![8
extension were the same used for cloning (described above). All mutations were137
confirmed by DNA sequencing.138
Protein expression and purification139
Transformed E. coli BL21 (DE3) cells with pNESS2 were grown in 4 x 1 L of LB140
supplemented with 100 µg/ml carbenicillin. This was performed in a 2.8 L Fernbach flask141
at 37 °C and 250 rpm until OD600 nm reached ~0.6. Protein expression was induced by the142
addition of 0.5 mM isopropyl-β-D-1-thiogalactopyranoside. Cells were incubated at 25143
°C and harvested after 16 h by centrifuging at 5000 x g and 4 °C for 15 min. The cell144
paste was resuspended in Buffer C [20 mM Tris-HCl pH 8.0, 200 mM NaCl, 5% (v/v)145
glycerol, 10 mM imidazole] and disrupted by sonication. The resulting suspension was146
centrifuged twice at 30000 x g and 4 °C for 15 min and the soluble fraction (crude147
extract) was loaded onto a 5 ml HisTrap column (GE Life Sciences, Piscataway, NJ)148
containing Ni2+
and previously equilibrated with Buffer C. Elusion of the retained149
proteins was achieved with a linear imidazole gradient (20 column volumes, 10-300150
mM). Fractions containing sucrose synthase activity were pooled, concentrated to 2 ml,151
and loaded onto a 16/60 Superdex 200 column (GE Life Sciences) previously152
equilibrated with 50 mM HEPES-NaOH pH 8.0 and 300 mM NaCl. Fractions containing153
enzyme activity were pooled, concentrated, supplemented with 5% (v/v) glycerol, and154
stored at -80 °C until use. Under these conditions the enzyme remained stable and fully155
active for at least 3 months.156
Protein assay and detection157
Protein concentration was determined by measuring the protein absorbance at 280158
nm using a NanoDrop 1000 (Thermo Fisher Scientific) and an extinction coefficient of159](https://image.slidesharecdn.com/c5f45068-74ee-41cb-b902-97a532bd8fc5-160627180844/85/SucSase-8-320.jpg)
SucSase
- 1. 1 The crystal structure of Nitrosomonas europaea sucrose synthase reveals critical1 conformational changes and insights into the sucrose metabolism in prokaryotes2 3 Rui Wu,a Matías D. Asención Diez,a,b Carlos M. Figueroa,a,b Matías Machtey,b Alberto A.4 Iglesias,b Miguel A. Ballicora,a and Dali Liua #5 6 Department of Chemistry and Biochemistry, Loyola University Chicago, Chicago,7 Illinois, USAa ; Instituto de Agrobiotecnología del Litoral, Universidad Nacional del8 Litoral and Consejo Nacional de Investigaciones Científicas y Técnicas, Centro9 Científico Tecnológico Santa Fe, Santa Fe, Argentinab 10 11 Running Head: Crystal structure of a prokaryotic sucrose synthase12 13 #Address correspondence to Dali Liu, dliu@luc.edu14 15 R.W., M.D.A.D. and C.M.F. contributed equally to this work16 17 18 19 JB Accepted Manuscript Posted Online 26 May 2015 J. Bacteriol. doi:10.1128/JB.00110-15 Copyright © 2015, American Society for Microbiology. All Rights Reserved.
- 2. 2 ABSTRACT20 In this paper we report the first crystal structure of a prokaryotic sucrose synthase21 from the non-photosynthetic bacterium Nitrosomonas europaea. The obtained structure22 was in an open form, whereas the only other available structure from the plant23 Arabidopsis thaliana was in a closed conformation. Comparative structural analysis24 revealed a “hinge-latch” combination, which is critical to transition between the open and25 closed forms of the enzyme. The N. europaea sucrose synthase shares the same fold as26 the GT-B family of the retaining glycosyltransferases. In addition, a triad of conserved27 homologous catalytic residues in the family showed to be functionally critical in the N.28 europaea sucrose synthase (Arg567, Lys572, Glu663). This implies that sucrose synthase29 shares not only a common origin with the GT-B family, but also a similar catalytic30 mechanism. The enzyme preferred transferring glucose from ADP-glucose rather than31 UDP-glucose like the eukaryotic counterparts. This predicts that these prokaryotic32 organisms have a different sucrose metabolic scenario from plants. Nucleotide preference33 determines where the glucose moiety is targeted after sucrose is degraded.34 IMPORTANCE35 We obtained biochemical and structural evidence of sucrose metabolism in non-36 photosynthetic bacteria. Until now, only sucrose synthases from photosynthetic37 organisms have been characterized. Here, we provide the crystal structure of the sucrose38 synthase from the chemo-litho-autotroph N. europaea. The structure supported that the39 enzyme functions with an open/close induced fit mechanism. The enzyme prefers as40 substrate adenine-based nucleotides rather than uridine-based like the eukaryotic41 counterparts, implying a strong connection between sucrose and glycogen metabolism in42
- 3. 3 these bacteria. Mutagenesis data showed that the catalytic mechanism must be conserved43 not only in sucrose synthases, but also in all other retaining GT-B glycosyltransferases.44 45
- 4. 4 INTRODUCTION46 In plants, sucrose is a major photosynthetic product and plays a key role not only47 for carbon partition but also in sugar sensing, development, and regulation of gene48 expression (1-3). It was first thought that sucrose metabolism was a characteristic of49 plants but it was later found in other oxygenic photosynthetic organisms (4, 5). In the last50 decade, Salerno and coworkers demonstrated the importance of sucrose for carbon and51 nitrogen fixation in filamentous cyanobacteria (6, 7). More recently, genomic and52 phylogenetic analyses revealed the existence of sucrose-related genes in non-53 photosynthetic prokaryotes such as proteobacteria, firmicutes, and planctomycetes (4, 5,54 8). It has been suggested that these organisms acquired the genes of sucrose metabolism55 by horizontal gene transfer (4, 5, 8). However, analysis of the enzymes encoded by such56 genes is currently lacking.57 Nitrosomonas europaea is a chemo-litho-autotrophic bacterium that obtains58 energy by oxidizing ammonia to hydroxylamine and nitrite in presence of oxygen (9). It59 is a member of the β-proteobacteria group with a putative photosynthetic ancestor (10).60 N. europaea has potential for many biotechnological applications, including61 bioremediation of water contaminated with chlorinated aliphatic hydrocarbons (11) or62 ammonia, in combination with Paracoccus denitrifi (9). N. europaea displays some63 metabolic resemblance to photosynthetic organisms, but with marked differences. For64 instance, it possesses all the coding genes for enzymes of the Calvin-Benson cycle, but65 with two exceptions that could be replaced by other glycolytic enzymes (12). All the66 genes coding for enzymes from the tricarboxylic acid cycle were found in N. europaea67 (12); however, activity of α-ketoglutarate dehydrogenase is non-detectable (13).68
- 5. 5 The evidence from genomic studies suggests that N. europaea can synthesize69 sucrose (12); however, the biochemical properties of enzymes from sucrose metabolism70 have not been characterized. Generally, in plants, sucrose is synthesized from UDP-71 glucose (UDP-Glc) and fructose-6-phosphate (Fru-6P) in a reaction catalyzed by sucrose-72 6-phosphate synthase (EC 2.4.1.14), followed by removal of the phosphate group by73 sucrose-6-phosphatase (EC 3.1.3.24). The disaccharide can be degraded to Glc and Fru74 by invertases (EC 3.2.1.26) or cleaved by UDP to form UDP-Glc and Fru by sucrose75 synthase (NDP-glucose:D-fructose 2-α-D-glucosyltransferase, EC 2.4.1.13, also76 abbreviated as SUS or SuSy) (2, 3). However, some plant sucrose synthases have a77 certain degree of substrate promiscuity (14-21) while the one from Thermosynechococcus78 elongatus prefers ADP (16). For that reason, a general reversible reaction could be79 written as:80 NDP + sucrose ⇌ NDP-Glc + Fru81 Besides its physiological role, sucrose synthase catalyzes a reversible reaction and82 its activity can be measured in both directions in vitro. In filamentous cyanobacteria, the83 products derived from sucrose cleavage contribute to other biological processes, such as84 polysaccharides synthesis (22). Therefore, understanding the catalysis and the regulation85 of sucrose synthase is of great significance. Recently, Zheng et al. (23) reported the86 crystal structure of the Arabidopsis thaliana sucrose synthase in complex with UDP and87 fructose in a closed conformation. This enzyme is a homotetramer composed of four88 identical subunits of ~90 kDa and belongs to group 4 of the GT-B retaining89 glycosyltransferase family (http://www.cazy.org/GlycosylTransferases.html) (24). A SNi-90 like reaction mechanism has been proposed for this enzyme family (23-25).91
