PÍA TARANTO • Centro de Referencia para Lactobacilos (CERELA)–CONICET, Tucumán, Argentina MARÍA L. TERESCHUK • Facultad de Ciencias Naturales e Instituto Miguel Lillo, Universidad Nacional de Tucumán, Tucumán, Argentina MARÍA SILVINA JUÁREZ TOMÁS • Centro de Referencia para Lactobacilos (CERELA)–CONICET, Tucumán, Argentina GRACIELA VIGNOLO • Centro de Referencia para Lactobacilos (CERELA)–CONICET, Tucumán, Argentina CRISTINA VILLENA • Enteric Virus Laboratory, Department of Microbiology, School of Biology, University of Barcelona, Barcelona, Spain ELISA VINTIÑI • Centro de Referencia para Lactobacilos (CERELA)–CONICET, Tucumán, Argentina ANA BELÉN VIVANCO • Departamento de Inmunología, Microbiología y Parasitología, Facultad de Farmacia, Universidad del País Vasco, Vitoria- Gasteiz, España INA VORBERG • Institute for Virology, Technical University of Munich, Munich, Germany GIOVANNI WIDMER • Division of Infectious Diseases, Tufts University School of Veterinary Medicine, North Grafton, MA LIHUA XIAO • Division of Parasitic Diseases, Centers for Disease Control and Prevention, Public Health Service, United States Deparment of Health and Human Services, Atlanta, GA GARY P. YAKUB • North Huntington, PA GABRIELA ZÁRATE • Centro de Referencia para Lactobacilos (CERELA)–CONICET, Tucumán, Argentina SHANGTONG ZHANG • Environmental Research Center, Department of Biology, Georgia State University, Atlanta, GA Contributors xvii
- 22. Tetracyline Resistance Genes 1 I BACTERIA
- 23. Tetracyline Resistance Genes 3 3 From: Methods in Molecular Biology, vol. 268: Public Health Microbiology: Methods and Protocols Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ 1 Detection of Tetracycline Resistance Genes by PCR Methods Rustam I. Aminov, Joanne C. Chee-Sanford, Natalie Garrigues, Asma Mehboob, and Roderick I. Mackie 1. Introduction Rapid, accurate, and sensitive determination of antibiotic resistance profiles of vari- ous human and animal pathogens becomes a vital prerequisite for successful therapeu- tic intervention in the face of the increased occurrences of drug-resistant bacterial infections. The current methods, which are dependent on cultivation of pathogens and phenotypic expression of antibiotic resistance, usually require excessive time, special microbiological equipment, and qualified personnel. However, even with all these req- uisites, for example, no bacteria can be grown from more than 80% of all clinical samples sent to clinical microbiology laboratories (1). Besides the cultivation limita- tions, the cultivation-based determination of an antibiotic resistance profile lacks the genotypic information, which is essential for understanding the epidemiology and routes of transmission of antibiotic resistance genes. These genes often reside on mobile genetic elements and can move freely between commensal and pathogenic microbiota, occurring even between taxonomically distant clinical and environmental microbiota. Therefore, development of genotyping methods for detection of antibiotic resistance genes is highly desirable for fast, accurate, and sensitive detection of antibi- otic resistance genes in a broad range of pathogenic and commensal bacteria in both clinical and environmental samples. As a model for our studies we have chosen the genes conferring resistance to tetra- cyclines. Tetracyclines belong to a family of broad-spectrum antibiotics that include tetracycline, chlortetracycline, oxytetracycline, demeclocycline, methacycline, doxy- cycline, minocycline, and a number of other semisynthetic derivatives (2). These anti- biotics inhibit protein synthesis in Gram-positive and Gram-negative bacteria by preventing the binding of aminoacyl-tRNA molecules to the 30S ribosomal subunit (3). The antibiotics of this group were introduced in the late 1950s and since then have been widely used in clinical and veterinary medicine, as well as for prophylaxis and
- 24. 4 Aminov et al. growth promotion in food animals. Because of the possible misuse and overuse of these drugs, resistance to this class of antibiotics is widespread among many clinical isolates, thus limiting the utility of tetracyclines in treating infections. Despite this shortcoming, antibiotics of this class still remain in the active arsenal for dermatolo- gists to treat skin infections such as acne (4) and rosacea (5). The local application of high concentrations of doxycycline has been proposed for clinical management of patients with periodontitis (6). Currently, the third generation of tetracyclines, the so-called glycylcyclines, are in phase II clinical trials (2), but microbial resistance to these novel antibiotics can already be seen among Salmonella isolates (7). Interest- ingly, this resistance to glycylcyclines is mediated by the well-known tetracycline resistance gene, tet(A), which has acquired an additional mutation conferring resis- tance to novel antibiotics that have not yet been introduced into clinical practice. Thus, routine monitoring for existing and novel tetracycline resistance genes may aid in evaluating possible decreases in efficacy of third-generation tetracyclines caused by spreading resistances. Bacterial resistance to tetracycline is mediated mainly by two mechanisms includ- ing protection of ribosomes by the synthesis of ribosomal protection proteins (RPPs), which share homology with the GTPases involved in protein synthesis, namely, EF-Tu and EF-G (8–14), and by the energy-dependent efflux of tetracycline from the cell (3,12,15). A third mechanism, enzymatic inactivation of tetracycline, is relatively uncommon and functions only during heterologous expression in E. coli (16). This reaction requires the presence of oxygen and NADPH and is not functional in the natural anaerobic host (Bacteroides). The first nomenclature for tetracycline resis- tance determinants was proposed in 1989 (17), and a recent update appeared in 1999 (18). Phylogeny-based classifications of the RPP genes allowed the identification of nine classes: TetB P, TetM, TetO, TetQ, TetS, TetT, TetW, Tet 32, and otrA (19,20). The second mechanism of tetracycline resistance, efflux of tetracycline from the cell, is mediated by transporters, which share a common structure with the 12 or 14 trans- membrane segments (12-TMS and 14-TMS) and belong to the major facilitator super- family (MFS) (21,22). The 12-TMS permeases are found almost exclusively in Gram-negative bacteria and they uniformly catalyze drug/H+ antiport (21). Recent phylogenetic analysis has suggested that the tet subcluster includes 11 genes cata- lyzing the efflux of tetracycline from the cell: tet(A), tet(B), tet(C), tet(D), tet(E), tet(G), tet(H), tet(J), tet(Y), tet(Z), and tet(30) (23). Genotyping of antibiotic resistance genes can be done by hybridization with any of the known tet genes or by polymerase chain reaction (PCR). A hybridization approach is time-consuming and is less sensitive when one is working with environmental or clinical samples. Based on the phylogenetic analysis of tetracycline resistance genes, we have developed PCR primer sets suitable for detection and tracking of these genes in various bacteria and environmental samples (19,23,24) as well as for quantification of these genes in a variety of bacterial isolates and samples (unpublished data). This PCR-based approach can be easily automated and scaled up, and a similar detection approach can be adapted for detection of other, more clinically relevant, antibiotic resistance genes.
- 25. Tetracyline Resistance Genes 5 2. Materials 1. Depending on the type of samples used for PCR analysis, genomic DNA can be isolated using the kits from Mo Bio Laboratories (Solana Beach, CA, www.mobio.com): a. From tissues, bones, and cell cultures: UltraClean™ Tissue DNA Kit. b. From whole blood: UltraClean BloodSpin Kit or UltraClean™ Blood DNA Kit. c. From plant tissue: UltraClean Plant DNA Kit. d. From soil samples: UltraClean Soil DNA Kit. e. From water and urine samples: UltraClean Water DNA Kit. f. From fecal samples: UltraClean DRY Soil DNA Kit for fecal samples. g. From microorganisms: UltraClean Microbial DNA Kit. h. From forensic samples: UltraClean Forensic DNA Kit. Additional equipment for genomic DNA isolation using these kits includes a vortex with a flat-bed pan for processing of multiple samples and a microcentrifuge. 2. PCR primers for detection of the RPP genes (Table 1) or tetracycline efflux pump genes of Gram-negative bacteria (TEPGNB) (Table 2) are synthesized commercially on a 50-nmol scale (high performance liquid chromatography [HPLC] purified). For PCR- denaturing gradient gel electrophoresis (DGGE) analysis, the forward or reverse primer is synthesized with a GC clamp (CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGC ACGGGGGG) attached to the 5'-end. 3. Takara Ex Taq™ DNA polymerase kit (Takara Shuzo, Japan). 4. Agarose gel electrophoresis buffer: 45 mM tris-borate, 1 mM EDTA, pH 8.0. This buffer should not require pH adjustment. The 10X stock is stored at room temperature and is used at a working strength of 0.5X. 5. Agarose gel sample loading buffer (6X): 40% (w/v) sucrose in water and 0.5% (w/v) Orange G (Sigma). This dye migrates as a DNA fragment of approx 50 bp. 6. Agarose gel stain solution: 0.5 mg/L (w/v) ethidium bromide in water. Alternatively, for faster results, the fluorescent dye GelStarº (FMC Bioproducts, Rockland, ME) can be incorporated into the agarose gels at a 1:10,000 dilution (v/v). 7. 100-bp DNA Ladder (Promega). 8. DGGE buffer: 40 mM Tris-acetate, 1 mM EDTA, pH 8.0. The 50X stock solution is stored at room temperature and is used at a working strength of 1X. 9. DGGE sample loading buffer: 0.05% bromophenol blue, 0.05% xylene cyanol, and 70% glycerol in sterile nanopure water. 10. GelBond PAG gel support films (FMC Bioproducts). 11. Freshly prepared silver stain solution: 0.1% AgNO3 in ddH2O. 12. Developing solution: 0.01% NaBH4 and 0.4% v/v formaldehyde in 1.5% w/v NaOH. 13. QuantiTect SYBR Green PCR kit (Qiagen, Germany) or other high-sensitivity real-time PCR kits based on quantification of amplified DNA by binding the SYBR Green fluores- cent dye. 14. Control strains to generate the standard curves for quantification of tetracycline resis- tance genes in the environmental samples or for determining the copy number of tetracy- cline resistance genes in microbial cells (Table 3). These strains are also used as controls in PCR and PCR-DGGE. 15 QIAquick Gel Extraction Kit (Qiagen).
- 26. 6 Aminov et al. Table 1 PCR Primers Targeting the Ribosomal Protection Protein Genes PCR annealing Class Sequence temperature Amplicon size Primer pair targeted 5'3' (°C) (bp) TetB/P-FW TetB P AAAACTTATTATATTATAGTG 46 169 TetB/P-RV TGGAGTATCAATAATATTCAC TetM-FW TetM ACAGAAAGCTTATTATATAAC 55 171 TetM-RV TGGCGTGTCTATGATGTTCAC TetO-FW TetO ACGGARAGTTTATTGTATACC 60 171 TetO-RV TGGCGTATCTATAATGTTGAC TetQ-FW TetQ AGAATCTGCTGTTTGCCAGTG 63 169 TetQ-RV CGGAGTGTCAATGATATTGCA TetS-FW TetS GAAAGCTTACTATACAGTAGC 50 169 TetS-RV AGGAGTATCTACAATATTTAC TetT-FW TetT AAGGTTTATTATATAAAAGTG 46 169 TetT-RV AGGTGTATCTATGATATTTAC TetW-FW TetW GAGAGCCTGCTATATGCCAGC 64 168 TetW-RV GGGCGTATCCACAATGTTAAC Tet32-FW Tet32 TCGACCTACAGCGTGTTTACC 62 277 Tet32-RV CTAATAGTTCATCGCTTCCGG 3. Methods 3.1 Genomic DNA Isolation Genomic DNA of sufficient purity for PCR amplification can be isolated using the corresponding kits from Mo Bio (see Materials and Notes 1 and 2). Alternatively, if there are difficulties in obtaining these kits, total genomic DNA can be isolated using the following protocol: 1. To 200 mg of material (microbial or cell culture pellet, soil, plant tissue, or other sample), in a 2-mL screw-top cryogen storage propylene plastic tube, add 0.1 g zirconium beads (0.1-mm diameter), 700 μL lysis solution (50 mM Tris-HCl, 10 mM EDTA, 2% sodium dodecyl sulfate [SDS], pH 8.0), and 700 μL Tris-buffered phenol, pH 8.0. 2. Shake the tubes (“homogenize” setting on a Mini Bead-Beater-8» [Biospec Products, Bartlesville, OK]) for 1 min and chill on ice for 2 min. 3. Repeat the previous step twice. 4. Centrifuge the tubes in a tabletop centrifuge at 10,000g for 5 min. 5. Transfer the upper water phase to a 2-mL microcentrifuge tube and extract with phenol- chloroform-isoamyl alcohol (25:24:1) twice or until the interphase is clear. 6. Precipitate with ethanol, wash with 70% ethanol, dry, and dissolve in 50 μL of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) with 10 μg/mL RNaseA. 3.2. Conventional PCR Detection of RPP Genes 1. On ice, combine the following components of the PCR mixture in a 200-μL thin-walled PCR tube: 25 pmol of each primer, 1X ExTaq reaction buffer, 100 μM of each
- 27. Tetracyline Resistance Genes 7 deoxynucleoside triphosphate, 1.0 U of ExTaq DNA polymerase, and 200 ng of the puri- fied DNA template, adjusted to a total volume of 20 μL. 2. Perform PCR amplification (25 cycles) with a GeneAmp PCR system 2400 (Perkin- Elmer, Norwalk, CT) or a DNA Engine Thermocycler (MJ Research, Waltham, MA) using initial denaturation at 94°C for 5 min, followed by cycling at 94° for 30 s, 30 s of annealing (annealing temperatures are shown in Table 2), 30 s of extension at 72°C, with final extension at 72°C for 7 min. Include positive (Table 1) and negative (e.g., a noncomplementary template) controls for each pair of primers used. 3. A second, nested PCR can be performed using 1 μL of product from the first PCR as a template and amplifying for 25 cycles as described above if PCR amplification fails ow- ing to the presence of unidentified PCR-inhibiting substances. 3.3. Conventional PCR Detection of TEPGNB Genes 1. On ice, combine the components of the following PCR mixture in a 200-μL PCR tube: 25 pmol of each primer, 1X ExTaq reaction buffer, 100 μM of each deoxynucleoside triph- osphate, 1.0 U of ExTaq DNA polymerase, and 125 ng of the purified DNA template, adjusted to a total volume of 25 μL. Table 2 PCR Primers Targeting tet Efflux Pumps of Gram-Negative Bacteria PCR annealing/ Class Sequence extension temperature Amplicon Primer pair targeted 5' 3' (°C) size (bp) TetA-FW TetA GCG CGA TCT GGT TCA CTC G 61 164 TetA-RV AGT CGA CAG YRG CGC CGG C TetB-FW TetB TAC GTG AAT TTA TTG CTT CGG 61 206 TetB-RV ATA CAG CAT CCA AAG CGC AC TetC-FW TetC GCGGGATATCGTCCATTCCG 68 207 TetC-RV GCGTAGAGGATCCACAGGACG TetD-FW TetD GGA ATA TCT CCC GGA AGC GG 68 187 TetD-RV CAC ATT GGA CAG TGC CAG CAG TetE-FW TetE GTT ATT ACG GGA GTT TGT TGG 61 199 TetE-RV AAT ACA ACA CCC ACA CTA CGC TetG-FW TetG GCA GAG CAG GTC GCT GG 68 134 TetG-RV CCY GCA AGA GAA GCC AGA AG TetH-FW TetH CAG TGA AAA TTC ACT GGC AAC 61 185 TetH-RV ATC CAA AGT GTG GTT GAG AAT TeJ-FW TetJ CGA AAA CAG ACT CGC CAA TC 61 184 TetJ-RV TCC ATA ATG AGG TGG GGC TetY-FW TetY ATT TGT ACC GGC AGA GCA AAC 68 181 TetY-RV GGC GCT GCC GCC ATT ATG C TetZ-FW TetZ CCT TCT CGA CCA GGT CGG 61 204 TetZ-RV ACC CAC AGC GTG TCC GTC Tet30-FW Tet30 CAT CTT GGT CGA GGT GAC TGG 68 210 Tet30-RV ACG AGC ACC CAG CCG AGC
