The GAS6-AXL signaling network is a mesenchymal (Mes) molecular subtype–specific therapeutic target for ovarian cancer

C A N C E R 2016 © The Authors,
some rights reserved;
exclusive licensee
American Association
for the Advancement
of Science.
10.1126/scisignal.aaf8175
The GAS6-AXL signaling network is a mesenchymal
(Mes) molecular subtype–specific therapeutic target
for ovarian cancer
Jane Antony,1,2,3
Tuan Zea Tan,1
Zoe Kelly,3
Jeffrey Low,4
Mahesh Choolani,4
Chiara Recchi,3
Hani Gabra,3
Jean Paul Thiery,1,5,6
Ruby Yun-Ju Huang1,4,7
*
Ovarian cancer is a complex disease with heterogeneity among the gene expression molecular subtypes (GEMS)
between patients. Patients with tumors of a mesenchymal (“Mes”) subtype have a poorer prognosis than patients
with tumors of an epithelial (“Epi”) subtype. We evaluated GEMS of ovarian cancer patients for molecular
signaling profiles and assessed how the differences in these profiles could be leveraged to improve patient clin-
ical outcome. Kinome enrichment analysis identified AXL as a particularly abundant kinase in Mes-subtype tumor
tissue and cell lines. In Mes cells, upon activation by its ligand GAS6, AXL coclustered with and transactivated the
receptor tyrosine kinases (RTKs) cMET, EGFR, and HER2, producing sustained extracellular signal–regulated kinase
(ERK) activation. In Epi-A cells, AXL was less abundant and induced a transient activation of ERK without evidence
of RTK transactivation. AXL-RTK cross-talk also stimulated sustained activation of the transcription factor FRA1,
which correlated with the induction of the epithelial-mesenchymal transition (EMT)–associated transcription
factor SLUG and stimulation of motility exclusively in Mes-subtype cells. The AXL inhibitor R428 attenuated
RTK and ERK activation and reduced cell motility in Mes cells in culture and reduced tumor growth in a chick
chorioallantoic membrane model. A higher concentration of R428 was needed to inhibit ERK activation and cell
motility in Epi-A cells. Silencing AXL in Mes-subtype cells reversed the mesenchymal phenotype in culture and
abolished tumor formation in an orthotopic xenograft mouse model. Thus, AXL-targeted therapy may improve
clinical outcome for patients with Mes-subtype ovarian cancer.
INTRODUCTION
Epithelial ovarian cancer is a lethal malignancy with nonspecific symp-
toms in early stages that enable silent progression of the disease. Most
cases are diagnosed in the advanced stages, and despite treatment, prog-
nosis is poor with 5-year survival lower than 30%. Locoregional dissem-
ination of the tumor and metastases contribute to immense disease
burden. Furthermore, epithelial ovarian cancer is hallmarked by a high
degree of genetic and epigenetic aberrations, resulting in a diverse
repertoire of modified cellular networks that can be delineated into dis-
tinct molecular subtypes based on gene expression profiling (1, 2).
These gene expression molecular subtypes (GEMS) are robust and re-
producible as reported in the Australian Ovarian Cancer Study (1), The
Cancer Genome Atlas (TCGA) (2), and by a large-scale meta-analysis
study (3). At least five distinct GEMS of epithelial ovarian cancer have
been identified: epithelial-A (Epi-A), epithelial-B (Epi-B), mesenchymal
(Mes), Stem-A, and Stem-B (3). Elucidation of key signaling networks
has further identified distinct players that promote tumorigenesis in
each subtype.
The Stem-A subtype, which corresponds to the C5 subtype from
the Tothill data set and the proliferative subtype from the TCGA data
set, is driven by MYCN amplification (4) and FZD7 overexpression
(5), is enriched in microtubule-related gene sets, and is dependent
on microtubule-associated genes for growth (3). The Mes subtype,
which corresponds to the C1 subtype from the Tothill data set and
the mesenchymal subtype from the TCGA data set, shows high cor-
relation with transforming growth factor–b (TGF-b) pathway in gene
set enrichment analysis (GSEA) with poor survival outcomes (1–3).
The TGF-b pathway promotes epithelial-mesenchymal transition
(EMT) (6). Mes-subtype tumors display extensive desmoplastic stromal
reactions (1) that are associated with EMT and a microRNA network
suppressing the expression of genes encoding E-cadherin (CDH1), vi-
mentin (VIM), SLUG (SNAI2), and the epithelial transcriptional gate-
keeper GRHL2 (7).
The RTK AXL belongs to the Tyro3-Axl-Mer (TAM) family of
RTKs (8) along with MER and Tyro-3 and is activated by its ligand
growth arrest–specific 6 (GAS6) (9). Its expression has been shown to
be of prognostic value in breast (10) and lung (11) cancers. AXL has also
been suggested as a therapeutic target for breast (12) and pancreatic
cancer (13), and cancers demonstrating resistance to epidermal growth
factor receptor (EGFR) and phosphatidylinositol 3-kinase (PI3K) inhi-
bition (14–16). In epithelial ovarian cancer, AXL is highly expressed in
advanced-stage diseases, predominantly in peritoneal deposits and
metastases (17). Silencing AXL or blocking the GAS6-AXL pathway
prevents regional dissemination of ovarian cancer cells in vivo (18).
However, the role of AXL in the heterogeneous molecular backgrounds
of epithelial ovarian cancer and the potential functional and therapeutic
implication are yet to be defined.
The concept of GEMS-specific therapeutics has been well devel-
oped in breast cancer (19). However, data supporting the GEMS-
specific management in epithelial ovarian cancer are newly emerging.