- 6. 6 Although several cyanobacterial (8, 16, 19) and plant (14, 17, 26-29) sucrose92 synthases have been characterized, the enzyme from non-photosynthetic bacteria has93 never been studied and no structural information of any sucrose synthase from bacterial94 sources is available. In this work we report the recombinant expression and biochemical95 characterization of N. europaea sucrose synthase and its crystal structure. We also96 determined the catalytic implications of highly conserved residues and the specificity for97 nucleotide substrates.98 99 MATERIALS AND METHODS100 Materials101 Chemicals and coupled enzymes used for activity assays were from Sigma-102 Aldrich (St. Louis, MO). Escherichia coli BL21 (DE3) cells were purchased from New103 England BioLabs (Ipswich, MA). Bacterial growth media and antibiotics were from104 Fisher Scientific (Pittsburgh, PA) and Sigma-Aldrich. Crystallization screen solutions and105 other supplies were purchased from Hampton Research (Aliso Viejo, CA) and Emerald106 Bio (Bedford, MA). All the other chemicals were of the highest quality available.107 Cloning108 The sequence coding for the sucrose synthase from N. europaea (gene ss2,109 accession: CAD85125.1) was amplified by PCR using genomic DNA from N. europaea110 ATCC 19718 as template, the specific oligonucleotides111 CATATGACCACGATTGACACACTCGCCACCTGTACCC (forward, NdeI site112 underlined) and GTCGACTCATATCTCATGGGCCAGCCTGTTTGCCAGCGGCC113 (reverse, SalI site underlined) as primers, and Phusion HF DNA polymerase (Thermo114
- 7. 7 Fisher Scientific, Rockford, IL) following the manufacturer’s instructions. The program115 used included an initial denaturation of 30 s at 98 °C; 30 cycles of 98 °C for 5 s, 50 °C116 for 20 s, and 72 °C for 2 min; and a final extension of 72 °C for 5 min. The PCR product117 was purified after agarose gel electrophoresis and inserted into the pSC-B vector using118 the StrataClone Blunt PCR cloning kit (Agilent Technologies, Santa Clara, CA).119 Sequence identity was checked by automated DNA sequencing at CRC (Comprehensive120 Cancer Center at University of Chicago, IL). Afterwards, the sequence was subcloned121 into the pET28c vector (Merck KGaA, Darmstadt, Germany) between NdeI and SalI sites122 to obtain pNESS2, which is the plasmid that encodes the recombinant N. europaea123 sucrose synthase with an N-terminal His6-tag.124 Site-directed mutagenesis125 Site-directed mutagenesis was performed by PCR overlap extension as previously126 described using Phusion DNA polymerase (30, 31). The plasmid encoding the N.127 europaea sucrose synthase (pNESS2) was used as a template for mutagenesis.128 To introduce mutations in pNESS2 we used the following primers:129 TTTACCATGGCGgcgCTGGATCGGATC (forward) and130 GATCCGATCCAGcgcCGCCATGGTAAA (reverse) for mutant R567A;131 CTGGATCGGATCgcgAACATTACCGGC (forward) and132 GCCGGTAATGTTcgcGATCCGATCCAG (reverse) for mutant K572A; and133 CCAGCCCTGTTCgcgGCATTCGGCCTG (forward) and134 CAGGCCGAATGCcgcGAACAGGGCTGG (reverse) for mutant E663A. PCR135 conditions were the same as those described above. Flanking primers for the PCR overlap136
- 8. 8 extension were the same used for cloning (described above). All mutations were137 confirmed by DNA sequencing.138 Protein expression and purification139 Transformed E. coli BL21 (DE3) cells with pNESS2 were grown in 4 x 1 L of LB140 supplemented with 100 µg/ml carbenicillin. This was performed in a 2.8 L Fernbach flask141 at 37 °C and 250 rpm until OD600 nm reached ~0.6. Protein expression was induced by the142 addition of 0.5 mM isopropyl-β-D-1-thiogalactopyranoside. Cells were incubated at 25143 °C and harvested after 16 h by centrifuging at 5000 x g and 4 °C for 15 min. The cell144 paste was resuspended in Buffer C [20 mM Tris-HCl pH 8.0, 200 mM NaCl, 5% (v/v)145 glycerol, 10 mM imidazole] and disrupted by sonication. The resulting suspension was146 centrifuged twice at 30000 x g and 4 °C for 15 min and the soluble fraction (crude147 extract) was loaded onto a 5 ml HisTrap column (GE Life Sciences, Piscataway, NJ)148 containing Ni2+ and previously equilibrated with Buffer C. Elusion of the retained149 proteins was achieved with a linear imidazole gradient (20 column volumes, 10-300150 mM). Fractions containing sucrose synthase activity were pooled, concentrated to 2 ml,151 and loaded onto a 16/60 Superdex 200 column (GE Life Sciences) previously152 equilibrated with 50 mM HEPES-NaOH pH 8.0 and 300 mM NaCl. Fractions containing153 enzyme activity were pooled, concentrated, supplemented with 5% (v/v) glycerol, and154 stored at -80 °C until use. Under these conditions the enzyme remained stable and fully155 active for at least 3 months.156 Protein assay and detection157 Protein concentration was determined by measuring the protein absorbance at 280158 nm using a NanoDrop 1000 (Thermo Fisher Scientific) and an extinction coefficient of159
- 9. 9 1.153 ml mg-1 cm-1 , determined from the amino acid sequence using the ProtParam server160 (http://web.expasy.org/protparam/). Denaturing protein electrophoresis was performed as161 described by Laemmli (32).162 Enzyme assays163 Activity assays were performed as previously described (16), with minor164 modifications. In the direction of sucrose synthesis, the reaction medium contained 50165 mM HEPPS pH 8.0, 10 mM MgCl2, 5 mM UDP-Glc, 500 mM Fru, 0.3 mM166 phosphoenolpyruvate, 0.3 mM NADH, 1 U pyruvate kinase, 1 U lactate dehydrogenase,167 0.2 mg ml-1 BSA, and enzyme in an appropriate dilution in a final volume of 50 µl.168 Alternatively, activity was measured with 1 mM ADP-Glc and 20 mM Fru. NADH169 oxidation was followed by measuring the absorbance at 340 nm in a Multiskan Ascent170 microplate reader (Thermo Fisher Scientific) at 37 °C. One unit of enzyme activity (U) is171 defined as the amount of protein necessary to produce 1 µmol of product in 1 min under172 the specified conditions.173 Kinetic characterization174 Since the saturation kinetics of the enzyme were slightly sigmoidal, data of initial175 velocity (v) versus substrate concentration (S) were plotted and fitted to a modified Hill176 equation: v = Vmax SnH / (S0.5 nH + SnH ), where S0.5 is the concentration of substrate177 necessary to obtain 50% of the maximal velocity (Vmax) and nH is the Hill coefficient.178 Fitting was performed by a non-linear least-squares algorithm provided by the software179 Origin 7.0 (OriginLab Corporation). Kinetic parameters were obtained using the averages180 of two independent datasets that were reproducible within errors of ± 10%.181 Phylogenetic analysis182
- 10. 10 We searched for protein sequences using the term “sucrose synthase” and applied183 the RefSeq filter in the National Center for Biotechnology Information (NCBI) database.184 Afterwards, we manually curated them to discard some which were clearly wrongly185 annotated since they had higher identity to other glycosyltransferases. Sequences were186 analyzed with the program BioEdit 7.0.5.3 (33) and aligned using the ClustalW server187 (http://www.genome.jp/tools/clustalw/). Tree reconstruction was performed using the188 Neighbor-Joining algorithm with a bootstrap of 1000 in the program SeaView 4.4.0 (34).189 The tree figure was prepared using the FigTree 1.4.0 software190 (http://tree.bio.ed.ac.uk/software/figtree/).191 Crystallization and data collection192 After the initial crystallization screen and optimization, the recombinant protein193 was crystallized via the hanging drop method. The hanging drops were prepared with 1 µl194 of 15 mg ml-1 sucrose synthase and 1 µl of the reservoir solution, containing 5%195 Tacsimate pH 5.0, 5% (w/v) PEG 3350, and 0.1 M sodium citrate pH 5.6. The hanging196 drops were kept at 20 °C for crystallization. Crystals appeared in 3 days and were197 allowed to continue growing at 20 °C for 4 more days until they reached their maximum198 sizes. Crystals with good morphology and large sizes were transferred to a cryo-199 condition, which contained 25% glycerol in addition to the components of the reservoir200 solution, before being frozen in liquid nitrogen.201 X-ray diffraction data sets were collected at the SBC19-ID beamline at the202 Advanced Photon Source (Argonne National Laboratory, Chicago, IL). The wavelength203 used in the monochromatic data collection was 1.008 Å. All the collected data sets were204 indexed and integrated using iMosflm and scaled with Scala in the CCP4 program suite205
- 11. 11 (Collaborative Computational Project Number 4) (35). After investigating all statistic206 values indicating data quality, especially I/σ<I>, and CC1/2 (36), we decided to cut the207 data resolution at 3.05 Å, where I/σ<I> = 2 while CC1/2 = 0.561 indicating good data208 quality (Table 2).209 Phasing, model building, and refinement210 Molecular replacement was carried out using the program Phaser (37) from the211 CCP4 program suite. The starting search model in molecular replacement was modified212 from the known A. thaliana sucrose synthase structural model (PDB ID: 3S29) (23). The213 molecular replacement using the full-length A. thaliana Sucrose synthase as a search214 model did not yield any solutions using Phaser. Suspecting that and inter-domain215 movement may have been the problem; we tried to virtually isolate some domains based216 on homology. Then, when we truncated the GT-B(D) domain (cyan domain in Fig. 1B)217 and used the rest of the molecule as the search model for molecular replacement in218 Phaser, a solution was finally obtained. Afterwards, model building was conducted in219 COOT (38). The GT-B(D) domain was built according to the electron density maps.220 Rigid body refinement and restrained refinement were conducted in refmac5 (39). In221 order to remove model bias and achieve the best refinement results possible, simulated222 annealing refinement and ordered solvent identification were conducted using223 PHENIX.refine (40). Final model and the structure factor have been deposited in the224 RCSB Protein Data Bank with the accession code 4RBN.225 Homology modeling226 A model of the monomeric closed form of the N. europaea sucrose synthase227 (residues 16 to 788) was constructed with the program Modeller 9.11228