- 28. 8 Aminov et al. 2. For detection of tet(C), tet(D), tet(G), tet(Y), and tet(30), perform a two-step PCR ampli- fication consisting of initial denaturation at 94°C for 5 min followed by 25 cycles at 94° for 5 s and 10 s of annealing/extension at 68°C, with a final extension at 68°C for 7 min. Include positive (Table 2) and negative (e.g., a noncomplementary template) controls for each pair of primers used. 3. For detection of tet(A), tet(B), tet(E), tet(H), tet(J), and tet(Z), perform a two-step PCR amplification consisting of initial denaturation at 94°C for 5 min followed by 25 cycles at 94° for 5 s and 30 s of annealing/extension at 61°C, with a final extension at 61°C for 7 min. Include positive (Table 2) and negative (e.g., a noncomplementary template) con- trols for each pair of primers used. 4. A second, nested PCR can be performed using 1 μL of product from the first PCR as a template and amplifying for 25 cycles as just described if amplification fails owing to the presence of unidentified PCR-inhibiting substances. 5. Analyze the PCR products by electrophoresis of 5-μL aliquots on a 2.5% (w/v) agarose gel (NuSieveº, FMC Bioproducts) containing the fluorescent dye GelStarº (FMC Bioproducts). If running the gel without the dye, stain it in the ethidium bromide or GelStar solution after the run. The expected amplicon sizes are shown in Tables 1 and 2. Table 3 Control Strains and Plasmids Strains and plasmids tet gene Reference/source RPP genes Clostridium perfringens JIR4202 tetB(P) 25 pFD310 tet(M) 26 pGEM-tetO tet(O) 27 pBT-1 tet(Q) 28 pVP2 tet(S) 29 pAT451 tet(S) 30 Streptococcus pyogenes A498 tet(T) 31 pGEM-tetW tet(W) 27 pGEM-tet32 tet(32) 20 Efflux genes RP1 tet(A) 32 pRT11 tet(B) 33,34 pBR322 tet(C) 35 pUC119D tet(D) 36 pSL1504 tet(E) 37 pUC119G tet(G) 38,39 pVM111 tet(H) 40 PVM6 tet(J) 41 pIE1122 tet(Y) Dr. E. Tietze pAGHD1 tet(Z) 42 pZLE4.5 tet(30) 43
- 29. Tetracyline Resistance Genes 9 3.4. PCR-DGGE 1. Perform PCR reaction as described earlier for the RPP and TEPGNB genes, but using a primer pair with a GC-clamp on one primer (see Note 3). 2. Analyze a 5-μL aliquot by agarose gel electrophoresis to confirm that sufficient quanti- ties of the desired amplicon are synthesized. 3. Assemble the vertical gel casting module of the Bio-Rad D-Code System (Hercules, CA) including a GelBond PAG gel supporting film. 4. Form a 15–60% urea/formamide gradient (100% denaturant is equivalent to 7 M urea and 40% deionized formamide) in a 8% polyacrylamide gel (0.5X TAE buffer) using a Bio- Rad Gradient Former. 5. Insert the comb and allow the gel to polymerize for 2 h. 6. Remove the comb and wash the pockets with the electrophoresis buffer. 7. Apply samples (1–10 μL), mount the gel module in the preheated electrophoresis tank of the Bio-Rad D-Code System, and perform electophoresis at 60°C and 150 V for 2 h fol- lowed by 200 V for 1 h. 8. After the run, remove the supporting film with the gel on it, rinse in ddH2O, and fix in a solution of 10% ethanol and 0.5% acetic acid for 4 h to overnight with gentle shaking. 9. Rinse gel briefly in ddH2O. 10. Shake gently in a solution of freshly prepared silver stain solution for 20 min. 11. Rinse gel briefly in ddH2O. 12. Incubate the gel in developing solution with gentle shaking until the desired intensity of bands is obtained. 13. Rinse gel in ddH2O. 14. The gel can now be photographed or scanned. We usually capture and digitize the gel images using the Bio-Rad system, which includes a GS-710 Calibrated Imaging Densito- meter connected to a G3 Macintosh computer with the Diversity Database™ software. Images can be saved in formats compatible with a number of other image software such as Adobeº Photoshopº. 3.5. Quantitative Real-Time PCR of TEPGNB Genes 1. Amplify the control templates using the corresponding primer pairs (see Subheading 3.3., Tables 2 and 3, and also Notes 4 and 5). 2. Run a preparative agarose gel (TAE buffer, 0.8% agarose) electrophoresis with the whole PCR mix applied. 3. Stain the gel with ethidium bromide. 4. Excise the band from the gel corresponding to the expected size amplicon while viewing under long-wave UV light. 5. Extract DNA with the QIAquick Gel Extraction Kit. 6. Determine the molar concentration of the purified DNA spectrophotometrically. Serial dilutions of this DNA will be amplified in parallel with the experimental samples using a real-time PCR thermocycler and will be used for generating standard curves to quantify the corresponding target genes in experimental samples. 7. For each sample: to QuantiTect SYBR Green master mix, add primers (at final concentra- tion of 5 mM) and template, and then add RNase-free water from the kit to a final volume of 100 μL. Distribute 25-μL aliquots to four tubes in a 96-well PCR plate. 8. Prepare other samples and control mixes as described in step 7. Seal the plate and per- form PCR with initial denaturation/enzyme activation at 94°C for 10 min, followed by 45 cycles of two-step PCR consisting of 15-s denaturation at 94°C and 60-s annealing/exten- sion at 61°C.
- 30. 10 Aminov et al. 9. After the run, perform control analyses such as melting curve analysis and, if necessary, analyze the samples by agarose gel electrophoresis to verify the amplicon sizes. 10. Quantify the target gene concentration in experimental samples based on standard curves generated from the control tet templates. 4. Notes 1. Some DNA preparations obtained with the Mo Bio kits may still contain the substances inhibitory to PCR. If the concentration of your genomic DNA preparation is sufficiently high, then the sample may be diluted to decrease the concentration of these substances. Additional DNA purification may include phenol-chloroform-isoamyl alcohol (25:24:1) extraction and gel filtration. As a control for the suitability of DNA for PCR amplifica- tion, a PCR reaction with the universal bacterial primers 27f (5'AGAGTTTGATCM TGGCTCAG) and 1525r (AAGGAGGTGWTCCARCC) (44) can be performed. 2. In some cases, PCR amplification directly from samples (e.g., microbial isolates, tissue, and other biomasses) may be used, omitting the DNA extraction step. In our hands, suc- cessful amplification was done with the fresh colony biomass of laboratory Escherichia coli strains, Streptococcus spp., Enterococcus spp., Salmonella spp., and lactic acid bac- teria. For this, resuspend one-half of a 1–2-mm individual colony in 20 μL of sterile water and use 1–2 μL of this suspension as a template for PCR amplification. The initial dena- turation time at 94°C should to be extended to 10 min to allow better denaturation of cellular proteins and more complete release of genomic DNA into a PCR mix. This labor- and time-saving shortcut may be especially important when a large number of samples need to be examined. 3. The DNA markers for PCR-DGGE of tetracycline resistance genes can be generated from control strains (Table 3). 4. Real-time PCR is extremely sensitive, allowing detection of several target molecules in a reaction, and care should be taken to reduce the possibility of contamination during all steps, beginning with purity of reagents, preparation of genomic DNA, and mixing of the PCR components. First, all solutions, water, and equipment for genomic DNA isolation must be free of tetracycline resistance gene contamination. Many molecular biology labs perform routine cloning with plasmids and strains that possess tetracycline resistance markers, the most widely used being tet(C), tet(B), and tet(A). These genes may circulate in the lab environment and air and may contribute to false-positive signals in real-time PCR. All surfaces, pipets, tube stands, and so on have to be cleaned with 3% H2O2 and ethanol and then UV-irradiated. The use of aerosol-protected filter tips is highly recom- mended. Second, genomic DNA isolation from samples and control strains should prefer- ably be carried out separately to avoid crosscontamination. Third, mixing the components for real-time PCR should, if possible, be performed in a designated UV-treated box. 5. Albeit suitable for conventional PCR and PCR-DGGE, the TetC primer set (Table 2) produced an additional low-molecular-weight amplicon in real-time PCR. Therefore, this pair cannot be recommended for quantitative real-time PCR. References 1. Bergeron, M. G. and Quellette, M. (1995) Diagnosing bacterial infectious diseases in one hour: an essential upcoming revolution. Infection 23, 69–72. 2. Chopra, I. and Roberts, M. (2001) Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol. Mol. Biol. Rev. 65, 232–260. 1 2
- 31. Tetracyline Resistance Genes 11 3. Schnappinger D. and Hillen, W. (1996) Tetracyclines: antibiotic action, uptake, and resis- tance mechanisms. Arch. Microbiol. 165, 359–369. 4. Leyden, J. J. (2001) Current issues in antimicrobial therapy for the treatment of acne. J. Eur. Acad. Dermatol. Venereol. 15(suppl 3), 51–55. 5. Del Rosso, J. Q. (2000) Systemic therapy for rosacea: focus on oral antibiotic therapy and safety. Cutis 66(4 suppl), 7–13. 6. Johnson, L. R. and N. H. Stoller (1999) Rationale for the use of Atridox therapy for man- aging periodontal patients. Compend. Contin. Educ. Dent. 20, 19–25. 7. Tuckman, M., Petersen, P. J., and Projan, S. J. (2000) Mutations in the interdomain loop region of the tetA(A) tetracycline resistance gene increase efflux of minocycline and glycylcyclines. Microb Drug Resist. 6, 277–282. 8. Burdett, V. (1986) Streptococcal tetracycline resistance mediated at the level of protein synthesis. J. Bacteriol. 165, 564–569. 9. Burdett, V. (1991) Purification and characterization of Tet(M), a protein that renders ribo- somes resistant to tetracycline. J. Biol. Chem. 266, 2872–2877. 10. Manavathu E. K., Hiratsuka, K., and Taylor, D. E. (1988) Nucleotide sequence analysis and expression of a tetracycline resistance gene from Campylobacter jejuni. Gene 62, 17–26. 11. Manavathu E. K., Fernandez, C. L., Cooperman, B. S., and Taylor, D. E. (1990) Molecular studies on the mechanism of tetracycline resistance mediated by Tet(O). Antimicrob. Agents Chemother. 34, 71–77. 12. Roberts, M.C. (1996) Tetracycline resistance determinants: mechanisms of action, regula- tion of expression, genetic mobility, and distribution. FEMS Microbiol. Rev. 19, 1–24. 13. Sanchez-Pescador, R., Brown, J. T., Roberts, M. C., and Urdea, M. S. (1988) Homology of the Tet(M) with translational elongation factors: implication for potential modes of tet(M)-conferred tetracycline resistance. Nucleic Acids Res. 16, 1218. 14. Taylor D. E. and Chau, A. (1996) Tetracycline resistance mediated by ribosomal protec- tion. Antimicrob. Agents Chemother. 40, 1–5. 15. Levy, S. B. (1992) Active efflux mechanisms for antimicrobial resistance. Antimicrob. Agents Chemother. 36, 695–703. 16. Speer, B. S. and Salyers, A. A. (1989) Novel aerobic tetracycline resistance gene that chemically modifies tetracycline. J. Bacteriol. 171, 148–153. 17. Levy, S. B., McMurry, L. M., Burdett, V., et al. (1989) Nomenclature for tetracycline resistance determinants. Antimicrob. Agents Chemother. 33, 1373–1374. 18. Levy, S. B., McMurry, L. M., Barbosa, T. M., et al. (1999) Nomenclature for new tetracy- cline resistance determinants. Antimicrob. Agents Chemother. 43, 1523–1524. 19. Aminov, R. I., Garrigues-Jeanjean, N., and Mackie. R. I. (2001) Molecular ecology of tetracycline resistance: development and validation of primers for detection of tetracy- cline resistance genes encoding ribosomal protection proteins. Appl. Environ. Microbiol. 67, 22–32. 20. Melville, C. M., Scott, K. P., Mercer, D. K., and Flint, H. J. (2001) Novel tetracycline resistance gene, tet(32), in the Clostridium-related human colonic anaerobe K10 and its transmission in vitro to the rumen anaerobe Butyrivibrio fibrisolvens. Antimicrob Agents Chemother. 45, 3246–3249. 21. Pao, S. S., Paulsen, I. T., and Saier, M. H. (1998) Major facilitator superfamily. Microbiol. Mol. Biol. Rev. 62, 1–34. 22. Paulsen, I. T., Brown, M. H., and Skurray, R. A. (1996) Proton-dependent multidrug efflux systems. Microbiol. Rev. 60, 575–608. 3 4 5 6 7 8 9 10 12 13 14 15 16 17 18 19 20 21 22
- 32. 12 Aminov et al. 23. Aminov R. I., Chee-Sanford, J. C., Garrigues, N., et al. (2002) Development, validation, and application of primers for detection of tetracycline resistance genes encoding tetracy- cline efflux pumps in gram-negative bacteria. Appl. Environ. Microbiol. 68, 1786–1793. 24. Chee-Sanford, J., Aminov, R. I., Garrigues, N., Krapac, I., and Mackie, R. (2001) Occur- rence and diversity of tetracycline resistance genes in lagoons and groundwater underly- ing two swine production facilities. Appl. Environ. Microbiol. 67, 1494–1502 25. Sloan, J., McMurray, L. M., Lyras, D., Levy, S. B., and Rood, J. I. (1994) The Clostridium perfringens Tet P determinant comprises two overlapping genes: tetA(P), which mediates active tetracycline efflux, and tetB(P), which is related to the ribosomal protection family of tetracycline-resistance determinants. Mol. Microbiol. 11, 403–415. 26. Smith C. J., Rogers, M. B., and McKee, M. L. (1992) Heterologous gene expression in Bacteroides fragilis. Plasmid 27, 141–154. 27. Barbosa, T. M., Scott, K. P., and Flint, H. J. (1999) Evidence for recent intergenic transfer of a new tetracycline resistance gene, tet(W), isolated from Butyrivibrio fibrisolvens, and the occurrence of tet(O), in ruminal bacteria. Environ. Microbiol. 1, 53–64. 28. Nikolich, M. P., Shoemaker, N. B., and Salyers, A. A. (1992) A Bacteroides tetracycline resistance gene represents a new class of ribosome protection tetracycline resistance. Antimicrob. Agents Chemother. 36, 1005–1012. 29. Perreten, V., Schwarz, F., Cresta, L., Boeglin, M., Dasen, G., and Teuber, M. (1997) Antibiotic resistance spread in food. Nature 389, 801–802. 30. Charpentier, E., Gerbaud, G., and Courvalin, P. (1993) Characterization of a new class of tetracycline-resistance gene tet(S) in Listeria monocytogenes BM4210. Gene 131, 27–34. 31. Clermont, D., Chesneau, O., De Cespedes, G., and Horaud, T. (1997) New tetracycline resistance determinants coding for ribosomal protection in streptococci and nucleotide sequence of tet(T) isolated from Streptococcus pyogenes A498. Antimicrob. Agents Chemother. 41, 112–116. 32. Waters, S.H., Grinsted, J., Rogowsky, P., Altenbuchner, J., and Schmitt, R. (1983) The tetracycline resistance determinants of RP1 and Tn1721: nucleotide sequence analysis. Nucleic Acids Res. 11, 6089–6105. 33. Jorgensen, R. A. and Reznikoff, W. S. (1979) Organisation of structural and regulatory genes that mediate tetracycline resistance in transposon Tn10. J. Bacteriol. 138, 705–714. 34. Hillen, W. and Schollmeier, K. 1983. Nucleotide sequence of the Tn10 encoded tetracy- cline resistance gene. ucleic Acids Res. 11, 525–539. 35. Bolivar, F., Rodriguez, R. L., Greene, P. J., et al. (1977) Construction and characterization of new cloning vehicles, II. A multipurpose cloning system. Gene 2, 95–113. 36. Kim, E. H. and Aoki, T. (1994) The transposon-like structure of IS26-tetracycline, and kanamycin resistance determinant derived from transferable R plasmid of fish pathogen, Pasteurella piscicida. Microbiol. Immunol. 38, 31–38. 37. Marshall, B., Morrissey, S., Flynn, P., and Levy, S. B. (1987) A new tetracycline-resis- tance determinant, class E, isolated from Enterobacteriaceae. Gene 50, 111–117. 38. Aoki, T., Satoh, T., and Kitao, T. (1987) New tetracycline resistance determinant on R plasmid from Vibrio anguillarum. Antimicrob. Agents Chemother. 31, 1446–1449. 39. Zhao, J. and Aoki, T. (1992) Nucleotide sequence analysis of the class G tetracycline resistance determinant from Vibrio anguillarum. Microbiol. Immunol. 36, 1051–1060. 40. Hansen, L.M., McMurry, L. M., Levy, S. B., and Hirsh, D. C. (1993) A new tetracycline resistance determinant, Tet H, from Pasteurella multocida specifying active effux of tetra- cycline. Antimicrob. Agents Chemother. 37, 2699–2705. 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
