Session 5.3: Levy
Download as PPT, PDF2 likes843 views
The document discusses using aptamers to target cells. Aptamers are nucleic acid molecules that can bind targets with high specificity and affinity, and have advantages over antibodies like small size and easy synthesis. The author describes selecting aptamers against cell surface receptors like transferrin receptor and PSMA on cancer cells, and DEC205 on dendritic cells. This allows targeted delivery of cargo like siRNA, drugs, or antigens to specific cell types for research and clinical applications like cancer treatment and vaccines.
Session 5.3: Levy
- 1. Levy Lab Matthew Levy Department of Biochemistry Albert Einstein College of Medicine Targeting cells with aptamers
- 2. Aptamers Nucleic acid based binding species Can be selected against a variety of targets Kd’s in the sub-nanomolar to nanomolar range with specificities (comparable to monoclonal antibodies) Small (ca. 10,000 MW) and easily synthesized in milligram or greater quantities Can be readily derivatized for conjugation Non-immunogenic Macugen, anti-VEGF aptamer, approved by FDA 2004 In vitro origin of aptamers allows for tailored selections
- 3. Aptamers exist naturally Small RNA loop binds protein (U1A) with pM affinity
- 4. In vitro selection of aptamers Constant regions Random region Of 40 nucleotides Library size = ~10 14-15
- 5. Aptamers that target cell surface receptors can be used for delivery of cargoes to cells siRNA Toxins Small molecule drugs Hicke et al. J Nucl Med. 2006 Apr;47(4):668-78 Anti-PSMA aptamer Anti-hTfR aptamer Anti-Tenascin C aptamer Aptamers can be used to target in vivo
- 6. Cancer/Aptamer projects underway in my lab Targeted drug delivery Transferrin Receptor PSMA Vaccine Development DEC205 (dendritic cell receptor)
- 7. The transferrin receptor (TfR, CD71) Cell surface (type II) glycoprotein involved in iron uptake Expressed at LOW levels on normal cells Expressed at HIGH levels on cells with high proliferation rates Highly over expressed in many cancers Expressed on activated PBMCs Expressed on the BBB. Transferrin and anti-TfR Abs have been demonstrated to cross the BBB Diagnostics Therapeutics
- 8. Selection for aptamers targeting the transferrin receptor 4 rounds of selection against recombinant protein Round 5 of selection conducted on HeLa cells (TfR+)
- 9. Anti-TfR aptamers label multiple human cancer cell lines FACs based analysis using AF488 labeled aptamer
- 10. Minimization eliminates more than half of the c2 sequence. c2 c2.min.2 c2.min.6 c2.min.9.1 38.6 kDa 14.0 kDa Brian Wengerter
- 11. Prostate-specific membrane antigen Two 2’F modified RNA aptamers (A9 and A10) selected by Lupold et al. (2002) 110 kDa type II transmembrane protein Expressed in high level by prostate tumor cells Expressed in tumor neovasculature Known to internalize via clatherin mediated endocytosis Using a library based on the A9 aptamer we have now performed a ‘doped’ selection Cytoplasmic domain Transmembrane domain Extracellular domain NH 2 COOH Catalytic domain NH 2 COOH Catalytic domain
- 12. Doped A9 selection GGGAGGACGATGCGGACCGAAAAAGACCTGACTTCTATACTAAGTCTACGTTCCCAGACGACTCGCCC (68) Linsley Kelly Heavily mutagenize (30%) Reselect (HeLa-PSMA cells)
- 13. Minimization of the anti-PSMA A9 aptamer GGGAGGACGATGCGGACCGAAAAAGACCTGACTTCTATACTAAGTCTACGTTCCCAGACGACTCGCCC (68) Linsley Kelly
- 14. These aptamers are currently being adapted for the delivery of a variety of cargoes
- 15. Targeting DEC 205 DEC205 is a C-type lectin expressed on the surface of dendritic cells (DCs) that is very efficient at cross-presentation. Cross-presentation = the ability to process and present extracellular antigens with MHC class I molecules to CD8 T cells (cytotoxic T cells). This process can be harnessed to enhance the immune response to tumors! An anti-DEC205 antibody fused to the protein NY-ESO-1 is currently in phase II clinical trials.
- 16. Targeting cell surface receptors with aptamers anti-DEC205 3 rounds of selection against recombinant protein Round 4 and 5 conducted on CHO DEC 205 (+)
- 17. Knocking down DEC205 with siRNA leads to decrease is surface staining Brian Wengerter Anti-DEC205 aptamers bind CHO cells that express DEC205
- 18. We have now minimized our DEC205 aptamers We have made aptamer OVA conjugates are learning to do antigen presentation assays on primary DCs (thank you Debbie Palliser). Brian Wengerter
- 19. Summary Aptamers posses unique qualities that make them well suited for the targeted delivery of cargoes to cells and translation to the clinic. siRNA and drugs to cancer cells Targeting dendritic cells (DEC205) for antigen presentation These technologies can be broadly applied to other receptors and multiple types of cancer.
- 20. Acknowledgements Lab Members: Amos Yan Maria Magalhaes Linsley Kelly Brian Wengerter Funding: Albert Einstein College of Medicine Marion Bessin Liver Research Center NIH/NIGMS, 1R01GM087985-01 SU2C/AACR, IRG Collaborators: AECOM Debbie Palliser Steve Almo Peng Wu David Soriano del Amo Rockefeller University Steinmann Lab Chae Gyu Park Jake Rosenberg