- 12. 12 (http://salilab.org/modeller/) (41). As template we used the atomic coordinates of the A.229 thaliana sucrose synthase (3S27) with the ligands UDP and fructose (23). Before the230 modeling process, sequence alignment was performed manually to match functionally231 conserved residues and secondary structures. An identity of 50.3% ensured a high232 confidence alignment since we only had to introduce four one-residue indels. The233 accuracy of the models was assessed with the Verify3D Structure Evaluation Server234 (http://nihserver.mbi.ucla.edu/Verify_3D/) (42).235 Difference distance matrix map236 We used an ad hoc program written in C applying previously developed concepts237 to detect domain motion and identify regions that move closer upon conformational238 changes (43). Distances were calculated between all pair of Cα of one reference structure239 (open), and a second pairwise distance matrix was calculated for the target (closed)240 structure. Afterwards, the target matrix was subtracted from the reference matrix to241 calculate the Δdistance plot (https://github.com/ballicoragroup/didimama).242 Hinge analysis243 In order to detect possible local conformations or hinges, we performed an244 analysis with the ad hoc program “hingescan”245 (https://github.com/ballicoragroup/hingescan). We compared the crystal structure of the246 open form of the N. europaea sucrose synthase with a closed form homology model of247 the same enzyme. To detect if there is a significant local conformational change around a248 given residue (“hinge”), we extracted the coordinates of a given number (n) of Cα before249 the putative hinge and the same given number (n) of residues after (window size = 2n+1).250 This was done for both the open and closed forms and obtained two fragments to251
- 13. 13 compare. After optimal rigid body superposition of only these two set of coordinates, an252 average distance was calculated (root-mean-square deviation, RMSD). This RMSD253 calculated in these conditions was called the “hinge score”. When this score is at a peak,254 the “flanking” n number of Cα at both sides display a maximum change between the two255 structures. For that reason, a hinge is detected. The bigger the window, the bigger the256 domain movement is detected surrounding the hinge. To identify hinges that link small257 and bigger domains, different window sizes were scanned. A flowchart illustrating the258 process is in Fig. S1.259 260 RESULTS AND DISCUSSION261 Sequence analysis262 To know how the sucrose synthase from N. europaea relates to others from263 divergent organisms we constructed a phylogenetic tree using 117 amino acid sequences264 retrieved from the NCBI database (Fig. 2, Table S1, and Fig. S2). The tree comprised265 seven major branches, containing the sequences from cyanobacteria (group I; 21266 sequences), proteobacteria (groups II and III; 17 sequences), the moss Physcomitrella267 patens subsp. patens (group IV; 4 sequences), and vascular plants (groups V, VI, and VII;268 75 sequences) (Fig. 2). The shape of the tree shown in Fig. 2 is similar to the one269 published by Kolman et al. (8). Group I is subdivided in two branches, containing the270 sequences encoded by the susA (cyan) and susB (orange) genes (Fig. 2) (8). Most271 sequences from proteobacteria are included in group III (including β-, γ- and δ-272 proteobacteria); though, the sequences from δ-proteobacterium MLMS-1 and273 Desulfurivibrio alkaliphilus AHT2 are in a diverging branch (group II) (Fig. 2). Sucrose274
- 14. 14 synthase sequences from P. patens subsp. patens (group IV) are clearly separated from275 those of vascular plants (Fig. 2). Interestingly, groups V and VII are further divided in276 two major branches, containing the sequences from dicots (green) and monocots (blue),277 respectively. This separation is less clear in group VI (Fig. 2). The sucrose synthase from278 N. europaea is in a small branch with other β-proteobacteria in group III (proteobacteria).279 Clearly, it is well separated from plant and cyanobacterial enzymes, although they share a280 significant similarity. For instance, the identity between sequences from N. europaea and281 those from Nostoc sp. PCC 7120 susA, P. patens, Zea mays sucrose synthase 1, and A.282 thaliana sucrose synthase 1 were 45.3, 49.3, 50.4, and 50.3%, respectively (Fig. S2).283 These values are indicative of a high structural conservation among enzymes from very284 divergent organisms.285 Protein expression and characterization286 The gene of the putative sucrose synthase in N. europaea (NCBI Protein ID287 NP_841269) codes for 794 amino acids. To shed light on sucrose metabolism of group III288 (Fig. 2), we amplified this sequence and expressed the recombinant protein in E. coli289 cells. The enzyme was purified to homogeneity by HisTrap column and gel filtration290 chromatography as mentioned in “Materials and Methods”. The recombinant protein291 migrated in SDS-PAGE as a single band of ~95 kDa (data not shown), which is in good292 agreement with the predicted molecular mass of 93 kDa (including the His-tag provided293 by the pET28c vector). The enzyme eluted from the Superdex 200 (size exclusion)294 column as a protein of ~360 kDa (data not shown), suggesting a tetrameric quaternary295 structure, as it was reported for cyanobacterial and plant sucrose synthases (16, 19, 23).296 Substrate specificity of the sucrose synthase from N. europaea297
- 15. 15 Sucrose synthases from plants have shown a certain degree of promiscuity to298 transfer glucoses from ADP-Glc and UDP-Glc, though UDP-Glc is generally preferred.299 We tested the substrate specificity of sucrose synthase from N. europaea in the sucrose300 synthesis direction (Table 1), and observed that ADP-Glc is a more efficient substrate301 than UDP-Glc. The main difference is not given by Vmax, but by a higher apparent affinity302 towards ADP-Glc. The S0.5 for ADP-Glc is 0.044 mM in presence of optimal303 concentrations of Fru (20 mM); whereas the S0.5 for UDP-Glc is 0.98 mM in presence of304 optimal concentrations of Fru (500 mM). On the other hand, the apparent affinity for Fru305 is higher in presence of ADP-Glc rather than UDP-Glc. The S0.5 for Fru at saturated306 concentrations of ADP-Glc is 5.6 mM whereas the S0.5 for Fru in presence of UDP-Glc is307 significantly higher. Because of the high concentrations of Fru needed to reach saturation,308 it is not possible to measure the S0.5 for Fru with high precision; but it is at least ~20-fold309 higher (120 mM). The catalytic efficiencies calculated for ADP-Glc and Fru(ADP-Glc) were310 17- and 37-fold higher than those obtained for UDP-Glc and Fru(UDP-Glc), respectively311 (Table 1). These results indicate that the sucrose synthase from N. europaea prefers ADP-312 Glc over UDP-Glc as substrate. Similar conclusions were obtained for the enzyme from313 the cyanobacterium T. elongatus, which showed a 26-fold higher catalytic efficiency for314 ADP-Glc than UDP-Glc (16). As it was stated for T. elongatus (16), this suggests that the315 metabolism of sucrose could be linked to the synthesis of glycogen, since ADP-Glc is the316 donor for its polymerization.317 X-ray diffraction, data processing, model building, and refinement318 The best data set collected at synchrotron beamline was processed to 3.05 Å and319 indexed as space group P65. It was integrated and scaled producing good statistics (Table320