The GEMS-specific pathways in epithelial ovarian cancer further point
to the direction for developing new therapeutic strategies. The Stem-A
subtype exhibits preferential sensitivity to microtubule destabilizers,
such as vinorelbine (3). Inhibiting the TGF-b pathway might be a
1
Cancer Science Institute of Singapore, National University of Singapore, Singapore
117599, Singapore. 2
NUS Graduate School for Integrative Sciences and Engineering,
National University of Singapore, Singapore 117456, Singapore. 3
Department of Sur-
gery and Cancer, Imperial College London, London W120NN, U.K. 4
Department of Ob-
stetrics and Gynecology, National University Health System, Singapore 119228,
Singapore. 5
Department of Biochemistry, Yong Loo Lin School of Medicine, National
University of Singapore, Singapore 117596, Singapore. 6
Institute of Molecular and Cell
Biology, A*STAR (Agency for Science, Technology and Research), Singapore 138673,
Singapore. 7
Department of Anatomy, Yong Loo Lin School of Medicine, National Uni-
versity of Singapore, Singapore 117597, Singapore.
*Corresponding author. Email: ruby_yj_huang@nuhs.edu.sg
S C I E N C E S I G N A L I N G | R E S E A R C H A R T I C L E
Antony et al., Sci. Signal. 9, ra97 (2016) 4 October 2016 1 of 15
onOctober5,2016http://stke.sciencemag.org/Downloadedfrom

potential option for patients with the Mes subtype (20). The feasibility
to stratify epithelial ovarian cancer patients on the basis of GEMS
using a laboratory-based assay on formalin-fixed, paraffin-embedded
(FFPE) diagnostic blocks has been demonstrated recently (21). There-
fore, there is an eminent need in the field to quest for GEMS-specific
therapeutic targets for epithelial ovarian cancer patients to achieve
personalized precision management.
Here, we investigated the molecular differences in kinase signaling
patterns among the various ovarian cancer GEMS and whether these
profiles are predictive of therapeutic efficacy. Our data suggest that, in
contrast to the Epi-A subtype, the Mes subtype is hallmarked by a re-
ceptor tyrosine kinase (RTK) cross-talk network sustained by the
GAS6-AXL signaling node. The findings show how particularly the
Mes and Epi-A subtypes differ, in molecular and cell behavior pheno-
types as well as in drug response, thereby supporting the future devel-
opment of GEMS-stratified clinical trials for epithelial ovarian cancer
patients.
RESULTS
Interrogation of kinome profiles identifies AXL as highly
expressed in Mes ovarian tumors and cell lines
Upon interrogating the kinome gene expression patterns in a pub-
lished data set of ovarian cancer tumors and cell lines (3), we found
that AXL was among the most highly expressed kinases in the Mes
subtype (fig. S1, A and B). Tumors and cell lines of the Mes subtype
in this data set (3) had significantly greater AXL gene expression than
did the other subtypes (Fig. 1, A and B). Survival analysis showed that
AXL overexpression correlated with poor prognosis in ovarian cancer
patients (Fig. 1C) in both univariate and multivariate analyses (table
S1). AXL was a prognostic factor for poor overall survival independent
of known prognostic factors: patient age, tumor stage, tumor grade,
and metastasis status. After stratification by the five GEMS, multi-
variate Cox’s regression showed that AXL was still an independent
prognostic factor for poor overall survival (table S2). The prognostic
relevance of AXL has been validated in an independent cohort (fig. S1,
C and D).
Mes, but not Stem-A, was largely positive for AXL when exam-
ining the total AXL protein expression in the SGOCL panel of ovar-
ian cancer cell lines (22) matched with the GEMS (Fig. 1D) (3). Cells
of the Epi-A and Epi-B subtypes collectively were moderately posi-
tive for AXL protein expression (Fig. 1D and fig. S1E). Because AXL
has been associated with EMT, we further examined, within each
GEMS, whether AXL expression would correlate with different phe-
notypes along the previously described EMT spectrum: epithelial (E),
intermediate epithelial (IE), intermediate mesenchymal (IM), and
mesenchymal (M) (22). Whereas the GEMS are principally deli-
neated on the basis of molecular profiles, the EMT phenotypes are
segregated on the basis of immunostaining and visualization of clas-
sic EMT markers such as E-cadherin, vimentin, and cytokeratins.
From a phenotypic standpoint, cell lines of the IM phenotype, which
has previously been shown to be an aggressive, anoikis-resistant state
(22), were all positive for AXL abundance (Fig. 1D and fig. S1F) and
also had the highest AXL abundance among the classifications (Fig.
1D and fig. S1G). AXL protein abundance was high in both Epi-A
and Mes subtypes, whereas it was low in both Stem-A and Stem-B
subtypes (Fig. 1D). These data suggest that although AXL is highly
expressed in cells of the Mes and the IM phenotypes, it is also
expressed abundantly in cells of the Epi-A and the IE phenotypes.
GEMS-specific AXL activation has divergent consequences in
downstream ERK activation, cell proliferation, and motility
We next asked whether AXL played different roles in Mes and Epi-A.
Cells representing the different ovarian cancer GEMS (fig. S2A) were
stimulated with GAS6 over time to study the kinetics of downstream
signaling by Western blotting for phosphorylated extracellular signal–
regulated kinase (pERK) and pAKT responses. Upon GAS6-AXL acti-
vation, Mes showed two inductions of ERK phosphorylation at early
(10, 20, and 30 min) and late (6 and 12 hours) time points (Fig. 1E
and fig. S2C). The other subtypes, such as Epi-A and Stem-A, showed
single induction of ERK activation only at the early time points (10, 20,
and 30 min) (Fig. 1E and fig. S2C). Additional time course experiments
showed that the pERK response in Epi-A subtype PEO1 cells is truly
transient with no recurrence, whereas Mes-subtype SKOV3 cells
showed multiple waves of ERK activation (fig. S2D). Within each
GEMS, the EMT phenotypic classification further dictated the pattern
of AKT activation (Fig. 1E and fig. S2, B and C). In GEMS with single
inductions of pERK, such as Epi-A, Epi-B, and Stem-A subtype cells,
AKT activation was induced once in cells of the epithelial or
intermediate epithelial phenotype. However, in those of a mesenchymal
or intermediate mesenchymal phenotype, AKT activation occurred in
dual peaks (Fig. 1E and fig. S2, B and C). For Mes, AKT activation per-
sisted from the early to the late time points regardless of the EMT phe-
notype (Fig. 1E and fig. S2, B and C). Densitometric quantitation further
validated high abundance of pERK at both early and late time points in
Mes, whereas Epi-A, Epi-B, and Stem-A showed pERK only at initial
stages (Fig. 1F). Because changes in the temporal duration of ERK
signaling elicit diverse biological outcomes (23, 24), the recurrence of
the pERK signal upon GAS6-AXL activation suggests that the temporal
duration of the signal is sustained in Mes and that this might affect rel-
evant downstream biological functions.