- 33. Tetracyline Resistance Genes 13 41. Magalhaes, V. D., Schuman, W., and Castilho, B. A. (1998) A new tetracycline resistance determinant cloned from Proteus mirabilis. Biochim. Biophys. Acta 1443, 262–266. 42. Tauch, A., Puhler, A., Kalinowski, J., and Thierbach, G. (2000) TetZ, a new tetracycline resistance determinant discovered in gram-positive bacteria, shows high homology to gram-negative regulated efflux systems. Plasmid 44, 285–291. 43. Luo, Z.-Q. and Farrand, S. K. (1999) Cloning and characterization of a tetracycline resis- tance determinant present in Agrobacterium tumefaciens C58. J. Bacteriol. 181, 618–626. 44. Lane, D. J. (1991) 16S/23S rRNA sequencing, In: Nucleic Acid Techniques in Bacterial Systematics (Stackebrandt, E. and Goodfellow, M., eds.). John Wiley Sons, New York, pp. 115–175. 41 42 43
- 34. Antimicrobial Resistance Genes in S. enterica 15 15 From: Methods in Molecular Biology, vol. 268: Public Health Microbiology: Methods and Protocols Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ 2 Integron Analysis and Genetic Mapping of Antimicrobial Resistance Genes in Salmonella enterica serotype Typhimurium Mairéad Daly and Séamus Fanning 1. Introduction Antimicrobial resistance determinants may be transferred among bacteria via mobile genetic elements including plasmids, transposons, and the more recently explored integrons (1). Integrons are naturally occurring genetic elements found as part of the Tn21 transposon family or located on various broad host-range plasmids (2). The fun- damental integron structure consists of a 5'-conserved segment (5'-CS) of 1.4-kbp and a 2-kbp 3'-CS (3). Between these conserved regions are DNA sequences of variable length and molecular complexity. These intervening sequences are known as gene cassettes, and several have now been characterized (Fig. 1). Acquisition and dissemination of these genes located within the integron structure, results in an increase in antimicro- bial resistance (4). Three classes of integron structure have been described. Class 1 integrons are of principal importance in clinical isolates. The 5'-CS of class 1 integrons includes an intI 1 gene of 1358 bp, which encodes a specific recombinase, a member of the DNA integrase family (5). This gene contains the att1 recombination site, required for specifically integrating gene cassettes (Fig. 1). Classes 2 and 3 also contain integrase genes (intI 2 and intI 3), with the former showing 40% sequence identity to those of class 1, and the latter showing 61% (1). All three classes of integrons contain similar gene cassettes from the same families, which suggests the existence of a common pool of gene cas- sette with cross-specificity between the classes (1). When the 3'-CS region is examined in detail, it contains several open reading frames (ORFs). These include qacE61, which confers resistance to quaternary ammonium compounds, often associated with antiseptics, along with a sul1 gene expressing resis- tance to sulphonamide antimicrobial agents. The sul1 gene encodes the enzyme hydopteroate synthase. Transcription of the sul1 gene begins at a promoter located in
- 35. 16 Daly and Fanning the 5'-CS. The latter is also responsible for the transcription of the inserted gene cassette(s) (6). Two additional ORFs, ORF-5 and -6, are located toward the distal end of the 3'-CS. The gene product of ORF 5 appears to share some sequence similarity with puromycin acetyltransferase, and this feature suggests a possible role in antimi- crobial resistance (7). A biological function has yet to be ascribed to ORF-6. Gene cassettes are discrete mobile DNA elements, which may exist as free, circu- lar, nonreplicating DNA molecules (possibly) in transit from one genetic locus to another (8). They usually contain one gene along with a recognition sequence known as the 59-base element (59-be). The latter is a necessary component required for their integration into the larger mobile elements (i.e., integrons). Examples of gene cassettes commonly found in integrons include the aminoglycoside-modifying enzyme-encoding genes ant (3'')-1a, ant (2'')-1a, aac (3')-1, and aac (6')-1b, the `-lactamase-encoding genes, blaPSE-1, blaOXA-1, blaOXA-2, blaOXA-5, and blaCARB-3, genes conferring resis- tance to chloramphenicol (cat, cml), and dfr genes resulting in resistance to trimethoprim. Gene cassettes lack a functional promoter (9) and therefore cannot be transcribed until they are correctly positioned within an integron (10). Pant, the integron promoter responsible for controlling gene expression is located toward the 5'-end of the attI site, 214 bases from the inner boundary of the 5'-CS (Fig. 1). Thus these unusual genetic elements act as natural expression vectors (1,11). Salmonalla enterica serotype Typhimurium is recognized as a significant human pathogen. It is currently estimated that, of the 40,000 Salmonella isolates reported to the Centers for Disease Control and Prevention (CDC), 8.5% are identified as sero- type Typhimurium (12). These organisms are often simultaneously resistant to five or more common antimicrobial agents including ampicillin (A), chloramphenicol (C), streptomycin (S), sulphomamides (Su), and tetracycline (T). The increasing spectrum of resistance among Salmonella Typhimurium, definitive type (DT)104, has led sev- eral investigators to investigate the mechanism(s) of resistance acquisition. Antimi- crobial resistance in S. Typhimurium DT204c and DT193 has been entirely attributed to the presence of plasmids; however, DT104 represents an unusual case in that some of the resistance determinants have become chromosomally integrated (13). Resistance to sulfonamides when encountered is suggestive of the involvement of a class 1 integron. This is a useful phenotypic indicator, as it is a property attributed to class 1 integrons (as outlined above). Multiple drug-resistant (MDR)-DT104 of resis- Fig.1. Schematic representation of a class 1 integron structure. Several gene cassettes (hatched box) have been found located between the 5'- and 3'-CS. Often, more than one open reading frame (ORF) gene cassette can be found within the same integron, in the same orienta- tion, and transcribed from a common promoter located proximal to the 5'-site of insertion.
- 36. Antimicrobial Resistance Genes in S. enterica 17 tance (R)-type ACSSuT are often associated with the presence of two class 1 integrons, containing gene cassettes of 1.0 and 1.2 kbp. The former gene cassette contains ant(3')- 1a, conferring resistance to aminoglycoside antibiotics, streptomycin, and specti- nomycin; the 1.2-kbp gene cassette contains a blaPSE-1 gene, encoding a `-lactamase enzyme conferring resistance to `-lactam antibiotics including ampicillin. Fine genetic mapping studies have located these structures to the chromosome of S. Typhimurium DT104 within a highly conserved 10-kbp XbaI DNA fragment (13-15). This chromo- somal region has been described as a multiresistant gene cluster consisting of two integrons flanking an R-plasmid (16). Molecular analysis of antimicrobial resistance indicated that the same gene cassettes accounted for MDR-DT104 isolates from diverse geographical regions (14,17-20). The inserted gene cassettes described above may be recovered by DNA amplifica- tion using the previously characterized Int1 F and Int1 R primer set (2) (Table 1). In a standard polymerase chain reaction (PCR), the complete amplification of any inserted gene cassette(s) within a class 1 integron structure can be successfully achieved. A typical result, for a DT104 isolate of R-type ACSSuT, is shown in Fig. 2 (lane 1). Two intensely ethidium bromide-stained DNA fragments corresponding to the 1.0- and 1.2- kbp amplicons outlined previously are detected after conventional agarose gel electro- phoresis. These structures accounted for three (ASSu) of the five resistance traits normally associated with MDR-DT104 isolates (see below). Larger amplicons (approx 1.6 kbp [Fig. 2, lane 2]) have also been identified in S. Typhimurium isolates includ- ing phage types DT170a and -193. The amplicon shown in Fig. 2 (lane 2) contained two resistance genes, dfrI and aadA, fused in a classical head-to-tail fashion (15). Chloramphenicol acetyl transferases (CATs) are the enzymes most frequently reaponsible for resistance to chloramphenicol. However nonenzymatic mechanisms have also been described including efflux pumps, membrane transporter impermeabil- ity, and ribosomal modifications. A cmlA gene found in MDR-DT104 and recently described by Briggs and Fratamico (14) encodes an exporter enzyme and not the more common acetyltransferase. The floR gene, which belongs to the MDR efflux pump family of proteins, was described (16) and is responsible for cross-resistance to chloramphenicol and florfenicol. The floR gene is located downstream of the integron containing the ant (3)-1a gene cassette. Distal to the floR gene are the tetRA genes (class G tetracyclines). Tetracycline resistance arises as a result of the production of an efflux pump. These resistance determinants are located on the integrated R-plas- mid, outlined above. The R-type pattern ACSSuT can therefore be accounted for by the presence of this conserved MDR locus on a 10-kpb Xba1 digested DNA fragment. However, addi- tional resistances to trimethoprim and fluoroquinolones are now being encountered in MDR-DT104 isolates (15). Trimethoprim resistance can arise owing to the presence of a nonconjugative but mobilizable 4.6-MDa plasmid, which can also encode resis- tance to sulphonamides (SuTp). Genes associated with trimethoprim resistance (includ- ing those of the dfr gene family), expressing a dihydrofolate reductase enzyme, have also been found in integrons (15). Considering the nature of integrons, this presents an opportunity for trimethoprim resistance determinants to become chromosomally inte-
- 37. 18 Daly and Fanning grated. A larger second plasmid of 60-MDa is also found in DT104s of R-type ACSSuT; however, this plasmid has not been linked with antimicrobial resistance but rather contains virulence determinants (13,21). Salmonella plasmid virulence (spv) genes are carried on this plasmid. The presence of putative resistance islands can be investigated using a combination of molecular approaches including pulsed-field gel electrophoresis (PFGE), Southern blotting and probe hybridization experiments. PFGE is a useful molecular typing pro- tocol, wherein the complete bacterial chromosome is investigated with a rare cutting restriction endonuclease (22). The macrodigested DNA fragments produced must be resolved by PFGE. These can then be denatured to yield single-stranded DNA frag- ments and transferred by Southern blotting to nylon membranes. Selected molecular probes for hybridization can be conveniently prepared by PCR, with the specific primer sets outlined in Tables 2 and 3. For example, when making the blaPSE-1 probe, the primer set given was used to amplify a segment of the pse gene from the gene cassette. In this case the int1 primer set is not used for probe generation purposes, as the flanking sequences are common among many gene cassettes and may lead to false-positive hybridization signals. Fur- thermore, the PFGE profiles may also provide epidemiological data and can be ana- lyzed to indicate the genomic relationships of isolates (Fig. 3A) prior to Southern blotting. Suitably labeled molecular weight markers must be included for size deter- mination, and these must be chosen depending on the type of hybridization and detec- tion system used. When a digoxigenin (DIG)-labeling and detection system is used, prelabeled molecular weight markers can be included in two or three gel lanes. Once Table 1 Sequence and Characteristics of Oligonucleotide Primers Used for PCR PCR Sequence Conc. per T-annealing Primer 5' 3' reaction (pmol) % GC (°C) IntI1 F GGC ATC CAA GCA GCA AGC 25 61 55 IntI1 R AAG CAG ACT TGA CCT GAT 25 44 55 sul1 F CTT CGA TGA GAG CCG GCG GC 25 70 65 sul1 R GCA AGG CGG AAA CCC GCG CC 25 75 65 qac E61 F ATC G2CA ATA GTT GGC GAA GT 25 45 55 qac E61 R CAA GCT TTT GCC CAT GAA GC 25 50 55 ant(3)-1a F GTG GAT GGC GGC CTG AAG CC 25 70 65 ant(3)-1a R ATT GCC CAG TCG GCA GCG 25 67 65 pse-1 F CGC TTC CCG TTA ACA ACT AC 25 55 55 pse-1 R CTG GTT CAT TTC AGA TAG CG 25 45 55 dfrI F GTG AAA CTA TCA CTA ATG GTA GCT 25 37 65 dfrI R ACC CTT TTG CCA GAT TTG GTA ACT 25 42 65 flo F ACC CGC CCT CTG GAT CAA GTC AAG 25 58 70 flo R CAA ATC ACG GGC CAC GCT GTA TC 25 54 70
- 38. Antimicrobial Resistance Genes in S. enterica 19 Fig.2. Amplified gene cassettes of two representative strains of Salmonella enterica sero- type Typhimurium. After PCR, 10 μL of the amplified reaction mixture was loaded into a 1% (w/v) agarose gel in 1X Tris-EDTA-acetate (TAE) buffer containing 0.1 μg of ethidium bro- mide per mL. Samples were horizontally electrophoresed at 80 V for 60 min. The lanes marked M contain an equal mixture of molecular weight markers grade III (ranging in size from 0.56 to 21.2 kb) and molecular weight markers grade V (ranging in size from 8 to 597 bp; Roche Diagnostics). Lane 1, CIT-F45, DT 104 isolate, containing two integrons with gene cassettes of 1.0 and 1.2 kbp; lane 2, CIT-F41, DT 193 isolate, containing one integron carrying a gene cassette with two ORFs, producing a PCR amplicon of 1.6 kbp. Table 2 Thermocycler Programs, Step Design, Cycle Number, and Corresponding Citation Used With Oligonucleotide Primersa PCR Step 1 Step 2 Step 3 Step 4 program Predenaturation Denaturation Annealing Extension No. of cycles Ref. IntI1 95°C, 5 min 95°C, 1 min 55°C, 1 min 72°C, 2 min 30 2 sul1 95°C, 5 min 95°C, 1 min 65°C, 1 min 72°C, 2 min 30 24 qac E61 95°C, 5 min 95°C, 1 min 55°C, 1 min 72°C, 2 min 30 6 ant(3)-1a 95°C, 5 min 95°C, 1 min 65°C, 1 min 72°C, 2 min 30 25 pse-1 95°C, 5 min 95°C, 1 min 55°C, 1 min 72°C, 2 min 30 26 dfrI 95°C, 5 min 95°C, 1 min 68°C, 1 min 72°C, 1 min 30 15 flo 95°C, 5 min 95°C, 1 min 70°C, 1 min 72°C, 1 min 30 16 aA final extension step of 72°C for 5 min was incorporated into each program; the samples are then maintained at 4°C until analysis.
- 39. 20 Daly and Fanning Fig. 3. (opposite page) The lanes marked M contain DIG-labeled DNA molecular weight marker grade II (Roche Diagnostics). Unlabeled mid-range PFG markers (New England BioLabs) in lane M* were included for fragment sizing before Southern transfer. Lane 1, CIT- V38; lane 2:CIT-F45; lane 3, CIT-H164; lane 4, CIT-H176; lane 5, CIT-H183; lane 6, CIT- V115; lane 7, CIT-F107; lane 8, CIT-H144; lane 9, CIT-V37; lane 10, CIT-F34; lane 11, CIT-F41; lane 12, CIT-F44; lane 13, CIT-V60; lane 14, CIT-V75; lane 15, CIT-V127; lane 16, CIT-V129; lane 17, CIT-F40; lane 18, CIT-F105; lane 19, CIT-H195; lane 20, E. coli R100.1 (control isolate); and lane 21, E. coli R751 (control isolate). (A) Pulsed-field gel electrophoresis Table 3 Southern Blotting of Salmonella Typhimurium Isolates and Probe Hybridization Using Selected Gene Cassettes 10-kb XbaI Probe hybridization Phage type R-type fragment ant (3)-Ia pseI dfrI DT104 CIT-V38 ACSSuT + + + – CIT-H164 ACSSuT + + + – CIT-H176 ACSSuTTp + + + – CIT-H183 SSu – – – – CIT-V115 ACSSuT + + + – CIT-F44 ASu – – – – DT104 related CIT-F107 (104b) ACSSuTK + + + – CIT-H144 (104b) ACSSuTTp + + + + CIT-V37 (U302) ACSSuTTp + + + – DT193 CIT-F34 ASSuTN – + + + CIT-F41 ASSuTTp – + + + DT195 CIT-V60 SuTTp – – – – DT208 CIT-V75 T – – – – DT170a CIT-V127 ASSuTTp – + + + CIT-V129 SuTTp – – – – Nontypable CIT-F40 Sensitive – – – – CIT-F105 SuTp – – – – CIT-H195 SuTp – + + – Controls E. coli R100.1 – + + + E. coli R751 – + + – ant (3)-1a, aminoglycoside modifying enzyme coding gene; pseI, `-lactamase gene; dfrI, dihydrofolate reductase gene; R-type, antimicrobial resistance pattern; A, ampicillin; C, chloroamphenicol; S, streptomycin; Su, sulphonamides; T, tetracycline; N, nalidixic acid; K, kana- mycin; V, veterinary; H, human; F, food.