- 16. 16 2). After the molecular replacement search, four copies of the starting model described in321 “Materials and Methods” were found in one asymmetric unit. Iterative cycles of model322 building and refinement were conducted yielding a well-defined structure with Rwork and323 Rfree values of 17.37 % and 21.75 %, respectively (Table 2). The truncated GT-B(D)324 domain was built according to the electron density map. The final structural model325 contains all the residues except the first three at the N-terminus and the last two at the C-326 terminus of the amino acid sequence (Fig. 1).327 Structural analysis of the sucrose synthase from N. europaea328 Overall structure. Although the resolution of the data set was 3.05 Å, the329 backbone of the protein and some of the key residues side chains were well defined by330 the electron density (Fig. S3 and Fig. S4). This allowed us to conduct detailed structural331 analysis on sucrose synthase’s conformational changes involving backbone movement,332 which are relevant to the catalytic cycle. The crystal structure displayed a similar fold to333 the previously reported structural model from the A. thaliana enzyme (PDB ID 3S29)334 (23). The sucrose synthase from N. europaea is a tetramer composed of four identical335 subunits (Fig. 1A), where each monomer contains four domains (Fig. 1B).336 The first domain designated as “Sucrose Synthase N-terminal-1” (SSN-1)337 included residues 1-112 (Fig. 1B, red) and contained five α-helices and four β-strands.338 The second domain, which included residues 142-264, is the “Sucrose Synthase N-339 terminal-2” (SSN-2) domain (Fig. 1B, green) with five α-helices. Domain SSN-1 and340 SSN-2 correspond to domains CTD and EPBD in the enzyme from A. thaliana (23). CTD341 and EPBD stand for “cellular targeting domain” and “ENOD40 peptide-binding domain”,342 which indicate the domain functions for the plant enzyme. In the case of the bacterial343
- 17. 17 form, the roles for these domains are not known, thus the nomenclature is only based on344 structure. Both the third and fourth domains constitute a typical GT-B fold of345 glycosyltransferases (24). The third is a domain that typically binds the nucleotide donor346 for the glycosyl group in that family (23, 25, 44). For this reason, we refer to it as GT-347 B(D) domain (Fig. 1B, cyan), although in sucrose synthase the transfer of glucosyl group348 is reversible. This nomenclature also matches the systematic name of the sucrose349 synthase (NDP-glucose:D-fructose 2-α-D-glucosyltransferase). The GT-B(D) domain350 includes residues 514-742 with eight α-helices and three β-strands. The fourth domain is351 the GT-B(A) domain (Fig. 1B, blue and yellow), which consists of residues from three352 separate regions. These separate regions are encompassed by the SSN-1, SSN-2 and GT-353 B(D) domains in the center of the monomer. The first region is a linker (residues 113-354 141) that joins SSN-1 and SSN-2 but structurally integrated to GT-B(A). The other two355 regions are 265-513, and 743-794. The GT-B(A) domain included nine α-helices and356 eight β-strands and functions in the GT-B family as the sugar acceptor (A) in catalysis357 (23, 25, 44).358 As mentioned above, the identity between sequences from N. europaea and A.359 thaliana is considerably high (50.3%). When the different domains were analyzed360 separately, we found identity values of 26.2% for SSN-1 (CTD), 40.2% for SSN-2361 (EPBD), 52.4% for GT-B(D), and 61.9% for GT-B(A), suggesting a high structural362 conservation. A comparison between the A. thaliana and N. europaea x-ray structures363 confirms it. With the exception of conformational changes, each of the folds for their364 respective domains is identical. The fact that the structure is so conserved, even for the365 domains that are not related to catalysis, would suggest that certain non-catalytic366
- 18. 18 functional roles have been preserved or adapted. On the other hand, SSN-1 (CTD in A.367 thaliana) does not have the Ser that is phosphorylated in plants, indicating that it is a role368 acquired in eukaryotes. Therefore, it is not certain whether N. europaea sucrose synthase369 is regulated for binding macromolecular structures such as actin or membranes as plant370 enzymes do (26, 45). Prokaryotes do not have cytoskeleton, although actin related371 proteins have been detected in Anabaena species (46). Whether sucrose synthase from372 bacteria can actually interact with actin or similar structures is a matter of further studies.373 In N. europaea, SSN-2 is involved in the oligomerization forming one of the374 contacts between subunits. It is not clear if it has any other physiological role. In A.375 thaliana, EPBD (SSN-2 in N. europaea), together with the CTD domain (SSN-1 in N.376 europaea), forms a groove hypothesized to bind actin (23). In our structure, the same377 structural arrangement is present (data not shown) highlighting the possibility that a378 similar role has been conserved. However, this needs to be investigated.379 The obtained N. europaea sucrose synthase structure with no substrates bound has380 a clearly different overall conformation when compared to the A. thaliana structure with381 UDP and Fru (23). This implies that substrate binding induces significant conformational382 changes (Fig. 3), and correlates with similar conformational changes that occur upon383 binding of substrates in other GT-B retaining glycosyltransferases (25, 47). After384 superimposition of only the GT-B(A) domains of the A. thaliana and N. europaea385 structures (using the least squares function in COOT), the SSN-1, SSN-2, and GT-B(A)386 domains overlapped well while the GT-B(D) domains were in a different relative387 position. The angle between the GT-B(A) and GT-B(D) domains in the obtained structure388 was about 23.5 degrees wider than in A. thaliana. Based on such comparison, we suggest389
- 19. 19 that the N. europaea structure in this work was in an “open” conformation whereas the A.390 thaliana form was “closed” (23). We have identified some distinct structural391 determinants (hinges and latches) related to the movements of the sugar (GT-B(A)) and392 nucleotide (GT-B(D)) binding domains.393 Sugar-binding GT-B(A) domain. In this analysis, we compared the open structure394 crystal structure of N. europaea enzyme with the homology model in a closed395 conformation built as described in “Materials and Methods”. Considering how modeling396 works, and that the closed structure template (A. thaliana) has no gaps with the N.397 europaea target in the sites of interest, the backbone comparison with the model is as398 reliable as comparing the backbones of both structures directly. The RMSD of backbone399 between the model obtained and the closed A. thaliana template was 0.29 Å. However,400 the use of the model is more convenient since the number is not shifted, which would be401 really confusing in the following analysis. One of the important assumptions we make is402 that the closed structure of the A. thaliana enzyme is a fair representation of the closed403 structure of that from N. europaea. We believe that this is a reasonable assumption, at404 least in the critical areas. Otherwise, the backbone of critical residues may not align405 properly for catalysis.406 Analysis of a difference distant matrix map of the Fru-binding GT-B(A) domain407 as described in “Materials and Methods” highlights three main regions that move closer408 upon sugar binding (Fig. 4). These are 325-375 to 280-290 (~5 Å), 425-435 to 280-290409 (~4 Å), and 425-435 to 325-375 (~3 Å) (Fig. 4). Other pair of regions that move towards410 each other are 280-290 to 490-505 (~3 Å) and 280-290 to 450-460 (~2 Å) (Fig. 4). From411 this analysis, the area 280-290 is the most involved in an induced fit interaction with Fru.412
- 20. 20 Further inspection of these areas reveals that Fru induces local conformational changes413 via superimposition of the GT-B(A) domains of the A. thaliana (closed) and the N.414 europaea (open) sucrose synthase (Fig. 5). These include the side chain of K431 and the415 backbone of residues 288-290. The re-shaping of the Fru binding site facilitates the416 closing via a set of inter-domain hydrogen bonds (Fig. 5 in green). These local417 conformational changes along with the presence of Fru further promote the interactions418 between the GT-B(A) and GT-(D) domains. Thus, we propose that Fru binding419 contributes to stabilizing the closed structure.420 Nucleotide-binding GT-B(D) domain. The GT-B(D) domain binds to sugar421 nucleotide (synthesis direction) or nucleotide (cleavage direction) substrates. When422 overlapping GT-B(D) domains from both A. thaliana and N. europaea structures, the423 residues interacting with the phosphate and ribose moieties of the nucleotides are not only424 conserved, but also at the same positions (Fig. 6). On the other hand, two residues425 interacting with the nucleotide base are not conserved. Residues Q648 and N654 from A.426 thaliana are replaced by R636 and A642 in the N. europaea sucrose synthase,427 respectively. This difference creates a more spacious binding site in N. europaea, which428 may accommodate bulkier adenosine nucleotide substrates. Modeling an ADP ligand into429 the N. europaea structure shows that the site may have a deeper pocket, which would be430 needed not to clash with the adenine ring (Fig. 6 and Fig. 7). Similar sequence differences431 were observed in the sucrose synthase from T. elongatus (16). Based on sequence432 analysis and homology modeling it was suggested that these two residues could be433 responsible for the preference towards ADP/ADP-Glc over other nucleotides such as434 UDP/UDP-Glc in the cyanobacterial enzyme (16). It is important to notice that the side435