AXL signaling promotes cancer cell survival (13, 25). A moderate in-
crement in cell proliferation was observed upon GAS6 stimulation in all
ovarian cancer GEMS without specific differences (fig. S2E). AXL
signaling also enhances cancer cell invasion and metastasis (13, 26).
We utilized single-cell tracking to monitor cell motility by measuring
several kinetic parameters such as displacement, velocity, speed, and di-
rectional persistence. Upon GAS6-AXL stimulation, Mes cells showed
significant increase in all four kinetic parameters (fig. S2F). Upon GAS6
stimulation, Mes cell lines showed a significant enhancement in
displacement (Fig. 1G and fig. S2G) and in gap closure migration assays
(Fig. 1H and fig. S2H), whereas the other GEMS did not.
Together, GAS6-AXL activation has divergent control in
downstream signaling and functions that are GEMS-specific in ovar-
ian cancer. In Mes, it results in a recurrent sustained ERK response,
which causes an increase in both proliferation and cell motility. How-
ever, in Epi-A, GAS6-AXL activation stimulates a single and transient
ERK response that only results in an increase in proliferation.
GEMS-specific AXL activation reveals an extensive RTK
cross-talk network in Mes
To understand the signaling circuitry that is connected to the recur-
rent ERK activation response specific to Mes-subtype cells, a reverse-
phase protein array (RPPA) experiment was carried out using a Mes
cell line (SKOV3) and an Epi-A cell line (PEO1) treated with GAS6 at
30 min and at 12 hours to evaluate the early and late responses, re-
spectively. SKOV3 cells displayed increased abundance of pEGFR,
pHER2, and pMET at both 30 min and 12 hours after GAS6 stimu-
lation compared to the 0-min control (Fig. 2A). This pattern was

parallel to the higher and sustained pAXL signals observed previously
by Western blotting (Fig. 1E and fig. S2C). This suggested that there
were cross-talks between AXL and other RTKs in Mes. However, this
RTK cross-talk phenomenon was completely deficient in the Epi-A
PEO1 system, where no significant transactivation of EGFR, HER2,
or cMET was detected after GAS6 treatment (Fig. 2A). The RPPA
results were validated by Western blotting and extended to the cell lines
OVCA429 (Epi-A) and HEYA8 (Mes) (Fig. 2B). An in situ proximity
ligation assay, Duolink, was carried out to explore whether the cross-
talks between AXL and these RTKs were mediated via protein-protein
**
PEO1
OVCA429
CAOV3
JHOS3
OV56
SKOV3
HEYA8
CH1
JHOS4
A2780
0
50
100
Gapclosure(%)
Control
GAS6
(400 ng ml-1)
*
Epi-A Epi-B Stem-AMes
H
AXLgeneexpression
A
Tumor
4
5
6
7
8
9
p
Mann-Whitney test: Mes vs. Rest
P = 2.4827 × 10−47
Stem-BEpi-A Epi-B Stem-AMes
4
5
6
7
8
9
Mann-Whitney test: Mes vs. Rest
P = 1.26 × 10−8
Cellline
B
AXLgeneexpression
Stem-BEpi-A Epi-B Stem-AMes
HR = 2.2023 P < 0.0001
AXL-low
(<median = 6.46)
AXL-high
(>median = 6.46)
Overallsurvival%
100
0
0 250Month
Ovarian cancer (n = 978)C
IE
Epi-A Epi-B Mes
Stem-A Stem-B
E IE IEE IE IM M
E IE IM M E
AXL
140−120 kDa
-Actin
40 kDa
AXL
140−120 kDa
-Actin
40 kDa
D
24h
pERK1/2
44−42 kDa
PEO1 E Epi-A HEYA8 M Mes
0’
GAS6
400 ng ml-1 10’ 20’ 30’ 1h 3h 6h 12h 24h 0’ 10’ 20’ 30’ 1h 3h 6h 12h
pAXL
140 kDa
pAKT
60 kDa
GAPDH
37 kDa
E 12h1h 3h
Lowest
pERK signal
GAS6
400 ng ml-1F
Highest
pERK signal
PEO1
CAOV3
JHOS3
OV56
SKOV3
HEYA8
JHOS4
CH1
A2780
OVCA429
0’ 10’ 20’ 30’ 6h
Epi-A
Epi-B
Mes
E
IE
E
IE
IE
IM
M
IE
IM
M
Stem-A
PEO1
OVCA429
CAOV3
JHOS3
OV56
SKOV3
HEYA8
CH1
JHOS4
A2780
0
50
100
150
200
Normalizeddisplacement
Control
GAS6
(400 ng.ml-1)
* ** **
Epi-A Epi-B Stem-AMes
G
24h
Fig. 1. The Mes subtype of ovarian cancer is enriched in AXL expression and shows recurrent ERK response and increased motility upon AXL activation. (A) AXL gene
expression in 1538 ovarian tumor samples and 142 ovarian cell lines from a data set (3) classified into five distinct biological subtypes: Epi-A, Epi-B, Mes, Stem-A, and Stem-B. P =
2.4827 × 10−47
by Mann-Whitney test, Mes versus non-Mes. (B) As in (A) in subtype-associated cell lines (P = 1.28 × 10−8
by Mann-Whitney test, Mes versus rest). (C) Correlation of
AXL expression with prognosis in ovarian cancer patients. Above median expression resulting in a hazard ratio (HR) of 2.2023. P < 0.0001 by log-rank test. (D) AXL protein
abundance in a panel of ovarian cancer cell lines (SGOCL) assigned to the five subtypes. P = 0.0138, Mes versus non-Mes; P = 0.0124, Stem-A versus non-Stem-A; P = 0.0871,
Epi-Aversus non-Epi-A;P = 0.892, Epi-B versus non-Epi-B; P = 0.1684, Epi versus non-Epi; by Mann-Whitney tests. (E) Western blotting for pAXL, pAKT, and pERK in PEO1 (Epi-A) and
HEYA8 (Mes) upon GAS6 stimulation for the indicated time points. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was the loading control. (F) Heat map representing ERK
response upon GAS6 stimulation of AXL in the 10 cell lines. (G) Displacement changes upon GAS6 activation of AXL in epithelial ovarian cancer subtypes. (H) Gap closure rates
upon GAS6 stimulation in epithelial ovarian cancer subtypes. Data in (E) to (H) are means ± SEM from at least three experiments; *P < 0.05, **P < 0.01, and ***P < 0.001 by
Student’s t tests. Blots are representative of three experiments.