- 40. Antimicrobial Resistance Genes in S. enterica 21 (Fig. 3. continued) profiles of Salmonella Typhimurium isolates digested with XbaI following electrophoresis through 1% (w/v) SeaKem Gold agarose in 0.5X TBE for 18 h at 10.5°C. Elec- trophoresis was performed at 200 V using a Gene Navigator system (Pharmacia) in the interpo- lation mode pulsing from 1 through 40 s. (B) Following pulsed-field gel electrophoresis the XbaI macrorestricted DNA fragments were transferred to nylon membranes. Individual gene cassettes were then used to probe the membranes. Southern blot using the blaPSE-1 gene as a probe.
- 41. 22 Daly and Fanning the PFGE patterns are analyzed, DNA is transferred as an exact pattern replica onto a nylon membrane or other suitable solid phase. The membrane can then be hybridized with a specific antimicrobial resistance gene probe and the location of any hybridizing signal(s) generated detected visually (Fig. 3B). This entire procedure must be repeated for each new probe and the position of the hybridizing signal recorded each time. One possible limitation to this approach is the time required, as several replica sets of PFGE gels must be produced, transferred to nylon membranes, and subsequently probed. However, it is an advantage, if several agarose slices are digested simultaneously for PFGE (see Note 1). Figure 3B shows the results of a hybridization experiment using the blaPSE-1 gene probe with the isolates listed in Table 3. The corresponding PFGE patterns are shown in Fig. 3A. A signal was detected for the DT104 isolates of R-type ACSSuT at approx 10 kbp. A similar result was obtained when using the ant (3)-1a and the flo gene probes sequentially. This indicated that these genes are located within the same region on the S. Typhimurium genome. Larger fragments in non-DT104s can also be seen, the largest of which is 112 kbp (Fig. 3B, lane 15). This isolate (CIT-V127, Table 3) also had a hybridization signal at this position when probed with ant (3)-1a and dfrI (Table 1). Analysis of hybridization signals from the various gene probes can therefore identify multiresistant gene clusters in bacterial isolates. 2. Materials All reagents marked with an asterisk (*) are autoclaved at 121°C for 15 min prior to use. 2.1. DNA Extraction This following protocol is a general purification method for Gram-negative organ- isms (23), yielding good-quality DNA templates (see Note 2). 1. All S. Typhimurium isolates used in this study are listed in Table 3. 2. Tryptone soya broth (TSB*; Oxoid, Hampshire, UK): dispensed in 5-mL volumes into sterile universal containers. 3. 1 M NaCl*. 4. TE solution*: 50 mM Tris-HCl, pH 8.0, 50 mM EDTA. 5. Lysozyme: obtained lyophilized from Sigma (Poole, UK), dissolved in sterile distilled water to a final concentration of 2 mg/mL, aliquoted, and stored at –20°C. 6. 20% (w/v) Sodium dodecyl sulfate (SDS). 7. Proteinase K: obtained lyophilized from Sigma, reconstituted in sterile distilled water to a final concentration of 10 mg/mL, aliquoted, and stored at –20°C. 8. Phenol/chloroform: isoamylalcohol (25:24:1; Sigma), saturated with 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. 9. 3 M Ammonium acetate, filter-sterilized, and stored at room temperature. 10. 70 and 100% (v/v) ethanol stored at –20°C. 11. 1X TE solution*: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. 2.2. Polymerase Chain Reaction 1. Deoxyribonucleoside triphosphates (dNTPs; Promega, Madison, WI), stock concentra- tion of 100 mM. Prepare a working concentration of 1.25 mM dNTPs by mixing 2.5 μL of
- 42. Antimicrobial Resistance Genes in S. enterica 23 each (dATP, dCTP, dGTP, and dTTP) with 190 μL of sterile distilled water (final volume 200 μL). Store at –20°C until required. 2. 2.5 UTaq DNA polymerase (Promega). The enzyme is supplied with 25 mM MgCl2 and 10X reaction buffer (100 mM Tris-HCl, pH 9.0, 500 mM KCl, 1% Triton X-100). 3. Sterile distilled water. 4. Oligonucleotide primers: all primers used for integron and gene cassette analysis were synthesized by Oswel (Southampton, UK) and purified by high-performance liquid chro- matography (HPLC). These primer sequences together with their relevant characteristics are listed in Table 1. 2.3. Conventional Agarose Gel Electrophoresis 1. ultra PURE agarose, electrophoresis grade from GibcoBRL Life Technologies (Paisley, Scotland). Gelling temperature 36-42°C. 2. 10 mg/mL Ethidium bromide in distilled water (stored in a dark bottle). 3. 10X TAE buffer: 400 mM Tris-HCl, pH 7.8, 400 mM glacial acetic acid, and 2 mM EDTA; working concentration 1X. 4. Loading dye: prepared by mixing 100 μL of 10% (w/v) bromophenol blue with 6.6 mL glycerol and 3.3 mL 10X TAE. 5. Molecular weight markers: several preparations of molecular weight markers are avail- able, and the choice of a suitable marker is made based on the expected size of the ampli- fied DNA fragment(s). Usually grades III and V molecular weight markers from Roche Diagnostics (East Sussex, UK) are used, and these have the following known DNA frag- ments: a. DNA molecular weight marker III: consists of 13 DNA fragments ranging in size from 0.12 to 21.2 kbp; prepared by cleaving h DNA with EcoRI and HindIII (250 μg/mL). b. DNA molecular weight marker V: consists of 22 DNA fragments ranging in size from 8 to 587 bp; prepared by cleaving pBR322 with HaeIII (250 μg/mL). 2.4. Pulsed-Field Gel Electrophoresis 2.4.1. Preparation of Agarose Plugs 1. Nutrient agar plates (Oxoid). 2. 1-mL Sterile plastic syringes with the nozzle removed. 3. Saline 0.85% (w/v) NaCl. 4. TEN buffer: 100 mM Tris-HCl, pH 7.5 100 mM EDTA. 5. Incertº agarose (FMC BioProducts, Vallesbaek Strand, Denmark). 6. 20 mg/mL Proteinase K in distilled water. Store at –20°C. 7. Lysis buffer: 6 mM Tris-HCl, pH 7.6, 1 M NaCl, 100 mM EDTA, pH 7.6, 0.5% (w/v) Brij-58 (polyoxyethylene-20-cetyl-ether), 0.2% (w/v) sodium deoxycholate, 0.5% (w/v) sarkosyl. Filter-sterilize and store at 4°C. 8. 400 mM EDTA, pH 9.3, 1% (w/v) sarkosyl. 9. 1X TE*: 100 mM Tris-HCl, pH 7.6, 100 mM EDTA, pH 7.6, 150 mM NaCl. 2.4.2. Restriction Endonuclease Digestion of Agarose Slices 1. DNS buffer: 100 mM Tris-HCl, pH 8.0, 5 mM MgCl2. 2. RNAse super stock: RNAse obtained from Sigma, diluted to 10 mg/mL with sterile dis- tilled water, and frozen at –20°C in 1-mL aliquots.
- 43. 24 Daly and Fanning 3. RNase A 1:100 dilution: prepared by mixing; 200 μL RNAse A super stock, 200 μL Tris- HCl, pH 7.5, 75 μL 4 M NaCl, and 19.5 mL sterile distilled water in a sterile glass univer- sal. Boil this mixture for 15 min, allow to cool gradually to room temperature in a water bath, and freeze 1-mL aliquots at –20°C. 4. 1 M MgCl2 (Sigma). 5. BNE (buffer with no restriction enzyme): mix 5 μL 10X restriction enzyme buffer with 5 μL 1:100 RNAse A dilution and 40 μL sterile distilled water, per sample. 6. BWE (buffer with restriction enzyme): same as for BNE (in step 5 above) but with 2 μL of the appropriate restriction enzyme and only 38 μL of sterile distilled water. 7. 10 U/μL XbaI restriction endonuclease. 2.4.3. Electrophoresis of Pulsed-Field Gels 1. SeaKemº Gold agarose (FMC BioProducts). 2. 5X Tris-borate-EDTA (TBE): 450 mM Tris-HCl, pH 8.3; 450 mM borate, pH 8.3; 10 mM EDTA (working concentration of 0.5X TBE). 3. 10 mg/mL Ethidium bromide. 4. Molecular weight markers: low-range and mid-range PFG markers embedded in 1% (w/v) low melting point (LMP) agarose supplied by New England BioLabs (Hertfordshire, UK). In addition, a DIG-labeled marker is also used to facilitate size determination from the colored developed blots: DNA molecular weight marker grade II, DIG-labeled, consist- ing of eight fragments ranging in size from 125 to 23,130 bp (Roche Diagnostics). 2.4.4. Visualization of DNA Bands Ethidium bromide solution at a final concentration of 0.5 μg/mL in distilled water. 2.5. Southern Blotting of Pulsed-Field Gels 2.5.1. DNA Transfer From Pulsed-Field Gels to Nylon Membranes 1. Depurination buffer*: 0.5 M HCl. 2. Denaturing buffer*: 0.5 M NaOH, 1.5 M NaCl. 3. 20X SSC*: 3 M NaCl, 0.3 M sodium citrate, pH 7.0. 4. Neutralizing buffer*: 0.5 M Tris-HCl, pH 7.0, 1.5 M NaCl. DNA transfer of pulsed-field gels was achieved using a Vacu-Aid Blot processing Pump (Hybaid, Middlesex, UK) onto positively charged nylon membranes (Roche Diagnostics) (see Note 3). 2.6. Preparation and Detection of Digoxigenin (DIG)-Labeled Probes 2.6.1. Preparation of DIG-Labeled Probes 1. DIG-labeled dUTP, at a concentration of 1 nmol/μL (DIG-11-dUTP; Roche Diagnostics). 2. 4 M Lithium chloride. 3. Cold 100% ethanol. 4. Cold 70% (v/v) ethanol. 2.6.2. Hybridization and Detection A DIG-DNA labeling and detection kit obtained from Roche Diagnostics was used for probe hybridization and for color detection of hybridization events.
- 44. Antimicrobial Resistance Genes in S. enterica 25 The solutions required are as follows: 1. Hybridization buffer: 5X SSC (1:4 dilution of 20X SSC), 1% blocking solution (from kit), 0.1% (w/v) N-lauroyl-sarcosine, 0.02% (w/v) SDS. 2. Wash solution A: 2X SSC, 0.1% (w/v) SDS (for 500 mL combine 50 mL 20X SSC, 450 mL sterile distilled water, and 0.5 g SDS). 3. Wash solution B: 0.1% SSC, 0.1% (w/v) SDS (for 500 mL combine 2.5 mL 20X SSC, 497.5 mL sterile distilled water, and 0.5 g SDS). 4. Buffer 1: maleic acid buffer; 0.1 M maleic acid, 0.15 M NaCl; adjust pH with NaOH to pH 7.5 (see Note 4). 5. Buffer 2: blocking buffer; dilute 10X blocking solution in buffer 1 (maleic acid buffer) to 1X final concentration. 6. Buffer 3: detection buffer; 0.1 M Tris-HCl, pH 9.5, 0.1 M NaCl, 50 mM MgCl2. 3. Methods 3.1. DNA Extraction This extraction method is a modification of the procedure described by Versalovic et al. (23). 1. Grow bacterial cells overnight in 5 mL TSB at 37°C and then pellet by centrifugation at 15,000g for 2 min. 2. Wash the cell pellet with 1 mL of 1 M NaCl followed by 1 mL TE solution (50 mM Tris- HCl [pH 8.0], 50 mM EDTA) and then resuspend in 0.7 mL TE solution (see Note 5). Transfer the cells to 1.5-mL Eppendorf tubes. 3. Add 100 μL lysozyme (2 mg/mL) to the cells and incubate at 37°C for 30 min. To com- plete lysis, add 30 μL of 20% (w/v) SDS and incubate at 65°C for 10 min. This is fol- lowed by the addition of 60 μL proteinase K (10 mg/mL) and returning the cells to 37°C for 1 h (see Note 6) 4. The protein must then be extracted from this crude nucleic acid preparation by perform- ing two phenol/chloroform extractions: Add 800 μL phenol/chloroform/isoamylalcohol (25:24:1) to the lysate mixture and invert the tubes vigorously for 5 min. Centrifuge the samples for 5 min at 20,000g and then transfer the top aqueous phase (containing the DNA) to a new 1.5-mL tube. Repeat the phenol/chloroform extraction on the aqueous phase. 5. After the second extraction, precipitate the DNA by adding a 1:10 volume of 3 M ammo- nium acetate and cold 100% ethanol to fill the 1.5-mL Eppendorf tube and place at –20°C to precipitate overnight (see Note 7). 6. After precipitation, centrifuge the DNA samples at 18,000g for 30 min at 4°C. Wash the DNA pellet with 70% ethanol, remove all ethanol with a pipet tip, and dry the DNA by leaving the tubes open on the bench for 5 min. Finally, resuspend in 200 μL 1X TE solution. 3.2. Polymerase Chain Reaction 3.2.1. Integron and Gene Cassette Amplification 1. Amplification of gene cassettes located between the 5' conserved segment and the 3' con- served segment of class I integrons is performed in a final volume of 50 μL.
- 45. 26 Daly and Fanning 2. For each reaction combine 5 μL 25 mM MgCl2, 5 μL 10X reaction buffer, 8 μL working stock dNTPs to give a final concentration of 0.2 mM each (dATP, dCTP, dGTP, and dTTP), 100 ng of template DNA, and 2.5 U Taq DNA polymerase (5 U/μL). 3. All primers are used at a concentration of 25 pmol per reaction (Table 1), and reaction conditions are given in Table 2. A wide range of thermocyclers are available for PCR; the MiniCycler» (MJ Research, Watertown, MA) is compact (if laboratory space is limited) and has proved very reliable. 3.3. Agarose Gel Electrophoresis 1. Prepare a 1.5% (w/v) agarose gel by mixing 1.5 g agarose and 100 mL 1X TAE (see Note 8). Heat gently in a microwave oven until the agarose bubbles, mix briefly, reduce the heat, and simmer for 30 s. Allow the gel to cool to 60°C and then add 1 μL of ethidium bromide (10 mg/mL). Mix in carefully and pour into the gel mold with the well comb in place. 2. Allow the gel to solidify for 20–30 min and then pour 1X TAE buffer containing 0.5 μg/mL Ethidium Bromide into the electrophoresis tank until it just covers the surface of the gel. Remove the comb and mold barriers (if present). 3. Prepare the samples by combining 10 μL each PCR with 3 μL loading dye and load into the preformed wells. 4. Electrophoresis times vary from approx 1 h at 80 V for smaller gels (6.5 × 8.0 cm) to 1.5– 2 h at 100 V for larger gels (11.5 × 14 cm). 5. The ethidium bromide-stained fragments can be viewed and photographed with a UV transilluminator, e.g., from UVP (Ultra-Violet-Products, Cambridge, UK), using Phoretix software (Newcastle-upon-Tyne, UK). 3.4. Pulsed-Field Gel Electrophoresis 3.4.1. Preparation of Samples in Agarose Plugs for Pulsed-Field Gel Electrophoresis Day 1: 1. For each strain to be analyzed plate out a single colony onto a nutrient agar plate and incubate overnight at 37°C. 2. Take one 1.5-mL Eppendorf tube per isolate and weigh the tube to 2 decimal places. Record the weights and add 1 mL of saline to each tube. Leave on the bench overnight. Day 2: 1. Using a disposable inoculating loop, remove a large inoculum of each isolate from the agar plates and place in the saline. Mix well and centrifuge at 8500g for 2 min. 2. Remove the saline by pipeting and repeat this step twice. After the last wash fully aspirate any remaining saline and reweigh each Eppendorf tube to get the precise weight of the pellet. Resuspend the pellet in an equal volume of saline, to the nearest 10 (i.e., if the pellet weighs 0.038 g, add 40 μL saline). These tubes now represent stock samples. 3. To prepare a working suspension, mix 5 μL of each stock sample with 10 μL of saline and then to each of these working suspensions add 225 μL of TEN and mix. 4. Prepare 250 μL of 2% (w/v) Incert agarose for each sample (plus 250 μL extra), by combin- ing the required amount of agarose with sterile distilled water in a heat-proof capped tube. Boil the agarose for 15 min, mixing occasionally, and then allow to cool to approx 50°C.