- 21. 21 chains in R636 and A642 in the N. europaea sucrose synthase are not conserved in the E.436 coli glycogen synthase, which is another glycosyltransferase that binds ADP-Glc (48). E.437 coli glycogen synthase has a different motif in that position with a Tyr and Ser instead of438 Arg and Ala (25, 47, 48), implying a different structural arrangement for accommodating439 ADP-Glc. Overall, the nucleotide binding to the GT-B(D) domain does not seem to440 trigger significant local conformational changes (Fig. 6). The direct interactions with the441 nucleotide do not make major contributions to the induced fit mechanism.442 Hinge Analysis. We scanned the structures of the acceptor and donor domains for443 hinges and subtle conformational changes that could be functionally important in444 catalysis. We used the in-house program hingescan described in “Materials and445 Methods”. Using several window sizes we detected several local conformational changes446 (Fig. S5). For a window size of 51, we detected two clear hinge elements near residues447 ~515 and ~744 (Fig. 8). These two elements actually form a single “hinge” that448 comprises a hydrogen bond between two conserved residues (G514 and W743) in a449 flexible area (Fig. 3, Fig. S4, and Fig. S5). These two residues remain at the same450 position in both the open and the closed conformations of the enzyme. For smaller451 windows, we found other significant local secondary structure rearrangements between452 the open and closed structures (Fig. S5, Fig. S6, and Fig. 8). Upon closing, two α-helices453 in the GT-B(D) domain are extended, and a β-strand replaces a previously coiled stretch.454 The outcome is a more ordered structure of the GT-B(D) domain. We propose that this455 secondary structure rearrangement, despite the local entropy decrease, would release456 extra energy to close the conformation facilitating the binding of substrates.457
- 22. 22 There are also differences between the conformations of the SSN-1 and SSN-2458 domains from the open structure of the N. europaea enzyme and the model of the closed459 form (Fig. 8). The analysis detected hinges because of local differences, and there are460 four major regions with scores above 2 (Fig. 8, Fig S5, Fig. S7). This predicts that some461 of the loops in these two domains are quite flexible, but we cannot assign a functional462 role to them (Fig. S7). In A. thaliana, the flexibility of the CTD domain (SSN-1) is463 hypothesized to have a role in actin binding (23).464 Latches. A feature that contributes to the stabilization of the closed form is a465 “latch”, E609, which comprises the highly conserved E609 residue located at the466 periphery of the GT-B(D) domain (Fig. S2). Going from an open to a closed467 conformation, this glutamate residue moves ~11 Å towards the GT-B(A) domain and468 ends up hydrogen-bonded to two tyrosine residues (Y432 and Y446) stabilizing the469 closing (Fig. 3 and Fig. S8). Interestingly, there were small secondary structure470 rearrangements in the vicinity of this latch, which could facilitate the interaction between471 E609 and the two tyrosines (Fig. S6). On the other side of the active site, opposite to the472 latch described, there is a hydrophobic patch that also contributes to the closing (Fig. 9).473 Two hydrophobic residues (M635, L637) in the GT-B(D) domain get in contact with a474 hydrophobic cluster (V281, L282 and L284) in the GT-B(A) domain, upon closing. The475 side chain of N280 also provides a methylene to build a non-polar pocket that latches on476 to M635 and L637 (Fig. 9). On the other hand, the amide polar group is exposed to the477 solvent.478 The closed structure seems to induce stronger interactions with the nucleotide and479 vice versa. In the N. europaea sucrose synthase, the conserved E671 is in the same480
- 23. 23 position as E369 in the E. coli trehalose-6-phosphate synthase (OtsA) (48, 49). In OtsA,481 as well as in the close conformation of the A. thaliana sucrose synthase (E683), the482 carboxylate of this side chain forms two hydrogen bonds with the hydroxyl groups of the483 ribose of the nucleotide. In these enzymes, the carboxylate is surrounded by hydrophobic484 residues (Y520, Y646, L667 and T668 in N. europaea sucrose synthase; Y533, Y658,485 L679 and T680 in the A. thaliana enzyme), which makes the hydrogen bonds stronger in486 the non-polar environment. In the open form of the sucrose synthase structure, V291487 (V306 in A. thaliana) moves away from the side chain of the glutamate residue (Fig. S9).488 This implies that the closing recruits a non-polar side chain to completely surround the489 carboxylate. Consequently, nucleotide binding stabilizes the carboxylate charge and490 facilitates the interaction with V291 upon closing. Interestingly, in another491 glycosyltransferase such as bacterial glycogen synthase, E671 has been replaced by a492 Tyr, and V291 was replaced by Asp, thus, switching their roles (48). Therefore, this493 ligand-dependent interaction may be a common feature in this family of enzymes.494 Site directed mutagenesis of critical residues495 Previously, important residues for catalysis were identified in other retaining GT-496 B glycosyltransferases. A triad of critical residues has been found in the active site of497 maltodextrin phosphorylase (50, 51) and glycogen synthase from E. coli (52). Based on498 X-ray structures, these residues were also predicted to be important for catalysis in OtsA499 (49) and the A. thaliana sucrose synthase (23). The homologue residues in N. europaea500 are R567, K572, and E663 (Fig. 10). When any of those residues were replaced by501 alanine the activity in the direction of sucrose synthesis severely decreased, either in502 presence of ADP-Glc or UDP-Glc (Table 3). The most active of all these mutants was503
- 24. 24 E663A in presence of ADP-Glc, but it was still 200-fold less active than the wild type.504 These results indicate that this triad is critical in sucrose synthases. Consequently, it also505 suggests that sucrose synthases together with all other retaining glycosyltransferases with506 a GT-B fold share the same reaction mechanism (Fig. 10).507 Structural and mechanistic consequences of the open/closed conformational change508 Large conformational movements may have a large impact on the architecture of509 the active site. For that reason, it is important to analyze how critical catalytic residues510 are arranged in the closed and open structure of sucrose synthase. We have identified and511 confirmed by mutagenesis three critical side chains in N. europaea sucrose synthase512 (R567, K572, E663, corresponding to R580, K485, E675 in A. thaliana). In addition, the513 comparison with other glycosyltransferases predicts another interaction (protein514 backbone-substrate) that stabilizes the transition state (24), which is not possible to be515 replaced by mutagenesis. The comparison between the open and closed forms of N.516 europaea and A. thaliana sucrose synthases, respectively, provide important information.517 But, the arrangement of the critical residues needs to be put in context of the reaction518 mechanism.519 It has been proposed that retaining glycosyltransferases either have a SNi-like520 mechanism with a oxocarbenium-phosphate short lived ion pair intermediate, or a SNi521 mechanism forming an oxocarbenium ion-like transition state that is not totally522 dissociated from the donor and acceptor (24, 53, 54). In either of those two cases, an523 important stabilization of the transition state would be based on the interaction between524 the anomeric carbon (C1) of the sugar being transferred and the oxygen of the main chain525 of a His residue (24, 55). Recently, an alternative elimination/addition mechanism has526