interactions. Upon GAS6 stimulation in Mes cell lines SKOV3 and
HEYA8, Duolink showed signals for interactions between AXL and
the phosphorylated forms of the RTKs Met, HER2 and EGFR (Fig. 2,
C and D). This transactivation was not seen at the resting state when
GAS6 is absent (fig. S3A). This indicated that ligand-activated AXL
might trigger the phosphorylation of other RTKs through receptor
clustering. This phenomenon of AXL-RTK clustering was not ob-
served in Epi-A lines PEO1 and OVCA429 (Fig. 2, C and D). The
difference in transactivation was not due to the expression status of
the RTKs since all chosen cell lines were positive for cMET, HER2,
and EGFR expression (fig. S3B).
Downstream of the RTK network, adapter proteins such as SHC,
SRC, and SHP2 and the mitogen-activated protein kinase (MAPK)
pathway kinases MEK1, ERK, and JNK had increased phosphorylation
PEO1
E Epi-A
OVCA429
IE Epi-A
SKOV3
IM Mes
HEYA8
M Mes
AXL-AXL
Positive
control
AXL-pMETAXL-pEGFRAXL-pHER2
30min
(+GAS6)
30min
(+GAS6)
30min
(+GAS6)
PEO1
E Epi-A
OVCA429
IE Epi-A
SKOV3
IM Mes
HEYA8
M Mes
C
0’12h
pEGFR (pY1068)
pEGFR (pY1173)
pcMET (Y1234 Y1235)
Shc (pY317)
Src (pY416)
SHP-2 (pY542)
PKC- (pS660)
MEK1 (pS217 S221)
pERK (pT202 Y204)
JNK (pT183 Y185)
Elk1 (pS383)
FRA1
p90RSK (pT573)
pHER2 (pY1248)
elF4G
SKOV3
Mes
PEO1
Epi-A
Lowest
median centred
fold change
Highest
median centred
fold change
A
GAS6 400 ng ml-1 0’ 30’ 12h30’
pEGFR 175 kDa
SLUG 30 kDa
pERK1/2 44 42 kDa
GAPDH 37 kDa
OVCA429
IE Epi-A
SKOV3
IM Mes
pHER2 185 kDa
PEO1
E Epi-A
HEYA8
M Mes
B
pMET 145 kDa
pAXL 140 kDa
pFRA1 40 kDa
12h0’ 30’ 12h0’ 30’ 12h0’ 30’ 12h0’ 30’GAS6 400 ng ml-1
AXL-pMET
AXL-pEGFR
AXL-pHER2
AXL-pMET
AXL-pEGFR
AXL-pHER2
AXL-pMET
AXL-pEGFR
AXL-pHER2
AXL-pMET
AXL-pEGFR
AXL-pHER2
0
50
100
150
200
0 min
30 min + GAS6
DUOlinksignal/cell
D
GAS624h
GRHL2
pAXL
pHER2
pEGFR
pERK
GAPDH
GAS6 0’ 10’ 20’ 30’ 1h 3h 6h 12h
OVCA429 shLuciferase control
10’ 20’ 30’ 1h 3h 6h 12h 24h0’
OVCA429 shGRHL2_12
TWIST1
pAXL
pHER2
pEGFR
pERK
GAPDH
0’ 10’ 20’ 30’ 1h 3h 6h 12h 24h
OVCA429 control
10’ 20’ 30’ 1h 3h 6h 12h 24h0’
OVCA429 TWIST1
E
Fig. 2. AXL is enmeshed in an RTK network in the Mes subtype. (A) RPPA depicting global proteomic and phosphoproteomic changes upon AXL stimulation by GAS6.
(B) Western blotting or phosphorylated RTKs and downstream signaling moieties in epithelial ovarian cancer cell lines PEO1 and OVCA429 (Epi-A) and SKOV3 and HEYA8 (Mes)
upon AXL activation. (C) Proximity ligation assay showing the extent of interactions of pMET, pHER2, and pEGFR with AXL upon activation with GAS6 in SKOV3 and HEYA8 (Mes) or
PEO1 and OVCA429 (Epi-A) cells. As a positive control, AXL-AXL interaction was assessed with two different antibodies targeting the C terminus and N terminus of AXL. Scale bars,
50 mm. (D) Quantification of Duolink signals in (C) using ImageJ. Data are means ± SEM from at least three experiments; *P < 0.05, **P < 0.01, and ***P < 0.001 by Student’s t tests.
(E) Western blotting for pAXL, pEGFR, pHER2, and pERK in GAS6-stimulated OVCA429 cells, transfected with GRHL2 short hairpin–mediated RNA (shRNA), TWIST1, or the
corresponding control. Blots and microscopy images are representative of three experiments.

upon GAS6 stimulation in SKOV3 but not in PEO1 cells (Fig. 2A).
Their activation correlated with the phosphorylation of sustained re-
sponse proteins such as ELK1, p90RSK, and FRA1 at 12 hours in
SKOV3 cells, which was absent in PEO1 cells (Fig. 2A). FRA1 induction
alongside the sustained ERK activation was confirmed by Western blot
analysis (Fig. 2B). Sustained activation of ERK stabilizes FRA1 (27), the
activity of which has been linked to the induction of EMT transcription
factors ZEB1 and SLUG and, consequently, increased motility (28).