- 46. Antimicrobial Resistance Genes in S. enterica 27 5. Working quickly, add 230 μL of agarose to each sample, mix well using a 1-mL pipete tip (see Note 9) and aspirate into a syringe barrel. Seal the opening of the syringe with Parafilm and place on ice for 15–20 min. 6. When plugs have solidified, push them out into 10-mL tubes, add 2 mL of EC buffer to each tube, and put gently shaking at 37°C for 5 h. 7. After 5 h aspirate the EC buffer and add 3 mL TE buffer. Aspirate the TE buffer and add another 3 mL of TE buffer and then place the tubes on a gently shaking platform for 10 min. Aspirate the TE buffer, and then to each sample add 2 mL freshly prepared ES buffer and 100 μL proteinase K (20 mg/mL). Place in a shaking waterbath at 50°C overnight. Day 3: 1. Remove all samples from the waterbath and place them on ice for 10 min. Aspirate the ES buffer from each plug and wash the plugs in 3 mL TE buffer. Immediately replace the TE buffer with fresh TE and incubate with gentle shaking for 1 h. 2. Repeat this procedure for a total of four washes. The plugs can now be stored in fresh TE buffer at 4°C until ready for restriction digestion. 3.4.2. Restriction Endonuclease Digestion of Genomic DNA Embedded in Agarose Plugs 1. Aliquot 300 μL of DNS buffer into the required number of Eppendorf tubes. 2. Chill the samples to be digested on ice for 10 min. Remove the surrounding TE buffer and aspirate the solid plug back into the syringe barrel originally used for preparing the plug. 3. Using a sterile scalpel, previously flamed with alcohol, slice 1-mm-thick pieces from the plug into the tubes containing the DNS buffer (see Note 1). Immediately replace the buffer with fresh DNS. Incubate the samples at room temperature for 1 h. Repeat this step for a total of four washes. 4. After aspirating of final wash, add 50 μL BNE to all tubes and incubate for 1 h at 4°C. Replace the BNE with 50 μL BWE, refrigerate for 2 h (at 4°C), and then place at 37°C for 12–20 h. 5. After incubation, add 250 μL 0.5X TBE to all tubes to stop the enzyme digestion. Samples can now be stored at 4°C or run immediately. 3.4.3. Preparation and Loading of Pulsed-Field Gels 1. Prepare a 1% (w/v) agarose gel by mixing 1.1 g of SeaKem Gold agarose with 110 mL 0.5X TBE buffer in a conical flask. Record the weight of the flask along with its contents. 2. Heat the agarose on full power in a microwave oven until boiling. Reduce the heat until the agarose bubbles very gently for 3 min. Mix the agarose by gently swirling the flask (see Note 10) and reheat for a further 3 min. Reweigh the flask and replace the moisture loss with hot distilled water. 3. Allow the agarose to cool to 60°C before casting the gel mold. Leave to solidify for 30 min at room temperature. 4. Finally, pre-electrophorese the gel (prior to loading the samples) for 1.5 h under sample run conditions to improve resolution of DNA bands. Alternatively, place the gel in the electrophoresis tank and allow the 0.5X TBE buffer to wash the gel overnight. 5. Load the prechilled, digested agarose slices into the corresponding wells in the agarose gel with the aid of a glass coverslip and an inoculating loop. 6. Seal the wells with molten 1% (w/v) agarose before applying electric current. Samples are electrophoresed through the homogenous field using a Gene Navigatorº System (Pharmacia Biotech, Uppsala, Sweden) or other similar PFGE system, with a hexagonal
- 47. 28 Daly and Fanning (HEX) electrode array. The running buffer consists of 2.5 L of 0.5X TBE, and the follow- ing run conditions are applied: 200 V at 10.5°C for 18 h with pulse times ramped from 1 to 40 s. 3.4.4. Visualization of DNA Bands 1. Following electrophoresis, stain the gel for 30 min with an ethidium bromide solution (0.5 μg/mL). This may be followed by destaining in distilled water for 1–2 h. 2. All ethidium bromide-stained DNA fragments can then be directly viewed and photo- graphed over a UV transilluminator (Ultra-Violet-Products). A permanent record is main- tained either electronically by creating a TIFF file using suitable capture software such as Phoretix software, or a standard photograph can be taken. 3.5. Southern Blotting 3.5.1. Transfer of DNA From Agarose Gels to Nylon Membranes DNA transfer from the PFGE gels to nylon membranes can be achieved efficiently using vacuum blotting with the Hybaid Vacu-aid apparatus (see Note 3). 1. Cut a piece of 3MM filter paper such that it is approx 2–4 cm larger than the gel to be blotted, and prewet the filter paper in 2X SSC (prepared by diluting 20X SSC 1:10 with sterile distilled water). 2. Being careful not to touch the membrane, cut it so that it is slightly (0.5 cm) larger than the gel. Again, prewet it in transfer buffer for 3–5 min. 3. Assemble the Vacu-aid (or similar device) as outlined in the manufacturer’s instructions, and overlay the membrane with the gel. 4. The blotting process is greatly accelerated with the in situ pretreatment steps. First, apply the vacuum and add depurination solution. Allow this solution to penetrate the gel for 10 min and then replace it with denaturation solution for 10 min followed by the neu- tralization solution, also for 10 min. Start the transfer by overlaying the gel with 20X SSC and allow transfer to proceed for at least 1 h (see Note 11). 5. Once the transfer is complete, rinse the membrane in 2X SSC and place it on fresh filter paper to air-dry completely. 6. Fix the DNA to the membrane either by crosslinking in a UV crosslinker or by wrapping the membrane in aluminium foil and baking at 80°C for 1 h. The membrane is now ready for DNA probe hybridization. 3.6. Preparation and Detection of DIG-Labeled Probes 3.6.1. Preparation of DIG-DNA Gene Probes 1. Incorporation of a DIG label can be achieved using 1 μL of DIG-labeled dUTP (DIG-11- dUTP) in the integron PCR reaction mixture as previously outlined in Subheading 3.2. 2. After the labeling reaction, recover the probe by precipitating in a mixture containing 2 μL 4 M LiCl and 50 μL cold ethanol (100%). 3. Allow the probe to stand for 2 h at –20°C, followed by a centrifugation step at 18,000g for 15 min. 4. Decant the surrounding ethanol and wash the pellet (see Note 12) with 70% (v/v) cold ethanol. Centrifuge for 5 min at 18,000g, fully aspirate the ethanol, and allow the pellet to air dry for 5 min. 5. Resuspend the pellet in 50 μL 1X TE and solubilize the probe at 37°C for 30 min. Place the probe in 10 mL hybridization solution and store at –20°C until required.
- 48. Antimicrobial Resistance Genes in S. enterica 29 3.6.2. Hybridization With DIG-DNA Probes 1. Prewarm the hybridization buffer to 58°C for Southern blots of PFGE gels. Place the membrane in a hybridization bottle with approx 50 mL prewarmed hybridization solution and incubate in a hybridization oven at 58°C for 1 h (see Note 13). 2. Boil the probe for 10 min to ensure that the DNA is completely denatured and cool rap- idly in ice water for an additional 10 min. Remove the hybridization solution from the membrane, add the denatured probe, and allow to hybridize overnight at 58°C with con- stant agitation of the hybridization-probe solution. This is achieved in the hybridization bottle simply by rotating it. This step should continue for a period of 18 h. 3. Following probe-hybridization, remove the probe and freeze it at –20°C for later use (see Note 14). 4. Wash the membrane twice with wash solution A at room temperature for 5 min per wash, and wash twice with wash solution B at 68°C for 15 min per wash, with constant shaking. 3.6.3. Color Detection of the Hybridized DIG Label 1. Rinse the membrane briefly in buffer 1 (maleic acid buffer), and then incubate the mem- brane for 30 min with 300 mL buffer 2 (blocking buffer) at room temperature. 2. Dilute anti-DIG-AP conjugate to 150 mU/mL (1:5000 dilution) in buffer 2 per the manu- facturers instructions (8-μL conjugate in 40 mL buffer 2) and incubate the membrane for a further 30 min with the antibody conjugate. 3. Remove unbound antibody conjugate by washing twice with 300 mL buffer 1 for 15 min for each wash at room temperature. Then equilibrate the membrane in approx 60 mL detection buffer for 2–5 min followed by incubation with 30 mL freshly prepared color solution (600 μL NBT/BCIP in 30 mL buffer 3), in a sealed plastic bag (see Note 15). 4. Once the color solution is added, place the membrane in the dark and do not shake. Allow the color to develop, which could take from several minutes to several hours. 5. After color development, wash the membrane in 1X TE or in sterile distilled water for a few minutes and then allow the membrane to dry before photographing and recording results. 4. Notes 1. When cutting the gel slices for restriction digests, it is useful to cut several slices together and digest them all at once in the same tube. This is particularly advantageous if the samples are to be electrophoresed more than once for hybridization with several probes. 2. The DNA extraction protocol outlined here can also be used for Gram-positive bacteria. However, note that lysozyme is not effective against Gram-positive bacterial cells and therefore must be substituted for by using mutanolysin (50–100 U per sample) or lyso- staphin (50–100 U per sample) for staphylococcal isolates. 3. The transfer of immobilized DNA fragments by Southern blotting can be greatly acceler- ated when using a vacuum-based blotting device. Denaturation, depurination, neutraliza- tion, and transfer of DNA to the solid-phase membrane can be achieved in under 2 h. Transfer can also be achieved using more traditional and slower methods including capil- lary action through multiple layers of filter paper. 4. When preparing the maleic acid buffer, to achieve the required pH 7.5, approx 7 g of NaOH per liter are required. Add the sodium hydroxide pellets carefully and allow them to dissolve, check the pH, and then add less concentrated NaOH until the desired pH is reached. Caution: Be aware that granular NaOH can cause skin burns and must be handled carefully.
- 49. 30 Daly and Fanning 5. It is very important to resuspend the bacterial pellet completely before adding the lysozyme. Repeated pipeting proves more efficient than vortexing in this respect. 6. After incubation with proteinase K for 1 h at 37°C, it is often difficult to manipulate the DNA in solution, owing to its “stickiness,” typically occurring following the release of chromosomal DNA. Incubating the samples for an additional hour at 65°C often improves this situation by reducing the “stickiness.” 7. As soon as the cold ethanol is added, strands of DNA should become visible as they precipi- tate. Allow the DNA to precipitate for at least 2 h or preferably overnight at –20°C, to increase the yield further. 8. Agarose gels can be made up in several different sizes; a gel of dimensions 11.5 × 14 cm requires 100 mL of agarose TAE buffer mix, whereas smaller gels approx 6.5 × 8.0 cm require only 30 mL. 9. When preparing plugs for PFGE, it is very important to prepare a homogenous mixture of bacterial cell culture and warm agarose. Maintain the solubilized agarose at a constant temperature of 50°C and dispense the 230-μL aliquot directly into each of the bacterial cultures. Mix by gently pipeting up and down, but avoid introducing air bubbles into the samples. When the samples are thoroughly mixed, immediately aspirate into the barrel of the syringe, again avoiding air bubble formation. If air bubbles form, gently flick the syringe barrel until the air bubbles escape by floating to the surface of the gel/culture mixture. 10. Caution: a fully heated flask of molten agarose is very likely to boil over when disturbed, resulting in a severe skin burn. Care should be taken when gently swirling molten agar- ose to avoid injury. Make sure that gloves are worn. 11. When performing the Southern blot with a vacuum blotter, allow the transfer to proceed for a minimum of 1 h, but as the macrorestricted DNA fragments are quite large, an additional 30 min often ensures complete transfer of the DNA. As the transfer proceeds, ensure that there is adequate 20X SSC buffer for the transfer. Generally the 20X SSC must be topped up every 20–30 min. 12. A pellet may not always be visible when the DIG-labeled DNA probe is precipitated; therefore it is reassuring if 5 μL of the PCR product for the probe is analyzed by agarose gel electrophoresis prior to the precipitation step. 13. If several Southern blotting and hybridization experiments are to be performed in the laboratory, it is wise to invest in a hybridization oven. The oven will maintain a constant temperature for hybridization, while continually rotating the membrane in a hybridiza- tion bottle to ensure even distribution of probe. 14. After hybridization, the probe can be frozen at –20°C and used for up to five hybridiza- tion experiments, depending on the strength of the original DIG-labeled PCR product. How- ever, it is important to remember that probes must be denatured each time before use. 15. Using a sealed plastic bag has the advantage of increasing the membrane-solution contact by reducing the volume of the container. References 1. Recchia, G. D. and Hall, R. M. (1995) Gene cassettes; a new class of mobile element. Microbiology 141, 3015–3027. 2. Lévesque, C., Pyché, L., Larose, C., and Roy, P.H. (1995) PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob. Agents Chemother. 39, 185–191. 1
- 50. Antimicrobial Resistance Genes in S. enterica 31 3. Hall, R. M., Brookes, D. E., and Stokes, H. W. (1991) Site-specific insertion of genes into integrons: role of the 59-base element and determination of the recombination cross-over point. Mol. Microbiol. 5, 1941–1959. 4. Recchia, G. D. and Hall, R. M. (1997) Origins of the mobile gene cassettes found in integrons. Trends Microbiol. 5, 389–394. 5. Sallen, B., Rajoharison, A., Desvarenne, S., and Malibat, C. (1995) Molecular epidemiol- ogy of integron associated antibiotic resistance genes in clinical isolates of Enterobactericeae. Microb. Drug Resist. 1, 195–202. 6. Stokes, H. W. and Hall, R. M. (1989) A novel family of potentially mobile DNA elements encoding site-specific gene-integration functions: integrons. Mol. Microbiol. 3, 1669–1683. 7. Paulsen, I.T., Littlejohn, T.G., Rådström, P., et al. (1993) The 3' conserved segment of integrons contains a gene associated with multidrug resistance to antisepics and disinfec- tants. Antimicrob. Agents Chemother. 37, 761–768. 8. Bennett, P. M. (1999) Integrons and gene cassettes: a genetic construction kit for bacteria. J. Antimicrob. Chemother. 43, 1–4. 9. Collis, C. M. and Hall, R. M. (1995) Expression of the antibiotic resistance genes in the integrated cassettes of integrons. Antimicrob. Agents Chemother. 39, 155–162. 10. Stokes, H. W., Ogorman, D. B., Recchia, G. D., Parsekhian, M., and Hall, R. M. (1997) Structure and function of 59-base element recombination sites associated with mobile gene cassettes. Mol. Microbiol. 26, 731–745. 11. Collis, C. M., Grammaticopoulous, G., Briton, J., Stokes, H. W., and Hall, R. M. (1993) Site specific insertion of gene cassettes into integrons. Mol. Microbiol. 9, 41–52. 12. Glynn, M. K., Bopp, W., Dewitt, P., Mokhtar, M., and Angulo, F. J. (1998) Emergence of multidrug resistant Salmonella enterica serotype Typhimurium DT104 infections in the United States. N. Engl. J. Med. 338, 1333–1338. 13. Threlfall, E. J., Frost, J. A., Ward, L. R., and Rowe, B. (1994) Epidemic in cattle and humans of Salmonella typhimurium DT104 with chromosomally integrated multiple drug resistance. Vet. Rec. 134, 577. 14. Briggs, C. E. and Fratamico, P. M. (1999) Molecular characterization of an antibiotic resistance gene cluster of Salmonella typhimurium DT104. Antimicrob. Agents Chemother. 43, 846–849. 15. Daly, M. and Fanning, S. (2000) Characterization and chromosomal mapping of antimi- crobial resistance genes in Salmonella enterica serotype Typhimurium. Appl. Environ. Microboiol. 66, 4842–4848. 16. Arcangioli, M. A., Leroy-Setrin, S., Martel, J. L., and Chaslus-Dancla, E. (2000) Evolu- tion of chloramphenicol resistance, with emergence of cross resistance to florfenicol, in bovine Salmonella Typhimurium strains implicates definitive phage type (DT) 104. J. Med. Microbiol. 49, 103–110. 17. Daly, M., Buckley, J., Power, E., et al. (2000) Molecular characterisation of Irish Salmo- nella enterica serotype Typhimurium: detection of class 1 integrons and assessment of genetic relationships by DNA amplification fingerprinting. Appl. Environ. Microbiol. 66, 614–619. 18. Ng, L. K., Mulvey, M. R., Martin, I., Peters, G. A., and Johnson, W. (1999) Genetic char- acterization of antimicrobial resistance in Canadian isolates of Salmonella serovar Typhimurium DT104. Antimicrob. Agents Chemother. 43, 3018–3021. 19. Ridley, A. and Threlfall, E. J. (1998) Molecular epidemiology of antibiotic resistance genes in multiresistant epidemic Salmonella typhimurium DT104. Microb. Drug Res. 4, 113–118. 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
- 51. 32 Daly and Fanning 20. Sandvang, D., Aarestrup, F. M., and Jensen, L. B. (1998) Characterisation of integrons and antibiotic resistance genes in Danish multiresistant Salmonella enterica Typhimurium DT104. FEMS Microbiol. Lett. 160, 37–41. 21. Threlfall, E. J., Frost, J. A., Ward, L. R., and Rowe, B. (1996) Increasing spectrum of resistance in multiresistant Salmonella typhimurium. Lancet 347, 1053–1054. 22. Maslow, J. N., Slutsky, A. M., and Arbeit, R. D. (1993) Application of pulsed field gel electrophoresis to molecular epidemiology. In: Diagnostic Molecular Microbiology, Prin- ciples and Application, (Persing, D. H., Smith, T. F., Tenover, F. C., and White, T. J., eds.) American Society for Microbiology, Washington, DC, pp. 563–572. 23. Versalovic, J. T., Koeuth, T., and Lupski, J. R. (1991) Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res. 24, 6823–6831. 24. Sundström, L., Rådström, P., Swedberg, G., and Sköld, O. (1988) Site specific recombina- tion promotes linkage between trimethoprim and sulfonamide resistance genes. Sequence characterisation of dhfrV and sulI and a recombination active locus of Tn21. Mol. Gen. Genet. 213, 191–201. 25. Hollingshead, S. K. and Vapnek, D. (1985) Nucleotide sequence analysis of a gene encod- ing a streptomycin/spectinomycin adenyltransferase. Plasmid 13, 17–30. 26. Huovinen, P. and Jacoby, G. A. (1991) Sequence of PSE-1 beta-lactamase gene. Antimicrob. Agents Chemother. 35, 2428–2430. 20 21 25