- 25. 25 been proposed for the Pyrococcus abyssi glycogen synthase (56), which was argued to be527 compatible with the current available data. In this mechanism, a general base is needed to528 extract a proton from C2 of the glycosyl group. The authors proposed this base is the529 same main chain oxygen from the His residue mentioned above. Interestingly, in the530 crystal structure of the A. thaliana sucrose synthase, the oxygen of the main chain of531 H438 (H425 in N. europaea) is at a close distance of both C1 and C2 of a proposed 1,5-532 anhydro-D-arabino-hex-1-enitol (Fig. S10). This ligand mimics the planar structure of the533 transition state in either the SNi, SNi-like, or the elimination/addition mechanism (56).534 This type of in situ generated intermediate was also observed in the E. coli and P. abyssi535 glycogen synthase (25, 56). Regardless of these alternative mechanisms, it must be536 critical that the main chain oxygen of H425 in N. europaea sucrose synthase is near537 C1/C2 in the transition state. Since this residue is located in the GT-B(A) domain, and538 there are other critical residues in GT-B(D) (Table 3), a precise arrangement between539 these two domains is necessary for a proper architecture of the catalytic site. Only in the540 closed structure all these functional groups would be at the right distance for catalysis541 (Fig. S10). Therefore, one of the roles of the closing is to bring the critical residues to a542 proper position.543 It is tempting to argue that UDP-Glc/ADP-Glc can induce the closing, based on544 the fact that the base and the ribose have numerous contacts with the GT-B(D) domain,545 and the glycosyl group with the opposing GT-B(A) domain (23). However, it is not clear546 how stable the closed form would be in presence of the donor without the acceptor.547 During the crystallization process, the A. thaliana enzyme cleaves UDP-Glc to generate548 UDP and possibly 1,5-anhydro-D-arabino-hex-1-enitol (or its tautomer 1,5-anhydro-D-549
- 26. 26 fructose) yielding a closed structure (23). But, this structure, which could occur550 transiently, may have been driven and stabilized by the extremely slow generation of 1,5-551 anhydro-D-arabino-hex-1-enitol. It is expected that this putative transition state analog552 binds favorably to the most active form of the enzyme, which in this case, is the closed553 one.554 The rationale for a conformational change induced by substrates (“induced fit”)555 was first described by Koshland to explain why a specific (good) substrate reacts faster556 than smaller (poor) alternatives that can also fit into the active site (57). If the changes557 that lead to a precise orientation of catalytic groups occur only upon binding of the (good)558 substrate, another (poor) substrate that does not trigger those conformational changes will559 not react effectively, even at high concentrations. This concept or at least its560 interpretation has been controversial (58, 59). On the other hand, Fersht stated that an561 induced fit mechanism does not increase substrate specificity per se (59), and the only562 contribution that matters is the relative binding affinities to the transition states of the563 competing reactions. According to this, to increase the sucrose synthase specificity for564 the acceptor Fru against water, selective interactions seems to be maximized by565 surrounding Fru completely by different functional groups from the enzyme.566 Consequently, the active site is isolated from the solution as it is shown in Fig. S11. For567 that reason, an induced fit mechanism becomes an indirect necessity to allow substrates568 and products to enter and leave, while maximizing a selective interaction with Fru.569 For retaining glycosyltransferases, another key issue is the stabilization of the β-570 phosphate to make it a better leaving group (54, 60). A hydroxyl group from the acceptor571 (Fru in this case) participates in a hydrogen bond with the β-phosphate. Consequently, the572
- 27. 27 oxygen of this group becomes a better nucleophile to attack the C1 of the forming573 oxocarbenium ion (54). Water could in theory compete with the acceptor (Fru) for this574 role, but is a poor substrate, probably because it does not stabilize the closed structure as575 well as Fru does. Fru not only interact with the phosphate leaving group, but also576 interacts more tightly with the closed form. Not only the distances between the residues577 in the GT-B(A) domain that contact Fru gets closer upon closing, but also networks of578 interactions of Fru with the GT-B(D) domain are established (Fig. 6 and Fig. S11).579 Noteworthy are the interaction of Fru with R580 (A. thaliana) and the hydrogen bond580 with K444 that brings the Y445 closer to E621, forming the latch (Fig. S11, panels D and581 E). Interestingly, the closed structure of the A. thaliana enzyme with the cleaved products582 of UDP-Glc seems to shape the active site to readily accommodate Fru. Even if Fru is583 absent, the site is nearly identical to the structure with Fru bound (Fig. S11, RMSD 0.27584 Å). On the other hand, the structure of the open form of the N. europaea enzyme does not585 have all these residues at a proper distance to bind Fru (Fig. S11, C). This indicates that586 Fru would preferentially bind to the closed form, stabilizing it.587 This mechanism in which the catalytic residues get into places upon closing may588 explain why it is not trivial to obtain a closed structure with an intact sugar-nucleotide.589 For instance, crystal structures of the closed forms were obtained for the E. coli glycogen590 synthase and the A. thaliana sucrose synthase grown in presence the sugar nucleotide, but591 the glycosyl group was slowly cleaved (23, 25, 56). There are other retaining GT-B592 structures with a sugar nucleotide bound, but those were described as “semi-closed” (44).593 A mechanism with a domain movement that allows the exchange of ligands to the594 solution is not unique for sucrose synthase and may be general among retaining GT-B595
- 28. 28 enzymes. However, not all of them may require such a large conformational change. The596 glycogen synthase was another case with closed and wide open structures described (25,597 47, 56). The sucrose-6-phosphate synthase must also have the same type of behavior, but598 only an open structure is available (61). In other cases, open/closed structures have been599 obtained, but the most significant movements were local rearrangement of loops (rather600 than a large domain rearrangement) such as in OtsA (44) and VldE (62, 63).601 602 CONCLUSIONS603 In this manuscript, we observed an “open” conformation for sucrose synthases.604 Based on the comparison with a previously published “closed” sucrose synthase structure605 (23), a “hinge-latch” combination was identified as a critical feature responsible for the606 open-close enzyme actions.607 We identified three highly conserved amino acids proposed to be critical for608 catalysis. We concluded that the triad composed of residues R567, K572, and E663609 (numbers according to the N. europaea enzyme) plays a key role not only in sucrose610 synthases, but also in all the retaining GT-B glycosyltransferases (23, 49-52).611 With both structural and kinetic results we propose that the sucrose synthase from612 N. europaea has a substrate preference in favor of ADP/ADP-Glc over UDP/UDP-Glc.613 This behavior is similar to the one observed for T. elongatus sucrose synthase (16).614 The evolutionary origin of enzymes from sucrose metabolism in proteobacteria615 has been previously discussed (4, 5, 8, 64). The evolution of sucrose synthases in616 cyanobacteria, proteobacteria, and plants is not yet fully understood, but most likely it617 involved horizontal gene transfers. On one hand, the sucrose synthase from N. europaea618
- 29. 29 is closer to the plant enzymes in the phylogenetic tree (Fig. 2), but on the other hand, the619 specificity for nucleotides is similar to several cyanobacterial enzymes examined (8, 16).620 It is possible that the enzyme from N. europaea evolved from a protein already present in621 the common ancestor of proteobacteria and cyanobacteria (10).622 623 AKNOWLEDGEMENTS624 This work was supported by grants from ANPCyT (PICT’12 2439) and625 CONICET (PIP 112-201101-00438) to A.A.I.; UNL (CAI+D 2011) to C.M.F. and626 A.A.I.; NSF (MCB-1024945) to M.A.B.; and NSF (CHE-1308672) to D.L. M.D.A.D.,627 C.M.F. and A.A.I. are researchers from CONICET.628 629
- 30. 30 REFERENCES630 1. Koch K. 2004. Sucrose metabolism: regulatory mechanisms and pivotal roles in631 sugar sensing and plant development. Curr Opin Plant Biol 7:235-246.632 2. Lunn JE. 2008. Sucrose Metabolism, Encyclopedia of Life Sciences. John Wiley633 & Sons.634 3. Winter H, Huber SC. 2000. Regulation of sucrose metabolism in higher plants:635 localization and regulation of activity of key enzymes. Crit Rev Biochem Mol636 Biol 35:253-289.637 4. MacRae E, Lunn J. 2012. Photosynthetic Sucrose Biosynthesis: An Evolutionary638 Perspective, p. 675-702. In Eaton-Rye JJ, Tripathy BC, Sharkey TD (ed.),639 Photosynthesis, vol. 34. Springer Netherlands.640 5. Salerno GL, Curatti L. 2003. Origin of sucrose metabolism in higher plants:641 when, how and why? Trends Plant Sci 8:63-69.642 6. Cumino AC, Marcozzi C, Barreiro R, Salerno GL. 2007. Carbon cycling in643 Anabaena sp. PCC 7120. Sucrose synthesis in the heterocysts and possible role in644 nitrogen fixation. Plant Physiol 143:1385-1397.645 7. Curatti L, Giarrocco L, Salerno GL. 2006. Sucrose synthase and RuBisCo646 expression is similarly regulated by the nitrogen source in the nitrogen-fixing647 cyanobacterium Anabaena sp. Planta 223:891-900.648 8. Kolman MA, Torres LL, Martin ML, Salerno GL. 2012. Sucrose synthase in649 unicellular cyanobacteria and its relationship with salt and hypoxic stress. Planta650 235:955-964.651