SLUG induction in Mes was confirmed by Western blotting (Fig. 2B).
The MEK inhibitor PD0325901 (29) prevented phosphorylation of the
MEK-ERK axis in Epi-A and Mes and consequently prevented induc-
tion of FRA1 and SLUG in Mes (fig. S3C). Furthermore, MEK inhibi-
tion prevented GAS6-AXL–mediated motility induction in Mes (fig. S3,
D to G), suggesting that AXL signaling relies on the MEK-ERK cascade
to induce motility. Furthermore, the ERK inhibitor SCH772984 (30)
prevented the induction of pERK in a time course–dependent manner
(fig. S3, H and I).
Together, our data indicate that the AXL-RTK network and the
signaling cascade responsible for the increased cell motility in Mes
are deficient in other GEMS, such as Epi-A. The Mes subtype is wired
with a unique signaling cross-talk network that contributes to its
biological functions. Indeed, knocking down epithelial status main-
taining transcription factor GRHL2 (7) or overexpressing EMT
inducing TWIST1 (31) in epithelial OVCA429 promoted a mesenchy-
mal phenotype (fig. S3J) and induced AXL-RTK cross-talk and recur-
rent pERK response (Fig. 2E).
AXL kinase domain is crucial to initiate phosphorylation
of RTKs
To study the functional relevance of the AXL kinase domian, we trans-
fected AXL-null Epi-A cell line PEO4, and Mes cell line TYKnu with a
plasmid encoding either functional AXL or a kinase-deficient K567R
mutant AXL (Fig. 3A) (32). Stimulation of AXL-transfected PEO4
cells with GAS6 for 30 min induced the phosphorylation of AXL
but not EGFR, as expected of epithelial systems (Fig. 3B). Stimulation
of transfected TYKnu cells with GAS6 induces the phosphorylation of
AXL as well as EGFR. However, in AXLK567R
(kinase-deficient)–transfected
TYKnu cells, neither AXL nor EGFR was activated (Fig. 3B). Duolink
assays were carried out to corroborate these Western blot results and
investigate the interaction between AXL and EGFR. AXL-EGFR
clustering occurred in both AXL- and AXLK567R
-transfected Mes-subtype
TYKnu cells; however, no pEGFR was detected in AXLK567R
-transfected
cells (Fig. 3C). This suggests that GAS6-AXL signaling–induced
RTK cross-talk relies on the AXL kinase activity to phosphorylate
the other RTKs.
Epithelial systems are under dual regulation of
membrane rafts and cellular phosphatases to
curtail AXL signaling
To decipher the differential modulation of AXL signaling in Epi and
Mes systems, we investigated the role of membrane-organized lipid
rafts, which regulate signal transduction (33). We depleted cholesterol,
an integral component of the lipid rafts, using methyl-b-cyclodextrin
(MBCD) in Epi-A cell lines PEO1 and OVCA429 and Mes cell lines
SKOV3 and HEYA8. Cholesterol depletion, as measured by the inten-
sity of cholesterol-bound filipin staining, was observed up to 12 hours
after MBCD treatment (Fig. 4A). Subsequent to loss of membrane
architecture integrity, GAS6 stimulation resulted in AXL-RTK cross-
talk in Epi-A subtype PEO1 and OVCA429 at early (30 min) and late
pAXL
pERK
GAPDH
AXL
ERK
pEGFR
EGFR
0’ 30’ 0’ 30’ 0’ 30’ 0’ 30’ 0’ 30’ 0’ 30’
Non
transfected
AXLWT
AXL K567R
Non
transfected
AXLWT
AXLK567R
GAS6
PEO4 TYKnu
PEO4Epi-ATYKnuMes
A
C
B
PEO4Epi-ATYKnuMes
Nontransfected AXLWT AXLK567R
Nontransfected AXLWT AXLK567R
DAPI/pEGFR/AXL-EGFR complex
Fig. 3. AXL kinase domain is crucial for phosphorylation of other RTKs. (A) Im-
munostaining of AXL-deficient Epi-A subtype PEO4 cells and Mes-subtype TYKnu cells,
transfected with wild-type AXL (AXLWT
) or AXLK567R
. (B) Western blotting for pAXL,
pEGFR, and pERK in Mes TYKnu and in Epi-A PEO1 cells transfected with AXLWT
or
AXLK567R
and stimulated with GAS6. (C) Proximity ligation assay to assess AXL-EGFR
cross-talk (red dots) upon stimulation with GAS6 in Mes TYKnu and in Epi-A PEO4 cells
transfected with AXLWT
or AXLK567R
, alongside immunostaining for pEGFR (green).
Scale bars, 50 mm. Blots and microscopy images are representative of three
experiments.

(12 hours) time points but only induced ERK activation at the early
time point (Fig. 4B). This suggested that epithelial systems are under
modulation of more than just the membrane rafts. To investigate the
cause of the reduced ERK response, even upon increased AXL-RTK
cross-talk, we analyzed the expression pattern of dual specificity phos-
phatases (DUSPs) across the Epi-A and Mes subtypes (Fig. 4C).
DUSP4, with an abundance significantly lower in Mes subtype (Fig.
4D), dephosphorylates ERK to modulate the MEK-ERK cascade in ovar-
ian cancer (34). Silencing DUSP4 with small interfering RNA (siRNA) in
Epi-A PEO1 and OVCA429 cells (Fig. 4E) increased the temporal
ERK response (Fig. 4F and fig. S4A) but not to the extent that was
observed in Mes cells. This may be explained by lack of AXL-RTK
cross-talk in Epi-A cells. Epi-A cells treated with both MBCD and
DUSP4 siRNA induced AXL-RTK cross-talk as well as ERK activation
at a later time point (Fig. 4G and fig. S4B). In epithelial systems, RTK
networks are modulated by membrane architecture, and ERK activity
is regulated by DUSP4; thus, loss of both these regulatory mechanisms
enables a signaling phenotype that is mesenchymal-like (Fig. 4H).