- 52. Analysis of C. jejuni and C. coli 33 33 From: Methods in Molecular Biology, vol. 268: Public Health Microbiology: Methods and Protocols Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ 3 Molecular-Based Identification and Typing of Campylobacter jejuni and C. coli Brigid Lucey, Fiona O’Halloran, and Séamus Fanning 1. Introduction Thermophilic Campylobacter spp., mainly Campylobacter jejuni and to a lesser extent C. coli are recognized as the most common bacteriological causes of gastroen- teritis in humans (1). As enteric infection with Campylobacter organisms cannot be distinguished from that caused by other enteric pathogens, a definitive diagnosis can only be made by isolating or detecting the organism from the feces. The epidemiology of Campylobacter enteritis has been complicated by the ubiquitous nature of the organism (commonly found as a commensal in the intestines of domestic animals, in milk, and in water). Furthermore, identification is carried out only to genus level by most clinical laboratories. Because of the biochemical similarity known to exist between C. jejuni and C. coli, the hippurate hydrolysis test is often used as the only phenotypic test capable of differ- entiating the two species. This test, however, has some acknowledged technical limi- tations and is dependent on inoculum size; results can be difficult to interpret accurately (2). Furthermore, almost all C. jejuni isolates possess the hippuricase gene (3), fewer C. jejuni isolates express the hippuricase gene. For this reason, certain poly- merase chain reaction (PCR)-based species identification methods, for both C. jejuni and C. coli, and for the other thermophilic species, provide more reliable identification; they also help to highlight mixed species cultures, should they occur. However, even with these methods, false negatives or nonspecifically amplified product(s) can occur in a minority of isolates tested owing to genomic anomalies. Thus a second molecular identification method may be required in these circumstances. Gonzalez et al. (4) developed a species-specific PCR assay for the identification of C. jejuni and C. coli based on the ceuE gene, which is involved in siderophore trans- port. Using this method two primer sets are employed in separate PCR amplification reactions. Another method, developed by Eyers et al. (5), performs PCR amplification of 23S rRNA gene fragments, based on regions specific for C. jejuni, C. coli, C. lari,
- 53. 34 Lucey, O’Halloran, and Fanning and C. upsaliensis. In addition, Hani and Chan (6) developed a PCR assay that detected and amplified the hippuricase gene. This molecular approach may offer a more reliable means of identifying C. jejuni strains compared with the phenotypic hippurate hydroly- sis test alone. Epidemiological typing methods currently in use for Campylobacter spp. include phenotypic methods such as serotyping and genotypic methods including DNA ampli- fication fingerprinting (DAF), pulsed-field gel electrophoresis (PFGE), and ribotyping and restriction fragment length polymorphism (RFLP) analysis of the flagellin A gene (flaA). Serotyping remains primarily a reference laboratory protocol because of the time and expense needed to maintain high-quality antisera. Furthermore, there are a high percentage of untypable strains, and the standard serotyping systems such as the Lior and Penner schemes are time-consuming and technically demanding (7). DAF is a PCR-based typing method that typically uses randomly designed 10-mer primers, under conditions that allow some base-pair mismatches, to increase the num- ber of primer binding sites. Primer binding throughout the genome generates an array of DNA amplicons with varying lengths and intensities, which typify a genomic fin- gerprint. Interstrain variation is dependent on the number, location, and degree of mis- matches tolerated when the primer binds to the genome. Advantages of this technique include a high degree of typability, ease of performance, cost effectiveness, and ready availability of reagents and equipment. In a recent study of 378 Campylobacter iso- lates, from human and poultry sources, only one isolate proved untypable with DAF analysis (Lucey et al., unpublished observations), using the primer HLWL85 (8). DAF analysis has proved to be highly discriminatory when primers are carefully selected (see Note 1). PFGE is a molecular typing technique that uses rare cutting restriction endonu- cleases to cleave bacterial genomes producing a small number of very large DNA fragments. These DNA fragments can only be resolved and visualized by PFGE meth- ods. Despite some obvious technical considerations such as the labor-intensive pro- cess involved, PFGE is one method that offers a high degree of reproducibility and typability, with the production of highly discriminatory profiles and the possibility of interlaboratory comparisons if methods are standardized. Compared with DAF, PFGE requires specialized equipment and can be more expensive to run on a routine basis (7). A study by Møller Nielsen et al. (9) compared the effectiveness of six typing meth- ods for use on a population of 90 Campylobacter isolates of human, cattle, and poultry origins (comprising outbreak and non-outbreak-related strains). The methods used were Penner heat-stable serotyping, automated ribotyping, DAF analysis, PFGE, RFLP of flaA, and denaturing gradient gel electrophoresis of flaA (flaA-DGGE). DAF and PFGE were shown to be the most discriminating methods, which the authors as- cribed to their ability to determine polymorphisms across the entire bacterial ge- nome. Serotyping was found to be the least discriminatory. Bacterial resistance to antimicrobial agents often results from the acquisition of new genes, as well as from mutations. These new genes can be acquired by several mecha- nisms including genetic elements, such as resistance (R-)plasmids, transposons, and integrons. The latter group are a class of genetic elements involved in the dissemination
- 54. Analysis of C. jejuni and C. coli 35 of antimicrobial resistance-encoding genes. This is mediated by the integration of a gene cassette containing the resistance genes via a site-specific recombinational event (10). Integrons have been found to be associated with antimicrobial resistance in many Gram-negative species, including Salmonella, Pseudomonas, and Klebsiella. A recent report suggests that Campylobacter spp. also possess integron-like structures (11). When the plasticity of the Campylobacter genome is considered, this has interesting implications for the continued evolution of this species. Therefore, it is reasonable to suggest that complete characterization of these species should include investigations for the presence of unique integron structures. Most cases of clinical Campylobacter enteritis are sufficiently mild or self-limiting not to require antimicrobial chemotherapy (12). Nevertheless, in severe or recurrent cases for which antibiotics are required, susceptibility testing is important to ensure appropriate and timely treatment. Macrolides remain the agents of choice for such cases, and resistance rates remain comparatively low (13). Since the 1980s, however, the development of the fluoroquinolones, which are effective against most enteric pathogens, offered an effective therapy to treat acute bacterial diarrhea; ciprofloxacin becoming used extensively as prophylaxis for travellers (14). The emergence of resis- tance to these agents, however, has since then made their efficacy less certain. Resis- tance was reported to develop among patients after treatment with fluoroquinolones (15) and was also found to coincide with the introduction of these agents in veterinary medicine (16). In Campylobacter and other Gram-negative bacteria, fluoroquinolones operate by interfering with the type II topoisomerase (DNA gyrase) and topoisomerase IV (17). The predominant mechanism of resistance to ciprofloxacin in C. jejuni and C. coli has been shown to result from a mutation in the gyrA gene, whereby all isolates tested demonstrated a Thr-86-Ile substitution in the A-subunit of DNA gyrase (18,19). A specific PCR assay, the mismatch amplification mutation assay (MAMA- PCR), has been demonstrated to be a useful screening method for ciprofloxacin resis- tance among each of these isolates (18,19). This method uses a conserved, forward primer and a reverse, diagnostic primer, which together generate a 265-bp product that is a positive indication of the presence of the Thr-86-Ile amino acid substituion consis- tent with resistance to ciprofloxacin. 2. Materials All materials marked with an asterisk (*) were autoclaved at 121°C for 15 min prior to use. 2.1. DNA Extraction This protocol is a modified version of a purification method for Campylobacter spp. (20) to yield purified DNA. Cultures were treated prior to DNA extraction with formaldehyde to inhibit any DNAse activity (see Note 2), according to the method of Gibson et al. (21). 1. Preston agar Campylobacter Agar Base, Oxoid CM689, containing Modified Campylobacter Selective Supplement Sr204E and 5% (v/v) lysed horse blood. Prepare according to the manufacturer’s instructions. 2. Distilled water*.
- 55. Another Random Document on Scribd Without Any Related Topics
- 56. thought I should disappoint it.' Not daunted by this inauspicious beginning, Laura, taking encouragement from her aunt's known instability, again and again renewed the subject; but Lady Pelham's purposes, however easily shaken by accident or caprice, were ever inflexible to entreaty. 'She possessed,' she said, 'the means of preventing her niece's folly, and she was determined to employ them.' Laura burnt with resentment at the injustice of this determination. She acknowledged no right which Lady Pelham possessed to detain her against her own consent, and she considered the detention of her lawful property as little else than fraud. But perceiving that remonstrance was useless, she judged it most prudent not to embitter, by vain recriminations, an intercourse from which she could not immediately escape. Without further complaint or upbraiding, she submitted to her fate; content with resolving to employ more discreetly the next payment of her annuity, and with making a just but unavailing appeal to her aunt's generosity, by asserting the right of defencelessness to protection. Lady Pelham had not the slightest idea of conceding any thing to this claim. On the contrary, the certainty that Laura could not withdraw from her power, encouraged her to use it with less restraint. She invited Hargrave to a degree of familiarity which he had not before assumed; admitted him at all hours; sanctioned any freedom which he dared to use with Laura; and forced or inveigled her into frequent tête-à-têtes with him. Fretted beyond her patience, Laura's temper more than once failed under this treatment, and she bitterly reproached Hargrave as the source of all her vexation. As it was, however, her habitual study to convert every event of her life to the purposes of virtue, it soon occurred to her, that, during these compulsory interviews, she might become the instrument of awakening her unworthy lover to more noble pursuits. Like a ray of light, the hope of usefulness darted into her soul, shedding a cheering beam on objects which before were dark and comfortless; and, with all the enthusiastic warmth of her character, she entered on her voluntary task; forgetting, in her eagerness to recal a sinner from the error of his ways, the
- 57. weariness, disgust, and dread with which she listened to the ravings of selfish passion. She no longer endeavoured to avoid him, no longer listened to him with frozen silence or avowed disdain. During their interviews, she scarcely noticed his protestations, but employed every interval in urging him, with all the eloquence of dread, to retreat from the gulf which was yawning to receive him; in assuring him, with all the solemnity of truth, that the waters of life would repay him a thousand-fold for the poisoned cup of pleasure. Truth, spoken by the loveliest lips in the world, confirmed by the lightnings of a witching eye, kindled at times in Hargrave a something which he mistook for the love of virtue. He declared his abhorrence of his former self, asserted the innocence of his present manner of life, and vowed that, for the future, he should be blameless. But when Laura rather incautiously urged him to give proof of his reformation, by renouncing a passion whose least gratifications were purchased at the expence of justice and humanity, he insisted that she required more than nature could endure, and vehemently protested that he would never, but with life, relinquish the hope of possessing her. Her remonstrances had however one effect, of which she was altogether unconscious. Hargrave could not estimate the force of those motives which led her to labour so earnestly for the conversion of a person wholly indifferent to her; and though she often assured him that her zeal was disinterested, he cherished a hope that she meant to reward his improvement. In this hope he relinquished, for a while, the schemes which he had devised against the unsuspecting Laura, till accident again decided him against trusting to her free consent for the accomplishment of his wishes. Among other exercises of authority to which Lady Pelham was emboldened by her niece's temporary dependence on her will, she adhered to her former prohibition of Laura's correspondence with De Courcy. Laura, unwilling to make it appear a matter of importance, promised that she would desist; but said that she must first write to Mr De Courcy to account for her seeming caprice. Lady Pelham consented, and the letter was written. It spoke of Laura's situation, of her sentiments, of her regret for Hargrave's strange perseverance,
- 58. of the dread and vexation to which he occasionally subjected her. To atone for its being the last, it was more friendly, more communicative than any she had formerly written. Laura meant to disguise under a sportive style the effects which oppression had produced upon her spirits; and the playful melancholy which ran throughout, gave her expressions an air of artless tenderness. Lady Pelham passed through the hall as this letter was lying upon the table, waiting for the servant who was to carry it to the post; she looked at it. The sheet was completely filled. She wondered what it could contain. She took it up and examined it, as far as the seal would permit her. What she saw did but increase her curiosity. It was only wafered, and therefore easily opened; but then it was so dishonourable to open a letter. Yet what could the letter be the worse? A girl should have no secrets from her near relations. Still, to break a seal!—It was felony by the law. Lady Pelham laid down the letter and walked away, already proud of having disdained to do a base action; but she heard the servant coming for his charge; she thought it best to have time to consider the matter. She could give him the letter at any time—and she slipped it into her pocket. Sad sentence is produced against 'the woman who deliberates:' Lady Pelham read the letter; and then, in the heat of her resentment at the manner in which her favourite was mentioned, shewed it to Hargrave. As he marked the innocent confiding frankness, the unconstrained respect, the chastened yet avowed regard, with which Laura addressed his rival, and contrasted them with the timid caution which, even during the reign of passion, had characterized her intercourse with himself,—contrasted them too with the mixture of pity, dislike, and dread, which had succeeded her infatuation, all the pangs of rage and jealousy took hold on the soul of Hargrave. He would have vented his frenzy by tearing the letter to atoms, but Lady Pelham snatched it from his quivering grasp, and dreading detection, sealed and restored it to its first destination. The first use which he made of his returning powers of self- command, was to urge Lady Pelham's concurrence in a scheme
- 59. which he had before devised, but which had been laid aside in consequence of his ill-founded hopes. He entreated that her Ladyship would, by an opportune absence, assist his intention; which was, he said, to alarm Laura with the horrors of a pretended arrest for an imaginary debt, and to work upon the gratefulness of her disposition, by himself appearing as her deliverer from her supposed difficulty. Lady Pelham in vain urged the futility of this strategem, representing the obstacles to its accomplishment, and the certainty of early detection. Hargrave continued to importune, and she yielded. Yet Hargrave himself was as far as Lady Pelham from expecting any fruits from the feeble artifice which he had detailed to her. He had little expectation that Laura could ever be induced to receive any pecuniary obligation at his hands, and still less that she would consider a loan which she might almost immediately repay, as a favour important enough to be rewarded with herself. He even determined that his aid should be offered in terms which would ensure its rejection. Though he durst not venture to unfold his whole plan to Lady Pelham, his real intention was merely to employ the disguise of the law in removing Laura from even the imperfect protection of her aunt, to a place where she would be utterly without defence from his power. To the baseness of his purpose he blinded himself by considering the reparation which he should make in bestowing wealth and title on his victim; its more than savage brutality he forgot in anticipation of the gratitude with which Laura, humbled in her own eyes, and in those of the world, would accept the assiduities which now she spurned. He little knew the being whom he thus devoted to destruction! Incited by jealousy and resentment, he now resolved on the immediate execution of his design; and he did not quit Lady Pelham till he had obtained her acquiescence in it so far as it was divulged to her. He then hastened to prepare the instruments of his villainy; and ere he gave himself time to cool, all was in readiness for the scheme which was to break the innocent heart that had loved and trusted him in seeming virtue, and pitied and prayed for him and warned him in guilt. How had the
- 60. shades of evil deepened since the time when Hargrave first faltered between his infant passion and a virtuous purpose! He had turned from the path which 'shineth more and more unto the perfect day.' On that in which he trode the night was stealing, slow but sure, which closes at last in outer darkness. One morning at breakfast, Lady Pelham, with more than usual civility, apologized for leaving Laura alone during the rest of the day, saying that business called her but a few miles out of the town, but that she would return in the evening. She did not say whither she was going; and Laura, never imagining that it could at all concern her to know, did not think of inquiring. Pleasing herself with the prospect of one day of peace and solitude, she saw her aunt depart, and then sat down to detail to the friend of her youth her situation, her wishes, and her intentions. She was interrupted by a servant who came to inform her that two men below desired to speak with her. Wondering who in that land of strangers could have business with her, Laura desired that they should be shewn up stairs. Two coarse robust-looking men, apparently of the lower rank, entered the room. Laura was unable to divine what could have procured her a visit from persons of their appearance; yet, with her native courtesy, she was motioning them to a seat, when one of them stepped forward; and, laying on her shoulder a stick which he held, said, in a rough ferocious voice, 'Laura Montreville, I arrest you at the suit of John Dykes.' Laura was surprised but not alarmed. 'This must be some mistake,' said she, 'I know no such person as John Dykes.' 'He knows you though, and that is enough,' answered the man. 'Friend,' returned Laura, mildly, 'you mistake me for some other person.' 'What, Miss,' said the other man, advancing, 'do you pretend that you are not Laura Montreville, daughter of the late Captain William Montreville, of Glenalbert in Scotland?' Laura, now changing colour, owned that she was the person so described. 'But,' said she, recovering herself, 'I cannot be arrested. I do not owe five shillings in the world.' 'Mayhap not, Miss,' said the man, 'but your father did; and you can be proved to have intermeddled with his effects as his heiress, which makes you liable for all his debts. So