- 31. 31 9. Yamanaka T. 2008. Chemolithoautotrophic Bacteria: Biochemistry and652 Environmental Biology. Springer, Japan.653 10. Teske A, Alm E, Regan JM, Toze S, Rittmann BE, Stahl DA. 1994.654 Evolutionary relationships among ammonia- and nitrite-oxidizing bacteria. J655 Bacteriol 176:6623-6630.656 11. Vannelli T, Logan M, Arciero DM, Hooper AB. 1990. Degradation of657 halogenated aliphatic compounds by the ammonia- oxidizing bacterium658 Nitrosomonas europaea. Appl Environ Microbiol 56:1169-1171.659 12. Chain P, Kurtz S, Ohlebusch E, Slezak T. 2003. An applications-focused660 review of comparative genomics tools: capabilities, limitations and future661 challenges. Brief Bioinform 4:105-123.662 13. Hooper AB. 1969. Biochemical basis of obligate autotrophy in Nitrosomonas663 europaea. J Bacteriol 97:776-779.664 14. Baroja-Fernandez E, Munoz FJ, Saikusa T, Rodriguez-Lopez M, Akazawa665 T, Pozueta-Romero J. 2003. Sucrose synthase catalyzes the de novo production666 of ADPglucose linked to starch biosynthesis in heterotrophic tissues of plants.667 Plant Cell Physiol 44:500-509.668 15. Delmer DP. 1972. The purification and properties of sucrose synthetase from669 etiolated Phaseolus aureus seedlings. J Biol Chem 247:3822-3828.670 16. Figueroa CM, Asencion Diez MD, Kuhn ML, McEwen S, Salerno GL,671 Iglesias AA, Ballicora MA. 2013. The unique nucleotide specificity of the672 sucrose synthase from Thermosynechococcus elongatus. FEBS Lett 587:165-169.673
- 32. 32 17. Grimes WJ, Jones BL, Albersheim P. 1970. Sucrose synthetase from Phaseolus674 aureus seedlings. J Biol Chem 245:188-197.675 18. Morell M, Copeland L. 1985. Sucrose synthase of soybean nodules. Plant676 Physiol 78:149-154.677 19. Porchia AC, Curatti L, Salerno GL. 1999. Sucrose metabolism in678 cyanobacteria: sucrose synthase from Anabaena sp. strain PCC 7119 is679 remarkably different from the plant enzymes with respect to substrate affinity and680 amino-terminal sequence. Planta 210:34-40.681 20. Ross HA, Davies HV. 1992. Purification and Characterization of Sucrose682 Synthase from the Cotyledons of Vicia faba L. Plant Physiol 100:1008-1013.683 21. Tanase K, Yamaki S. 2000. Purification and characterization of two sucrose684 synthase isoforms from Japanese pear fruit. Plant Cell Physiol 41:408-414.685 22. Curatti L, Giarrocco LE, Cumino AC, Salerno GL. 2008. Sucrose synthase is686 involved in the conversion of sucrose to polysaccharides in filamentous nitrogen-687 fixing cyanobacteria. Planta 228:617-625.688 23. Zheng Y, Anderson S, Zhang Y, Garavito RM. 2011. The structure of sucrose689 synthase-1 from Arabidopsis thaliana and its functional implications. J Biol690 Chem 286:36108-36118.691 24. Lairson LL, Henrissat B, Davies GJ, Withers SG. 2008. Glycosyltransferases:692 structures, functions, and mechanisms. Annu Rev Biochem 77:521-555.693 25. Sheng F, Jia X, Yep A, Preiss J, Geiger JH. 2009. The crystal structures of the694 open and catalytically competent closed conformation of Escherichia coli695 glycogen synthase. J Biol Chem 284:17796-17807.696
- 33. 33 26. Hardin SC, Winter H, Huber SC. 2004. Phosphorylation of the amino terminus697 of maize sucrose synthase in relation to membrane association and enzyme698 activity. Plant Physiol 134:1427-1438.699 27. Klotz KL, Finger FL, Shelver WL. 2003. Characterization of two sucrose700 synthase isoforms in sugarbeet root. Plant Physiol Biochem 41:107-115.701 28. Schäfer WE, Rohwer JM, Botha FC. 2004. A kinetic study of sugarcane702 sucrose synthase. Eur J Biochem 271:3971-3977.703 29. Wolosiuk RA, Pontis HG. 1974. Studies on sucrose synthetase. Kinetic704 mechanism. Arch Biochem Biophys 165:140-145.705 30. Kuhn ML, Falaschetti CA, Ballicora MA. 2009. Ostreococcus tauri ADP-706 glucose pyrophosphorylase reveals alternative paths for the evolution of subunit707 roles. J Biol Chem 284:34092-34102.708 31. Sambrook J, Russell DW. 2001. Molecular Cloning: A laboratory Manual, 3rd709 ed, vol. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.710 32. Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the711 head of bacteriophage T4. Nature 227:680-685.712 33. Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and713 analysis program for Windows 95/98/NT. Nucl Acids Symp Ser 41:95-98.714 34. Gouy M, Guindon S, Gascuel O. 2010. SeaView version 4: A multiplatform715 graphical user interface for sequence alignment and phylogenetic tree building.716 Mol Biol Evol 27:221-224.717 35. Winn MD, Ballard CC, Cowtan KD, Dodson EJ, Emsley P, Evans PR,718 Keegan RM, Krissinel EB, Leslie AG, McCoy A, McNicholas SJ, Murshudov719
- 34. 34 GN, Pannu NS, Potterton EA, Powell HR, Read RJ, Vagin A, Wilson KS.720 2011. Overview of the CCP4 suite and current developments. Acta Crystallogr D721 Biol Crystallogr 67:235-242.722 36. Diederichs K, Karplus PA. 2013. Better models by discarding data? Acta723 Crystallogr D Biol Crystallogr 69:1215-1222.724 37. McCoy AJ, Grosse-Kunstleve RW, Adams PD, Winn MD, Storoni LC, Read725 RJ. 2007. Phaser crystallographic software. J Appl Crystallogr 40:658-674.726 38. Emsley P, Cowtan K. 2004. Coot: model-building tools for molecular graphics.727 Acta Crystallogr D Biol Crystallogr 60:2126-2132.728 39. Murshudov GN, Vagin AA, Dodson EJ. 1997. Refinement of macromolecular729 structures by the maximum-likelihood method. Acta Crystallogr D Biol730 Crystallogr 53:240-255.731 40. Adams PD, Afonine PV, Bunkoczi G, Chen VB, Davis IW, Echols N, Headd732 JJ, Hung LW, Kapral GJ, Grosse-Kunstleve RW, McCoy AJ, Moriarty NW,733 Oeffner R, Read RJ, Richardson DC, Richardson JS, Terwilliger TC, Zwart734 PH. 2010. PHENIX: a comprehensive Python-based system for macromolecular735 structure solution. Acta Crystallogr D Biol Crystallogr 66:213-221.736 41. Sali A, Blundell TL. 1993. Comparative protein modelling by satisfaction of737 spatial restraints. J Mol Biol 234:779-815.738 42. Luthy R, Bowie JU, Eisenberg D. 1992. Assessment of protein models with739 three-dimensional profiles. Nature 356:83-85.740
- 35. 35 43. Richards FM, Kundrot CE. 1988. Identification of structural motifs from741 protein coordinate data: secondary structure and first-level supersecondary742 structure. Proteins 3:71-84.743 44. Gibson RP, Tarling CA, Roberts S, Withers SG, Davies GJ. 2004. The donor744 subsite of trehalose-6-phosphate synthase: binary complexes with UDP-glucose745 and UDP-2-deoxy-2-fluoro-glucose at 2 A resolution. J Biol Chem 279:1950-746 1955.747 45. Duncan KA, Huber SC. 2007. Sucrose synthase oligomerization and F-actin748 association are regulated by sucrose concentration and phosphorylation. Plant Cell749 Physiol 48:1612-1623.750 46. Guerrero-Barrera AL, Garcia-Cuellar CM, Villalba JD, Segura-Nieto M,751 Gomez-Lojero C, Reyes ME, Hernandez JM, Garcia RM, de la Garza M.752 1996. Actin-related proteins in Anabaena spp. and Escherichia coli. Microbiology753 142 ( Pt 5):1133-1140.754 47. Buschiazzo A, Ugalde JE, Guerin ME, Shepard W, Ugalde RA, Alzari PM.755 2004. Crystal structure of glycogen synthase: homologous enzymes catalyze756 glycogen synthesis and degradation. EMBO J 23:3196-3205.757 48. Yep A, Ballicora MA, Preiss J. 2006. The ADP-glucose binding site of the758 Escherichia coli glycogen synthase. Arch Biochem Biophys 453:188-196.759 49. Gibson RP, Turkenburg JP, Charnock SJ, Lloyd R, Davies GJ. 2002. Insights760 into trehalose synthesis provided by the structure of the retaining761 glucosyltransferase OtsA. Chem Biol 9:1337-1346.762
- 36. 36 50. Schinzel R, Drueckes P. 1991. The phosphate recognition site of Escherichia763 coli maltodextrin phosphorylase. FEBS Lett 286:125-128.764 51. Schinzel R, Palm D. 1990. Escherichia coli maltodextrin phosphorylase:765 contribution of active site residues glutamate-637 and tyrosine-538 to the766 phosphorolytic cleavage of alpha-glucans. Biochemistry 29:9956-9962.767 52. Yep A, Ballicora MA, Preiss J. 2004. The active site of the Escherichia coli768 glycogen synthase is similar to the active site of retaining GT-B769 glycosyltransferases. Biochem Biophys Res Commun 316:960-966.770 53. Lee SS, Hong SY, Errey JC, Izumi A, Davies GJ, Davis BG. 2011.771 Mechanistic evidence for a front-side, SNi-type reaction in a retaining772 glycosyltransferase. Nat Chem Biol 7:631-638.773 54. Gomez H, Lluch JM, Masgrau L. 2013. Substrate-assisted and nucleophilically774 assisted catalysis in bovine alpha1,3-galactosyltransferase. Mechanistic775 implications for retaining glycosyltransferases. J Am Chem Soc 135:7053-7063.776 55. Mitchell EP, Withers SG, Ermert P, Vasella AT, Garman EF, Oikonomakos777 NG, Johnson LN. 1996. Ternary complex crystal structures of glycogen778 phosphorylase with the transition state analogue nojirimycin tetrazole and779 phosphate in the T and R states. Biochemistry 35:7341-7355.780 56. Diaz A, Diaz-Lobo M, Grados E, Guinovart JJ, Fita I, Ferrer JC. 2012. Lyase781 activity of glycogen synthase: Is an elimination/addition mechanism a possible782 reaction pathway for retaining glycosyltransferases? IUBMB Life 64:649-658.783 57. Koshland DE. 1958. Application of a Theory of Enzyme Specificity to Protein784 Synthesis. Proc Natl Acad Sci U S A 44:98-104.785