DUSP1
DUSP2
DUSP3
DUSP4
DUSP5
DUSP6
DUSP7
DUSP8
DUSP9
DUSP10
DUSP11
DUSP12
DUSP13
DUSP14
DUSP15
DUSP16
DUSP18
DUSP19
DUSP21
DUSP22
DUSP23
DUSP26
DUSP27
DUSP28
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1.0
1.1
1.2
1.3
1.4
1.5
Foldchange
Epi-A
Mes
ERK
AXL
GAS6
cMET
EGFR
DUSP
AXL
GAS6
cMET
EGFR
Lipid raft
ERK
AXL
GAS6 cMET
EGFR
ERK
DUSP
12h 12h 12h 12h 12h 12h 12h 12h
PEO1 OVCA429 SKOV3 HEYA8 PEO1 OVCA429 SKOV3 HEYA8
Epi-A Mes Epi-A Mes
Control +MBCD
pAXL
pHER2
pEGFR
pERK
GAPDH
GAS6
3h2h 2.5h1h 1.5h 3.5h 4h 6h 12h
OVCA429 Epi-A
pAXL
pERK
GAPDH
ERK
pEGFR
3h2h 2.5h1h 1.5h 3.5h 4h 6h 12hGAS6
NontargetingsiDUSP4SMARTpool
pAXL
pERK
GAPDH
ERK
pEGFR
GAS6
G
pAXL
pERK
GAPDH
Nontargeting siDUSP4 Nontargeting siDUSP4
Control +MBCD
GAS6
pEGFR
Epithelial system:
Membrane modulation of
AXL-RTK cross-talk and
DUSP4 regulation of
pERK
60h
72h
60h
72h
60h
72h
60h
72h
DUSP4
Vinculin
PEO1 OVCA429 PEO1 OVCA429
Nontargeting siDUSP4 SMARTpool
0’ 10’ 20’ 30’
0’ 10’ 20’ 30’
12h12h12h12h0’ 30’ 0’ 30’ 0’ 30’ 0’ 30’
-
Fig. 4. Membrane rafts and cellular phosphatases regulate epithelial systems to downmodulate AXL signaling. (A) Cholesterol, visualized by filipin staining, in cells
cultured with MBCD for up to 12 hours. Scale bar, 200 mm. (B) Western blotting for AXL-RTK cross-talk and pERK in Epi-A–subtype PEO1 and OVCA429 upon stimulation with
GAS6. (C) Expression of the DUSPs from the gene expression database CSIOVDB (38). (D) DUSP4 expression in Epi-A compared with Mes subtypes. P = 1.28 × 10−
22 by Mann-
Whitney test. (E) DUSP4 knockdown using a DUSP4-targeting SMARTpool siRNA compared to a control siRNA in PEO1 and OVCA429 cells. (F) Western blotting for pERK response
upon GAS6 stimulation in DUSP4-depleted or control OVCA429 cells. (G) Western blotting for pERK and RTK cross-talk in DUSP4- and cholesterol-depleted OVCA429 cells upon
GAS6 stimulation. (H) Schematic overview of AXL signaling and modulation. Blots and microscopy images are representative of three experiments.

The Mes subtype is more sensitive to the AXL
inhibitor R428
R428, an AXL-selective inhibitor, blocks tumor dissemination and pro-
longs survival in mouse models of metastatic breast cancer (12). To
support specificity of the inhibitor, we first confirmed that R428 did
not disrupt EGF-EGFR signaling (fig. S5A). To test whether R428
causes different effects among ovarian cancer GEMS, we treated 10
selected cell lines representing the different GEMS (fig. S2A) with
R428 for 48 hours to determine the 50% growth inhibition (GI50) con-
centrations. Mes cell lines had a significantly lower mean GI50 of 2.91
mM compared to the other subtypes with a mean GI50 of 9.38 mM (P =
0.016) (Fig. 5A). Furthermore, AXL-deficient Epi-A PEO4 cells, and
Mes TYKnu cells, were transfected with wild-type or kinase-deficient
(K567R) AXL and treated with R428. The R428-mediated GI50 in
AXL-null PEO4 and TYKnu cells was high at 195.9 and 262.86 mM,
respectively, enforcing the specificity of the AXL inhibitor (fig. S5B).
High GI50 was also observed in kinase-deficient AXLK567R
-transfected
PEO4 cells (276.6 mM) and TYKnu cells (245.5 mM), confirming the
Non-Mes Mes
0
5
10
15
20
25
GI50R428(m)
*
DMSO 2.91 M 9.38 MDMSO 2.91 M 9.38 M
0
5
10
0
20
40
60
80
SKOV3 IM Mes
0
5
10
15
10
20
30
40
HEYA8 M Mes
0’ 30’ 3h12h 0’ 30’ 3h12h 0’ 30’ 3h12h 0’ 30’ 3h12h 0’ 30’ 3h12h 0’ 30’ 3h12h
OVCA429 IE Epi-A
0
5
10
0
20
40
60
80
100
0
2
4
6
8
0
50
100
150
PEO1 E Epi-A
pERKintensitypAXLintensity
0’ 30’ 3h12hGAS6 0’ 30’ 3h12h 0’ 30’ 3h12h 0’ 30’ 3h12h 0’ 30’ 3h12h 0’ 30’ 3h12h
DMSO 2.91 M 9.38 M DMSO 2.91 M 9.38 MR428
**
***
* * *
* * *
0.0
0.1
0.2
0.3
Velocity(µm/s)
DMSOcontrol
R4282.91µM
R4289.38µM
DMSOcontrol
R4282.91µM
R4289.38µM
DMSOcontrol
R4282.91µM
R4289.38µM
DMSOcontrol
R4282.91µM
R4289.38µM
PEO1 OVCA429 SKOV3 HEYA8
A
D
DMSOCtrl
R4283µM
R42810µM
DMSOCtrl
R4283µM
R42810µM
DMSOCtrl
R4283µM
R42810µM
0
100
200
300
400
Tumorvolume(mm3
)
HEYA8SKOV3PEO1
*
*
*
*
*
E F
12h3h0’ 30’ 0’ 3h12h30’ 3h12h0’ 30’ 0’ 3h 12h30’ 3h 12h0’ 30’ 0’ 12h30’ 3h
DMSO Ctrl 2.91 M 9.38 MR428 DMSO Ctrl 2.91 M 9.38 M
B
PEO1 E Epi-A OVCA429 IE Epi-A
SKOV3 IM Mes HEYA8 M Mes
pERK 1/2
44−42 kDa
pAXL 140 kDa
GAPDH 37 kDa
GAS6 400 ng ml-1
pERK 1/2