- 61. you'll please pay me the two hundred pounds which he owed to Mr John Dykes.' 'Two hundred pounds!' exclaimed Laura. 'The thing is impossible. My father left a list of his debts in his own hand-writing, and they have all been faithfully discharged by the sale of his property in Scotland.' The men looked at each other for a moment, and seemed to hesitate; but the roughest of the two presently answered, 'What nonsense do you tell me of lists? who's to believe all that? I have a just warrant; so either pay the money or come along.' 'Surely, friend,' said Laura, who now suspected the people to be mere swindlers, 'you cannot expect that I should pay such a sum without inquiring into your right to demand it. If your claim be a just one, present it in a regular account, properly attested, and it shall be paid to-morrow.' 'I have nothing to do with to-morrow, Miss,' said the man. 'I must do my business. It's all one to me whether you pay or not. It does not put a penny in my pocket: only if you do not choose to pay, come along; for we can't be standing here all day.' 'I cannot procure the money just now, even though I were willing,' answered Laura, with spirit, 'and I do not believe you have any right to remove me.' 'Oh, as for the right, Miss, we'll let you see that. There is our warrant, properly signed and sealed. You may look at it in my hand, for I don't much like to trust you with it.' The warrant was stamped, and imposingly written upon parchment. With the tautology which Laura had been taught to expect in a law- paper, it rung changes upon the permission to seize and confine the person of Laura Montreville, as heiress of William Montreville, debtor to John Dykes of Pimlico. It was signed as by a magistrate, and marked with the large seals of office. Laura now no longer doubted; and, turning pale and faint, asked the men whether they would not stay for an hour while she sent to Finsbury Square to beg the advice of Mr Derwent, Lady Pelham's man of business. 'You may send for him to the lock-up house,' said the savage. 'We have no time to spare.' 'And whither will you take me?' cried Laura, almost sinking with horror. 'Most likely,' answered the most gentle of the two ruffians, 'you would not like to be put into the common prison; and
- 62. you may have as good accommodations in my house as might serve a dutchess.' Spite of her dismay Laura's presence of mind did not entirely forsake her. She hesitated whether she should not send to beg the assistance of some of Lady Pelham's acquaintance, or at least their advice in a situation so new to her. Among them all there was none with whom she had formed any intimacy; none whom, in her present circumstances of embarrassment and humiliation, she felt herself inclined to meet. She shrunk at the thought of the form in which her story might be represented by the malignant or the misjudging, and she conceived it her best course to submit quietly to an inconvenience of a few hours continuance, from which she did not doubt that her aunt's return would that evening relieve her. Still the idea of being a prisoner; of committing herself to such attendants; of being an inmate of the abodes of misery, of degradation, perhaps of vice, filled her with dread and horror, while, sinking on a couch, she covered her pale face with her hands, and inwardly commended herself to the care of heaven. The men, meanwhile, stood whispering apart, and seemed to have forgotten the haste which they formerly expressed. At last one of them, after looking from the window into the street, suddenly approached her, and, rudely seizing her arm, cried, 'Come, Miss, the coach can't wait all day. It's of no use crying; we're too well used to that, so walk away if you don't choose to be carried.' Laura dashed the tears from her eyes, and, faintly trying to disengage her arm, was silently following her conductor to the door, when it opened and Hargrave entered. Prepared as he was for a scene of distress, determined as he was to let no movement of compassion divert his purpose, he could not resist the quiet anguish which was written in the lovely face of his victim; and turning with real indignation to her tormentor, he exclaimed, 'Ruffian! what have you done to her?' But quickly recollecting himself, he threw his arm familiarly round her, and said, 'My dearest Laura, what is the meaning of all this? What can these
- 63. people want with you?' 'Nothing which can at all concern you Sir,' said Laura, her spirit returning at the boldness of his address. 'Nay, my dear creature,' said Hargrave, 'I am sure something terrible has happened. Speak, fellows,' said he, turning to his emissaries, 'what is your business with Miss Montreville?' 'No great matter, Sir,' answered the man; 'only we have a writ against her for two hundred pounds, and she does not choose to pay it; so we must take her to a little snug place, that's all.' 'To a prison! You, Laura, to a prison! Heavens! it is not to be thought of. Leave the room fellows, and let me talk with Miss Montreville.' 'There is no occasion, Sir,' said Laura. 'I am willing to submit to a short confinement. My aunt returns this evening, and she will undoubtedly advance the money. It ought to be much the same to me what room I inhabit for the few intervening hours.' 'Good heaven! Laura do you consider what you say? Do you consider the horrors—the disgrace? Dearest girl, suffer me to settle this affair, and let me for once do something that may give you pleasure.' Laura's spirit revolted from the freedom with which this was spoken. Suffering undeserved humiliation, never had she been more jealous of her claim to respect. 'I am obliged to you, Sir,' said she, 'but your good offices are unnecessary. Some little hardship, I find, I must submit to; and I believe the smallest within my choice is to let these people dispose of me till Lady Pelham's return.' Hargrave reddened. 'She prefers a prison,' thought he, 'to owing even the smallest obligation to me. But her pride is near a fall;' and he smiled with triumphant pity on the stately mien of his victim. He was, in effect, almost indifferent whether she accepted or rejected his proffered assistance. If she accepted it, he was determined that it should be clogged with a condition expressly stated, that he was for the future to be received with greater favour. If she refused, and he scarcely doubted that she would, he had only to make the signal, and she would be hurried, unresisting, to destruction. Yet, recollecting the despair, the distraction, with which she would too late discover her misfortune; the bitter upbraidings with which she would meet her betrayer; the frantic anguish with which she would mourn her disgrace, if, indeed, she survived it, he
- 64. was inclined to wish that she would choose the more quiet way of forwarding his designs, and he again earnestly entreated her to permit his interference. Laura's strong dislike to being indebted for any favour to Hargrave, was somewhat balanced in her mind by the horror of a prison, and by the consideration that she could immediately repay him by the sale of part of her annuity. Though she still resisted his offer, therefore, it was less firmly than before. Hargrave continued to urge her. 'If,' said he, 'you dislike to allow me the pleasure of obliging you, this trifling sum may be restored whenever you please; and if you afterwards think that any little debt remains, it is in your power to repay it a thousand fold. One kind smile, one consenting look, were cheaply purchased with a world.' The hint which concluded this speech seemed to Laura manifestly intended to prevent her acceptance of the offer which he urged so warmly. 'Are you not ashamed, Sir,' said she, with a disdainful smile, 'thus to make a parade of generosity which you do not mean to practise? I know you do not—cannot expect, that I should poorly stoop to purchase your assistance.' 'Upon my soul, Laura,' cried Hargrave, seizing her hands, 'I am most earnest, most anxious, that you should yield to me in this affair; nor will I quit this spot till you have consented—nor till you have allowed me to look upon your consent as a pledge of your future favour.' Laura indignantly snatched her hands from his grasp. 'All that I comprehend of this,' said she, 'is insult, only insult. Leave me, Sir! It is unworthy even of you to insult the misfortunes of a defenceless woman.' Hargrave would not be repulsed. He again took her hand and persevered in his entreaties, not forgetting, however, to insinuate the conditions. Laura, in silent scorn, turned from him, wondering what could be the motive of his strange conduct, till it suddenly occurred to her that the arrest might be a mere plot contrived by Hargrave himself for the purpose of terrifying her into the acceptance of the conditions necessary to her escape. This suspicion once formed gained strength by every circumstance. The improbability of the debt; the time chosen when Lady Pelham was absent; the opportune arrival of Hargrave; the submission of the pretended bailiffs to his order; his frequent repetition of the conditions of his offer, at the same time
- 65. that he appeared to wish for its acceptance; all conspired to convince Laura that she was intended to be made the dupe of a despicable artifice. Glowing with indignation, she again forced herself from Hargrave. 'Away with this contemptible mockery,' she cried, 'I will hear no more of it. While these people choose to guard me in this house, it shall be in an apartment secure from your intrusion.' Then, before Hargrave could prevent her, she left him, and shut herself into her own chamber. Here, at greater liberty to think, a new question occurred to her. In case of her refusal to accept of Hargrave's terms—in case she actually preferred intrusting herself to the pretended bailiffs, whither could they intend to convey her? Laura's blood ran cold at the thought. If they were indeed the agents of Hargrave, what was there of dreadful that she had not to fear! Yet she could scarcely believe that persons could be found to attempt so daring a villany. Would they venture upon an outrage for which they must answer to the laws! an outrage which Lady Pelham would certainly feel herself concerned to bring to immediate detection and punishment. 'Unfortunate chance!' cried Laura, 'that my aunt should be absent just when she might have saved me. And I know not even where to seek her.—Why did she not tell me whither she was going? She who was wont to be so open!—Can this be a part of this cruel snare? Could she—Oh it is impossible! My fears make me suspicious and unjust.' Though Laura thus endeavoured to acquit Lady Pelham, her suspicion of Hargrave's treachery augmented every moment. While she remembered that her father, though he had spoken to her of his affairs with the most confidential frankness, had never hinted at such a debt, never named such a person as his pretended creditor— while she thought of the manner of Hargrave's interference, the improbability that her own and her father's name and address, as well as the casualty of Lady Pelham's absence should be known to mere strangers—the little likelihood that common swindlers would endeavour to extort money by means so hazardous and with such
- 66. small chance of success—her conviction rose to certainty; and she determined that nothing short of force should place her in the power of these impostors. Yet how soon might that force be employed! How feeble was the resistance which she could offer! And who would venture to aid her in resisting the pretended servants of law! 'Miserable creature that I am!' cried she, wringing her hands in an agony of grief and terror, 'must I submit to this cruel wrong?—Is there no one to save me—no friend near?—Yes! yes, I have a friend from whom no treachery of man can tear me—who can deliver me from their violence—who can do more—can make their cruelty my passport to life eternal. Let me not despair then—Let me not be wanting to myself.—With His blessing the feeblest means are mighty.' After a moment's consideration Laura rung her bell, and the maid who usually attended her appeared. 'Catherine,' said Laura, endeavouring to speak composedly, 'will you oblige me by going to Finsbury Square, to Mr Derwent, and begging of him to come hither instantly?' 'Bless me, Madam,' cried the girl, 'you look as if you were just going to faint! can I get you any thing?' 'No, no, I shall not faint,' said Laura. 'Go my dear—go quickly—if you would save a wretch from destruction. Stop not a moment I implore you!—Oh Catherine, more than life depends on you!' The girl's curiosity was strongly excited by these words, as well as by the strange visit of the men who were waiting in the lobby. She would fain have staid to make inquiries, but the imploring anguish of Laura's look and manner was irresistible, and she hastened out of the room. Laura then double-locking the door determined that by force only it should be entered, and throwing herself on a seat, strove to rally the spirits she was so soon to need. In a few minutes, however, Catherine returned, and through the key hole informed Laura that she had been intercepted by the men below stairs, who would not suffer any one to leave the house. 'All is then as I feared,' cried Laura in a voice of desperation. 'And thus has he made his cruel plot so sure! Is there no escape! Oh Catherine! cannot you steal away from them? Is there no means to save me?' Moved by the voice of anguish, the girl
- 67. promised to do her utmost, but confessed that she had little hope of succeeding. For a moment Laura believed her fate sealed, and almost gave herself up to despair; but, now convinced of the treachery of Hargrave, and unwillingly obliged to suspect Lady Pelham's connivance, indignation at such unexampled baseness and cruelty again roused her fainting spirit. Again she determined to resist to the uttermost, and if dragged by force from her place of refuge, to appeal to the humanity of the passengers in the street. 'Surely,' thought she, 'even common strangers will not permit such oppression.' The windows of her chamber looked towards the gardens behind the house; and she now regretted that she had not rather shut herself up in one of the front apartments, from whence she could have explained her situation to the passers by. Seeing no other chance of escape, she resolved on attempting to change her place of refuge, and was approaching the door to listen whether any one was near, when she was startled by the rough voice of one of the pretended bailiffs. 'Come along Miss,' he cried, 'we are quite tired of waiting. Come along.' The shuddering Laura made no reply. 'Come, come Miss,' cried the man again; 'you have had time enough to make ready.' Laura continued silent, while the ruffian called to her again and again, shaking the door violently. He threatened, with shocking oaths, that he would burst it open, and that she would be punished for resisting the officers of justice. All was in vain. Laura would not answer a single word. Trembling in every limb, she listened to his blasphemies and vows of vengeance, till she had wearied out her persecutor, and her ear was gladdened with the sound of his departing. He was almost immediately succeeded by his less ferocious companion, who more civilly begged her to hasten, as their business would not permit any longer delay. Finding that she would not answer, he reminded her of the consequences of obstructing the execution of the law; and threatened, if she continued obstinate, to use force. Laura sat silent and motionless, using every momentary interval of quiet, in breathing a hasty prayer for deliverance. The least violent of the fellows proved the most
- 68. persevering; yet at last she had the satisfaction to hear him also retire. Presently a lighter step approached, and Hargrave called to her. 'Miss Montreville! Laura! Miss Montreville!' Laura was still silent. He called again, without success. 'Miss Montreville is ill,' cried he aloud, as if to some one at a distance. 'She is insensible. The door must be forced.' 'No! No!' cried Laura, determined not to leave him this pretence, 'I am not insensible, nor ill, if you would leave me in peace.' 'For heaven's sake, then,' returned he, 'let me speak a few words to you.' 'No,' answered Laura, 'you can say nothing that I wish to hear.' 'I beseech you, I implore you,' said Hargrave, 'only by one word put it in my power to save you from these miscreants—say but that one little word, and you are free.' 'Man, man!' cried Laura, vehemently, 'why will you make me abhor you? I want no freedom but from your persecutions! Begone!' 'Only promise me,' said Hargrave, lowering his voice, 'only promise me that you will give up that accursed De Courcy, and I will dismiss these men.' 'Do you curse him who saved your life! Monster! Leave me! I detest you.' Hargrave gnawed his lip with passion. 'You shall dearly pay for this obstinacy,' said he, and fiercely strode away. In the heat of his wrath, he commanded his coadjutors to force the door; but the law which makes the home of an Englishman a sacred sanctuary, extends its precious influence, in some faint degree, to the breasts even of the dregs of mankind; and these wretches, who would have given up Laura to any other outrage, hesitated to perpetrate this. They objected the danger. 'Does your Honour think,' said one of them, 'that the servants will stand by and allow us to break open the door.' 'I tell you,' said Hargrave, 'all the men-servants are from home. What do you fear from a parcel of women?' 'Women can bear witness as well as men, your Honour; and it might be as much as our necks are worth to be convicted. But if your Honour could entice her out, we'd soon catch her.' Hargrave took two or three turns along the lobby, and then returned to Laura. 'Miss Montreville,' said he, 'my dearest Miss Montreville, I conjure you to admit me only for a moment. These savages will wait no longer. They are determined to force your door. Once more I implore you,