- 37. 37 58. Johnson KA. 2008. Role of induced fit in enzyme specificity: a molecular786 forward/reverse switch. J Biol Chem 283:26297-26301.787 59. Fersht A. 1999. Structure and mechanism in protein science : a guide to enzyme788 catalysis and protein folding. W.H. Freeman, New York.789 60. Gomez H, Polyak I, Thiel W, Lluch JM, Masgrau L. 2012. Retaining790 glycosyltransferase mechanism studied by QM/MM methods: lipopolysaccharyl-791 alpha-1,4-galactosyltransferase C transfers alpha-galactose via an oxocarbenium792 ion-like transition state. J Am Chem Soc 134:4743-4752.793 61. Chua TK, Bujnicki JM, Tan TC, Huynh F, Patel BK, Sivaraman J. 2008. The794 structure of sucrose phosphate synthase from Halothermothrix orenii reveals its795 mechanism of action and binding mode. Plant Cell 20:1059-1072.796 62. Zheng L, Zhou X, Zhang H, Ji X, Li L, Huang L, Bai L, Zhang H. 2012.797 Structural and functional analysis of validoxylamine A 7'-phosphate synthase798 ValL involved in validamycin A biosynthesis. PLoS One 7:e32033.799 63. Cavalier MC, Yim YS, Asamizu S, Neau D, Almabruk KH, Mahmud T, Lee800 YH. 2012. Mechanistic insights into validoxylamine A 7'-phosphate synthesis by801 VldE using the structure of the entire product complex. PLoS One 7:e44934.802 64. Kolman MA, Nishi CN, Perez-Cenci M, Salerno GL. 2015. Sucrose in803 cyanobacteria: from a salt-response molecule to play a key role in nitrogen804 fixation. Life (Basel) 5:102-126.805 806 807
- 38. 38 FIGURE LEGENDS808 FIGURE 1. The crystal structure of the sucrose synthase from N. europaea. A.809 Tetrameric structure of the enzyme. B. Monomeric structure and its different domains:810 SSN-1, SSN-2, GT-B(A), and GT-B(D), and a linker between SSN-1 and SSN-2.811 812 FIGURE 2. Phylogenetic tree of sucrose synthases. Group I contains sequences from813 cyanobacteria and is divided in two major branches, susA (cyan) and susB (orange)814 proteins; groups II and III (pink) contain sequences from proteobacteria; group IV815 contains the sequences from the moss P. patens (violet); and groups V, VI, and VII,816 which contain the sequences from vascular plants are further divided in two branches,817 dicots (green) and monocots (blue). Numbers for major branches are the bootstrap values818 obtained during tree reconstruction, as described in the “Materials and Methods” section.819 Neu, N. europaea; Ath, A. thaliana sucrose synthase 1; Nos, Nostoc sp. PCC 7120 susA;820 Tel, T. elongatus.821 822 FIGURE 3. Comparison of the open and closed monomeric forms. The open form823 structure is represented by the N. europaea sucrose synthase structure reported in this824 paper; the closed form is represented by the A. thaliana enzyme (PDB ID 3S29). The825 SNN-1, SNN-2 and GT-B(A) domains are shown in blue for the open form structure and826 in cyan for the closed form structure. The GT-B(D) domain is shown in magenta for the827 open form and in green for the closed form. The “hinge-latch” features of the domain828 movement are shown in blown-up views.829 830
- 39. 39 FIGURE 4. Difference distance matrix map of the GT-B(A) domain. Distances were831 calculated between all pair of Cα carbon of the open structure (N. europaea sucrose832 synthase). A second pairwise distance matrix was calculated for the closed structure833 (homology model as described in “Materials and Methods”). Afterwards, these two834 matrices were subtracted, and the Δdistance was color coded. The negative and zero835 values are represented in white. Red colors (higher Δdistance values) are pairs of Cα836 carbon that are getting closer upon closing of the enzyme. Only residues from 260 to 510837 are shown, which correspond to the GT-B(A) domain.838 839 FIGURE 5. Overlap comparison of the fructose binding sites of the open (N.840 europaea) and closed (A. thaliana, PDB ID 3S29) sucrose synthase structures. The841 carbon atoms in the closed form structure are in pale yellow. The carbon atoms in the842 open form structure are in cyan (GT-B(A) domain) and pink (GT-B(D) domain).843 Conserved residues between two structures are labeled with respective residue numbers;844 the residue numbers of the open form structure are in parenthesis. The hydrogen bonds in845 the GT-B(D) domain are shown in black. The hydrogen bonds in between GT-B(A) and846 GT-B(D) domains and the ones in GT-B(A) domains are shown in green.847 848 FIGURE 6. Overlap comparison of the nucleotide binding sites of the open (N.849 europaea) and closed (A. thaliana, PDB ID 3S29) sucrose synthase structures. The850 carbon atoms in the closed form structure are in pale yellow. The carbon atoms in the851 open form structure are in cyan (GT-B(A) domain) and pink (GT-B(D) domain).852 Conserved residues between two structures are labeled with respective residue numbers;853
- 40. 40 the residue numbers of the open form structure are in parenthesis. The asterisks indicate854 the non-conserved binding residues with the closed form residues labeled in front of the855 ones in the open form structure.856 857 FIGURE 7. Modeling of the ADP-Glc binding site. Panel A shows the GT-B(D)858 domain of the N. europaea sucrose synthase, in which ADP has been modeled with859 Modeller. For that purpose, the closed structure of glycogen synthase with ADP bound860 (PDB code: 2QZS) was manually aligned to the closed structures of A. thaliana, (PDB861 code: 3S27 and 3S28) and the structure from N. europaea (this paper). All those862 alignments were used as templates. Loops that did not structurally align well were not863 used for the modelling and the backbone structure was inherited from the A. thaliana864 structures. The rest of the modelling and validation proceeded as described in “Materials865 and Methods”. Panel B shows the GT-B(D) domain from A. thaliana (PDB code: 3S27)866 and the UDP bound.867 868 FIGURE 8. Hinge analysis by comparison of the open v. close conformations. The869 blue and red show the “hinge score” using 51 and 9 windows, respectively. The magmata870 dots (also point with black arrows) shows the two distinct hinges: G514 and W743. The871 purple arrows points at the region displaying the secondary structure rearrangements.872 873 FIGURE 9. Hydrophobic residues contribute to the latch action. Panel A depicts the874 open (N. europaea sucrose synthase crystal structure) and B a homology model of a875 closed structure, which was built as described in the “Materials and Methods” section.876
- 41. 41 Upon closing, the hydrophobic residues: M635, L637 in the GT-B (D) domain and N280,877 V281, L282 and L284 in GT-B(A) domain generate a hydrophobic environment that878 stabilize the close action.879 880 FIGURE 10. Three highly conserved catalytic residues in different members of the881 retaining GT-B glycosyltransferase family. The structures analysed in this figure are882 maltodextrin phosphorylase (PDB ID 1E4O), trehalose-6-phosphate synthase (PDB ID883 1GZ5), and glycogen synthase (PDB ID 2ZQS) from E. coli, sucrose synthase from A.884 thaliana (PDB ID 3S29), and N. europaea (this work).885 886 887
- 42. 42 TABLE 1. Kinetic parameters of substrates of the N. europaea sucrose synthase in888 the synthesis direction. Assays were performed using the conditions described in the889 “Materials and Methods” section. Analogous values to catalytic efficiency (kcat/S0.5) were890 calculated using the predicted molecular mass of 93 kDa.891 892 Substrate S0.5 (mM) Vmax (U mg-1 ) nH kcat/S0.5 (mM-1 s-1 ) UDP-Glc 0.89 ± 0.05 4.3 ± 0.1 1.1 7.5 ADP-Glc 0.044 ± 0.006 3.7 ± 0.1 1.3 130.3 Fru(UDP-Glc) 120 ± 10 2.8 ± 0.2 1.3 0.036 Fru(ADP-Glc) 5.6 ± 0.4 4.8 ± 0.2 1.6 1.33 893 894
- 43. 43 TABLE 2. Data collection and refinement statistics.895 Data Processing Space group P65 Cell dimensions a; b; c (Å) 236.90; 236.90; 231.44 α; β; γ (°) 90.00; 90.00; 120.00 Resolution (Å) 3.05 Mosaicity (°) 0.47 a Rmerge 0.169 (0.963) CC1/2 0.993(0.561)0.993(0.561) 0.993(0.561) I/sigma 9.6 (2.1) Completeness 97.9 (98.6) Multiplicity 6.3 (6.3) Refinement Resolution (Å) 3.05 No. reflections 794715 No. unique reflections 126170 b Rwork/c Rfree 17.37/21.75 d RMSD Bond length (Å) 0.009 RMSD Bond angle (°) 1.439 896 The values for the highest resolution bin are in parentheses.897 a Linear Rmerge = Σ|Iobs-Iavg|/ ΣIavg898 b R = Σ|Fobs-Fcalc|/ ΣFobs.899 c Five percent of the reflection data were selected at random as a test set and only these900 data were used to calculate Rfree.901 d RMSD, root mean square deviation.902
- 44. 44 TABLE 3. Activity of wild type and mutants of the N. europaea sucrose synthase.903 Assays were performed using the conditions described in the “Materials and Methods”904 section.905 Substrate Vmax (U mg-1 ) WT R567A K572A E663A UDP-Glc 4.3 ± 0.1 < 0.0017 < 0.0019 < 0.01 ADP-Glc 3.7 ± 0.1 < 0.0014 < 0.0016 0.020 ± 0.02 906 907 908 909