44 − 42 kDa
pAXL 140 kDa
GAPDH 37 kDa
HEYA8
MMes
PEO1
EEpi-A
SKOV3
IMMes
DMSO Ctrl 2.91 M 9.38 MR428
C
Fig. 5. The Mes subtype is more sensitive to the AXLinhibitorR428. (A)GI50 valuesfor AXL inhibitorR428in epithelialovarian cancercelllines.P = 0.0167, Mesversus non-Mes
by Mann-Whitney test. (B) Western blotting for pAXL, pAKT, and pERK in epithelial ovarian cancer cell lines PEO1 and OVCA429 (Epi-A) or SKOV3 and HEYA8 (Mes), preincubated
with DMSO [control (Ctrl)], 2.91 mM R428 (GI50
Mes
), or 9.38 mM R428 (GI50
non-Mes
) for an hour, then stimulated with GAS6 for 0.5, 3, or 12 hours. (C) Quantitation of immunofluore-
sence staining for pAXL, pAKT, and pERK in epithelial ovarian cancer cell lines PEO1 and OVCA429 (Epi-A) or SKOV3 and HEYA8 (Mes) upon treatment with the indicated dose of
R428. (D) Velocity of Epi-A– and Mes-subtype cell lines exposed to 2.91 mM (GI50
Mes
) or 9.38 mM R428 (GI50
non-Mes
). (E) Chick CAM model of Mes or Epi-A cell line tumor growth in
response to R428. Scale bars, 2000 mm. (F) Tumor volume as the mean radius (r) of the fluorescent tumor was calculated relative to background. Tumor was assumed to be a
spheroid with volume 4pr3
/3. Data in (A), (C), (D), and (F) are means ± SEM from at least three experiments; *P < 0.05, **P < 0.01, and ***P < 0.001 by Student’s t tests. Blots and
microscopy images are representative of three experiments.

relevance of the AXL kinase domain (fig. S5B). Transfections with
functional wild-type AXL showed a GI50 of 30.48 mM in Epi-A
PEO4 cells and a significantly lower GI50 of 3.45 mM in Mes TYKnu
cells (fig. S5B).
Because Mes has a unique GAS6-AXL signaling network, we ex-
plored the effect of R428 on this signaling network in comparison
to Epi-A. Two Epi-A lines (PEO1 and OVCA429) and two Mes
lines (SKOV3 and HEYA8) were chosen and preincubated with di-
methyl sulfoxide (DMSO; control), 2.91 mM (GI50
Mes
), and 9.38 mM
(GI50
non-Mes
) of R428. From both Western blotting and immuno-
staining, the early-phase ERK activation in Epi-A was only inhibited at
the higher concentration of R428 at 9.38 mM, whereas the early- and
late-phase ERK activation in Mes were effectively inhibited at the low-
er concentration of 2.91 mM (Fig. 5, B and C, and fig. S5C). In addi-
tion, these four cell lines also represent different phenotypes along the
EMT spectrum (E, PEO1; IE, OVCA429; IM, SKOV3; M, HEYA8).
From the phenotypic perspective, lower R428 concentration of 2.91
mM had no effect on the pERK and pAXL activations in PEO1 (E),
whereas OVCA429 (IE) showed a moderate reduction (Fig. 5C and
fig. S5C). The SKOV3 (IM) line showed a drastic decrease, whereas
the HEYA8 (M) line showed complete inhibition at 2.91 mM (Fig.
5C and fig. S5C). Mes shows dependence on the GAS6-AXL axis
and is therefore very sensitive to AXL inhibition. In addition, complex
RTK networks connected by AXL might govern the phenotypic
transition along the EMT gradient.
To analyze the functional consequences following AXL signaling in-
hibition, we preincubated PEO1, OVCA429, SKOV3, and HEYA8 with
R428 and tracked for motility. Similar to the pERK and pAXL signaling
inhibition, Epi-A cell lines showed motility inhibition only at the higher
concentration of R428, whereas Mes cell lines showed effective inhibi-
tion at the lower concentration (Fig. 5D and fig. S5, D to F).
To translate the AXL signaling inhibition and functional repression
to a biologically relevant system, we embedded the four cell lines in Ma-
trigel and deposited on top of the chick chorioallantoic membrane
(CAM) model to study the relevance of AXL inhibition in ovo. The
in ovo findings substantiated the in vitro results, with HEYA8 and
SKOV3 forming large tumors in the CAM, which were significantly
suppressed at 2.91 mM as well as at 9.38 mM of R428 (Fig. 5, E and
F). Unlike its Mes counterparts, tumor formation in PEO1 was not
inhibited at 2.91 mM but only at 9.38 mM (Fig. 5, E and F). The
OVCA429 line proved to be nontumorigenic in the CAM system.
Together, these results indicated the preferential application of in-
hibiting AXL in the Mes subtype of epithelial ovarian cancer, in which
significant sensitization to R428 can be achieved.