- 69. before it is too late, let me speak with you. I expect them every moment.' Laura's breast swelled with indignation at this vile pretence of kindness. 'Acting under your commands, Sir,' said she, 'I doubt not that they may even dare this outrage. And let them at their peril. If the laws of my country cannot protect, they shall avenge me.' For a moment Hargrave stood confounded at this detection, till anger replacing shame,—'Very well, Madam,' he cried; 'insult me as you please, and take the consequences.' He then rejoined his emissaries; and by bribery and threats endeavoured to prevail upon them to consummate their violence. The men, unwilling to forfeit the reward of the hazard and trouble they had already undergone, allured by Hargrave's promises, and fearing his vengeance, at last agreed to drag their hapless victim to her doom. Having taken such instruments as they could find, for the purpose of forcing the door, they followed Hargrave up stairs, and prepared to begin their work. At this near prospect of the success of all his schemes, Hargrave's rage began to cool; and a gleam of tenderness and humanity reviving in his heart, he shrunk from witnessing the anguish which he was about to inflict. 'Stop,' said he to his people, who were approaching the door; 'stay a few moments;' and, putting his hand to his forehead, he walked about, not wavering in his purpose, but endeavouring to excuse it to himself. 'It is all the consequence of her own obstinancy,' said he, suddenly stopping. 'You may go on—No; stay, let me first get out of this house. Her cries would drive me mad.—Make haste—lose no time after I am gone. It is better over.' Besides the motive which he owned, Hargrave was impelled to depart by the dread of meeting Laura's upbraiding eye, and by the shame of appearing even to the servants, who were so soon to know his baseness, an inactive spectator of Laura's distress. He hastened from the house, and the men proceeded in their work. With dread and horror did Laura listen to their attempts. Pale, breathless, her hands clenched in terror, she fixed her strained eyes upon the door, which every moment seemed yielding; then flying to
- 70. the window, surveyed in despair the height, which made escape an act of suicide; then again turning to the door, tried with her feeble strength to aid its resistance. In vain! It yielded, and the shock threw Laura upon the ground. The ruffians raised her, more dead then alive, and were seizing her lily arms to lead her away; but, with all her native majesty, she motioned them from her. 'You need not touch me,' said she, 'you see I can resist no further.' With the composure of despair, she followed them to the hall, where, her strength failing, she sunk upon a seat. The servants now in pity and amazement approaching her, she addressed herself to one of them. 'Will you go with me, my good friend,' said she, 'that you may return and tell Lady Pelham where to find her niece's corpse!' The girl consented with tears in her eyes; but one of the fellows cried, 'No; no; she may run after the coach if she likes, but she don't go within side.' 'Why not?' said the other, with a brutal leer. 'They may both get home again together. They'll be free enough soon.' Laura shuddered. 'Where wandered my senses,' said she, 'when I thought of subjecting any creature to the chance of a fate like mine! Stay here, my dear, and tell Lady Pelham, that I charge her, by all her hopes here and hereafter, to seek me before she sleeps. Let her seek me wherever there is wickedness and wo—and there, living or dead, I shall be found.' 'Let's have done with all this nonsense,' said one of the men. 'John, make the coach draw up close to the door.' The fellow went to do as he was desired; while the other with a handkerchief prepared to stifle the cries of Laura, in case she should attempt to move the pity of passengers in the street. Laura heard the carriage stop, she heard the step let down, and the sound was like her death knell. The man hurried her through the hall. He opened the street door— and Catherine entered with Mr Derwent. Laura, raising her bowed- down head, uttered a cry of joy. 'I am safe!' she cried, and sunk into the arms of Catherine. Mr Derwent immediately directed his servants to seize the fellow who had held Laura, the other having made his escape upon seeing
- 71. the arrival of her deliverers. Laura, soon recovering, told her tale to Mr Derwent, who ordering the man to be searched, examined the warrant, and declared it to be false. The danger attending forgery, however, had been avoided, for there was no magistrate of the same name with that which appeared in the signature. Hargrave's villany thus fully detected, Laura wished to dismiss his agent; but Mr Derwent would not permit such atrocity to go unpunished, and gave up the wretch to the arm of law. He then quitted Laura, leaving his servant to attend her till Lady Pelham's return and, worn out with the emotion she had undergone, she threw herself on a bed to seek some rest. Early in the evening Lady Pelham returned, and immediately inquired for her niece. The servants, always attentive and often uncharitable spectators of the actions of their superiors, had before observed the encouragement which their mistress gave to Hargrave, and less unwilling to suspect than Laura, were convinced of Lady Pelham's connivance in his purpose. None of them therefore choosing to announce the failure of a scheme in which they believed her so deeply implicated, her questions produced no information except that Miss Montreville was gone indisposed to bed. The habitual awe with which the good sense and discernment of Laura had inspired Lady Pelham, was at present augmented almost to fear by the consciousness of duplicity. She shrunk from encountering the glance of quiet scrutiny, the plain direct question which left no room for prevarication, no choice between simple truth and absolute falsehood. But curiosity to know the success of the plot, and still more a desire to discover how far she was suspected of abetting it, prevailed over her fears; and having before studied the part she was to play, she entered Laura's apartment. She found her already risen and prepared to receive her. 'My dear child,' said her Ladyship in one of her kindest tones, 'I am told you have been ill. What is the matter?' 'My illness is nothing, Madam,' answered Laura, 'but I have been alarmed in your absence by the most daring, the most unprincipled outrage!' 'Outrage, my dear!'
- 72. cried Lady Pelham in a voice of the utmost surprise; 'What outrage?' Laura then, commanding by a powerful effort the imagination which swelled her heart, related her injuries without comment; pausing at times to observe how her aunt was affected by the recital. Lady Pelham was all amazement; which, though chiefly pretended, was partly real. She was surprised at the lengths to which Hargrave had gone, and even suspected his whole design, though she was far from intending to discover her sentiments to her niece. 'This is the most extraordinary thing I ever heard of!' cried she when Laura had ended. 'What can have been the meaning of this trick? What can have incited the people?' 'Colonel Hargrave, Madam,' said Laura without hesitation. 'Impossible, my dear! Hargrave can be no further concerned in it, than so far as taking advantage of the accident to extort the promise of a little kindness from you. He would never have ventured to send the men into my house on such an errand.' 'One of them confessed to Mr Derwent, before the whole family, that Colonel Hargrave was his employer.' 'Astonishing!' cried Lady Pelham. 'And what do you suppose to have been Hargrave's intention?' 'I doubt not, Madam,' returned Laura, commanding her voice, though resentment flashed from her eyes, 'I doubt not that his intentions were yet more base and inhuman than the means he employed. But whatever they were, I am certain he would never have dared to entertain them, had it not been for the encouragement which your Ladyship has thought proper to give him.' 'I, child!' cried Lady Pelham, truth in her colour contradicting the falsehood of her tongue, 'Surely you do not think that I would encourage him in such a plot!' 'No, Madam,' answered Laura, 'I hope and believe that you are incapable of consenting to such wickedness. I allude only to the general countenance which you have always shewn to Colonel Hargrave.' Lady Pelham could implicitly rely upon Laura's word; and finding that she was herself unsuspected, she had leisure to attempt palliating the offence of her protegé. 'That countenance,' returned she, 'shall be completely withdrawn for the future, if Hargrave does not explain this strange frolic to my satisfaction.' 'Frolic, Madam!' cried Laura indignantly. 'If that name belongs to crimes which would disgrace barbarians, then
- 73. call this a frolic!' 'Come, my dear girl,' said Lady Pelham, coaxingly throwing her arm round Laura, 'you are too much, and I must own, according to present appearances, justly irritated, to talk of this affair coolly tonight. To-morrow we shall converse about it. Now let's go to tea.' 'No, Madam,' said Laura with spirit, for she saw through her aunt's intention of glossing over Hargrave's villany—'I will never again expose myself to the chance of meeting a wretch whose crimes are my abhorrence. I will not leave this room till I quit it for ever. Madam, you have often called me firm. Now I will prove to you that I am so. Give me the means to go hence in a manner becoming your niece, or my own limbs shall bear me to Scotland, and on the charity of my fellow-creatures will I rely for support.' 'I protest, my love,' cried Lady Pelham, 'you are absolutely in a passion, I never saw you so angry till now.' 'Your Ladyship never saw me have such reason for anger,' replied Laura. 'I own I am angry, yet I know that my determination is right, and I assure you it will outlive the heat with which it is expressed.' Had Laura's purpose been more placidly announced it would have roused Lady Pelham to fury; but even those who have least command over their tempers have generalship enough to perceive the advantage of the attack; and the passion of a virago has commonly a patriarchal submission for its elder-born brother. Lady Pelham saw that Laura was in no humour for trifling; she knew that her resolutions were not easily shaken; and she quitted her upon pretence of fatigue, but in reality that she might consider how to divert her from the purpose which she had announced so peremptorily. Laura was every day becoming more necessary to her aunt, and to think of parting with her was seriously disagreeable. Besides, Laura's departure would effectually blast the hopes of Hargrave; and what would then become of all Lady Pelham's prospects of borrowing consequence from the lovely young Countess of Lincourt? Never wanting in invention, Lady Pelham thought of a hundred projects for preventing her niece's journey to Scotland. Her choice was fixed by a
- 74. circumstance which she could not exclude from her consideration. The story of Hargrave's seditious plot was likely soon to be made public. It was known to Mr Derwent, and to all her own household. Her conscience whispered that her connivance would be suspected. Mr Derwent might be discreet; but what was to be expected from the discretion of servants? The story would spread from the footmen to the waiting-maids, and from these to their ladies, till it would meet her at every turn. Nor had her imprudent consent left her the power of disclaiming all concern in it, by forbidding Hargrave her house, since he would probably revenge himself by disclosing her share in the strategem. Lady Pelham saw no better success of palliating these evils, than by dismissing her establishment and returning immediately to Walbourne; and she hoped, at the same time, that it might not be impossible to prevail on Laura to change the direction of her journey. For this purpose she began by beseeching her niece to lay aside thoughts of retiring to Scotland; and was beginning to recount all the disadvantages of such a proceeding; but Laura would listen to no remonstrance on the subject; declaring that, if after what had happened, she remained in a place where she was liable to such outrage, she should be herself accountable for whatever evil might be the consequence. Lady Pelham then proposed an immediate removal to Walbourne, artfully insinuating that, if any cause of complaint should there arise, Laura would be near the advice and assistance of her friends at Norwood, and of Mrs Bolingbroke. Laura was not without some wishes that pointed towards Walbourne; but she remembered the importunities which she had there endured, and she firmly resisted giving occasion to their renewal. Lady Pelham had then recourse to tender upbraidings. 'Was it possible that Laura, the only hope and comfort of her age, would quit her now, when she had so endeared herself to the widowed heart, reft of all other treasure—now when increasing infirmity required her aid—now when the eye which was so soon to close, was fixed on her as on its last earthly treasure! Would Laura thus cruelly punish her for a crime in which she had no share; a crime which she was willing to resent to the utmost of her niece's wishes!' Lady Pelham talked herself into tears, and few
- 75. hearts of nineteen are hard enough to resist the tears of age. Laura consented to accompany her aunt to Walbourne, provided that she should never be importuned on the subject of Hargrave, nor even obliged to see him. These conditions Lady Pelham solemnly promised to fulfil, and, well pleased, prepared for her journey. Hargrave, however, waited on her before her departure, and excused himself so well on the score of his passion, his despair, and his eager desire to be allied to Lady Pelham, that, after a gentle reprimand, he was again received into favour, informed of the promises which had been made against him, and warned not be discouraged if their performance could not immediately be dispensed with. Of this visit Laura knew nothing; for she adhered to her resolution of keeping her apartment, nor ever crossed its threshold, till, on the third day after her perilous adventure, the carriage was at the door which conveyed her to Walbourne.
- 76. CHAPTER XXX As Lady Pelham's carriage passed the entrance of the avenue which led to Norwood, Laura sunk into a profound reverie; in the course of which she settled most minutely the behaviour proper for her first meeting with De Courcy. She decided on the gesture of unembarrassed cordiality with which she was to accost him; intending her manner to intimate that she accounted him a friend, and only a friend. The awkwardness of a private interview she meant to avoid by going to Norwood next day, at an hour which she knew that Montague employed in reading aloud to his mother. All this excellent arrangement, however, was unfortunately useless. Laura was taking a very early ramble in what had always been her favourite walk, when, at a sudden turn, she saw De Courcy not three steps distant. Her white gown shining through the still leafless trees had caught his attention, the slightest glimpse of her form was sufficient for the eye of love, and he had advanced prepared to meet her; while she, thus taken by surprise, stood before him conscious and blushing. At this confusion, so flattering to a lover, De Courcy's heart gave one bound of triumphant joy; but he was too modest to ascribe to love what timidity might so well account for, and he prudently avoided reminding Laura, even by a look, of either his hopes or his wishes. Quickly recollecting herself, Laura entered into a
- 77. conversation which, though at first reserved and interrupted, returned by degrees to the confidential manner which De Courcy had formerly won from her under the character of her father's friend. This confidence, so precious to him, De Courcy was careful never to interrupt. From the time of Laura's return, he saw her almost daily. She made long visits to Mrs De Courcy; he came often to Walbourne; they met in their walks, in their visits; they spent a week together under Mr Bolingbroke's roof; yet De Courcy religiously kept his promise, nor ever wilfully reminded Laura that he had a wish beyond her friendship. Always gentle, respectful and attentive, he never invited observation by distinguishing her above others who had equal claims on his politeness. She only shared his assiduities with every other woman whom he approached; nor did he betray uneasiness when she, in her turn, received attentions from others. His prudent self-command, had the effect which he intended; and Laura, in conversing with him, felt none of the reserve which may be supposed to attend intercourse with a rejected admirer. His caution even at times deceived her. She recollected Mrs Douglas's prophecy, that 'his attachment would soon subside into friendly regard,' and imagined she saw its accomplishment. 'How happy are men in having such flexible affections,' thought she with a sigh. 'I wonder whether he has entirely conquered the passion which, three short months ago, was to last through life—beyond life? I hope he has,' whispered she with a deeper sigh; and she repeated it again—'I hope he has,'—as if by repeating it, she would have ascertained that it was her real sentiment. Yet, at other times, some little inadvertency, unheeded by less interested observers, would awaken a doubt of De Courcy's self-conquest; and in that doubt Laura unconsciously found pleasure. She often reconsidered the arguments which her friend had used to prove that passion is unnecessary to the happiness of wedded life. She did not allow that she was convinced by them; but she half wished that she had had an opportunity of weighing them before she had decided her fate with regard to De Courcy. Meanwhile, much of her time was spent in his
- 78. Welcome to our website – the perfect destination for book lovers and knowledge seekers. We believe that every book holds a new world, offering opportunities for learning, discovery, and personal growth. That’s why we are dedicated to bringing you a diverse collection of books, ranging from classic literature and specialized publications to self-development guides and children's books. More than just a book-buying platform, we strive to be a bridge connecting you with timeless cultural and intellectual values. With an elegant, user-friendly interface and a smart search system, you can quickly find the books that best suit your interests. Additionally, our special promotions and home delivery services help you save time and fully enjoy the joy of reading. Join us on a journey of knowledge exploration, passion nurturing, and personal growth every day! ebookbell.com