AXL governs the sequential phenotypic and functional
transition of EMT
Apart from pharmacological inhibition of AXL, shRNA-mediated si-
lencing of AXL was also utilized to better understand its functional role
in ovarian cancer. Two shRNAs (shAXL#40 and shAXL#41) were used
to knock down AXL, and a nontargeting shRNA (shLuciferase) was
used as a control, in Epi-A OVCA429 and Mes SKOV3 cell lines. More
than 90% reduction in total AXL protein expression was achieved by
both shRNAs (Fig. 6A). Phase-contrast images revealed that in shAXL
clones,OVCA429formedmore compactcolonies,andSKOV3reverted
from a fibroblastic to a loosely defined colony structure (Fig. 6B). Im-
munofluorescence staining revealed that shAXL OVCA429 cells
increased the intensity of E-cadherin staining at the cell-cell junctions
together with a complete restoration of cytoplasmic b-catenin to the
junctions (Fig. 6C). The shAXL SKOV3 cells showed reexpression of
E-cadherin, which was mostly cytoplasmic with partial restoration to
the cell-cell junctions (Fig. 6C). These data suggested that AXL
knockdown causes a partial reversal along the EMT spectrum. The re-
versalin OVCA429 isfroman IE state to amore epithelialstate, whereas
the SKOV3 reverts from an IM state to an IE state. This implies that the
extent of EMT reversal upon AXL knockdown is sequential and de-
pends on the cell line’s original EMT state (Fig. 6D). Note that although
the Mes subtype is indeed more sensitive to pharmacological inhibition
of AXL at lower doses of R428, shRNA-mediated AXL silencing did not
induce differential survival benefits but induced EMT reversal in both
Epi-A and Mes.
To substantiate the functional effect of partial EMT reversal in
shAXL cells, we carried out motility assays. Single-cell motility analysis
and gap closure assays in shAXL#40 and shAXL#41 clones showed a
significant reduction (fig. S6, A to C). These results were consistent with
the functional changes in cell motility after R428 inhibition.
AXL knockdown reduces anchorage-independent growth,
invasion, and tumor formation
In addition to the effect on EMT reversal, proliferation, soft agar, and
invasion assays were carried out in the shAXL cells. Both Mes SKOV3
and Epi-A OVCA429 shAXL cell lines showed reduced proliferation
(Fig. 6, E and F). This is concordant with the proliferative effects ob-
served after GAS6 stimulation that both Epi-A and Mes require AXL
signaling for cell growth. For soft agar assays, OVCA429 cells showed
minimal colony formation, which was completely abrogated in shAXL
(Fig. 6G and fig. S6D). In SKOV3, the control cells showed significant
colony formation in soft agar, and shAXLattenuated its clonogenic abil-
ity (Fig. 6G and fig. S6D). Spheroid invasion assays showed a similar
trend with OVCA429, forming minimally invasive spheroids, an effect
that was completely prevented in shAXL. SKOV3 showed numerous
invasive protrusions from the spheroids, which was abolished in shAXL
(Fig. 6H and fig. S6E).
When the spheroid invasion assay was performed in reduced serum
conditions with GAS6 treatment, only the Mes SKOV3 cell line showed
invasion, but not the Epi-A OVCA429 cell line (fig. S6, F and G). Our
data suggested that AXL played an important role in both the anchorage-
dependent and anchorage-independent growth. It is particularly essential
for the mesenchymal phenotype such as Mes that AXL is required for
anchorage independency.
In an orthotopic xenograft tumor model in mice, shAXL#40 and
shAXL#41 SKOV3 cells showed complete inhibition of tumor forma-
tion and growth compared to shLuciferase control. Tumor inhibition
was 100%, with SKOV3 shLuciferase control forming tumors [average
weight of 0.3658 g (SEM, 0.1563); average number of 5.8 (SEM, 0.74)],
and the SKOV3 shAXL#40 and shAXL#41 clones forming no tumors
(P = 0.0474; P = 0.0001) (Fig. 6, I and J). This is consistent with the
R428-mediated tumor reduction observed in the in ovo CAM model,
suggesting that AXL is indeed a key signaling node for Mes.
The AXL signature is clinically relevant for
patient stratification
A gene signature of the top 30 genes correlating with AXL expression
(Fig. 7A) was derived from the gene expression microarray analysis
(3). This “AXL gene signature” was significantly overexpressed in
Mes-type tumors (Fig. 7B). EMT scoring is a quantitative measure
of the effects of EMT on cancer progression (35); GEMS classification
and EMT status in ovarian tumors robustly correlate with a poor

prognosis in patients (35). By analyzing the gene expression profiling
meta-analysis cohort (3), the AXL gene signature positively correlated
with the ovarian-specific EMT score (Rho = +0.4148, P = 5.23 × 10−65
)
(Fig. 7C) and negatively correlated with overall patient survival (Fig.
7D). These findings were validated in an independent cohort (fig. S7,
A to C). Multivariate analysis also shows a significant prognostic
relevance of the AXL signature (table S3). In addition, the AXL gene
signature was significantly overexpressed in omental metastases (36)
(P = 0.0078) and platinum-resistant relapsed tumors (37) (P =
0.0059) compared to their paired primary tumors (Fig. 7E). This is
Epithelial mesenchymal
Intermediate
epithelial
Intermediate
mesenchymal
SKOV3OVCA429
shAXLshAXL
D
shLuciferaseshAXL#41shAXL#40
OVCA429 IE Epi-A SKOV3 IM Mes
B shLuciferase
shAXL#40
shAXL#41
AXL
140 kDa
-Actin
40 kDa
shLuciferase
shAXL#40
shAXL#41
OVCA429 IE Epi-A SKOV3 IM Mes
A
shLuciferase shAXL#41shAXL#40 shLuciferase shAXL#41shAXL#40
OVCA429 IE Epi-A SKOV3 IM MesG
shLuciferase shAXL#41shAXL#40 shLuciferase shAXL#41shAXL#40
OVCA429 IE Epi-A SKOV3 IM MesH
shControl shAXL#40 shAXL#41
0.0
0.5
1.0
1.5
Tumorweight(g)
*
*
shControl shAXL#40 shAXL#41
0
2
4
6
8
Tumornumber
****
****
0 2 4 6 8
0.0
2.5 106
5.0 106
7.5 106
1.0 107
1.3 107
Day
Numberofcells
shLuciferase
shAXL40
shAXL41
***
***
0 2 4 6 8
0
2 106
4 106
6 106
Day
Numberofcells
shLuciferase
shAXL40
shAXL41
***
***
E F I JOVCA429 IE Epi-A SKOV3 IM Mes SKOV3 IM Mes SKOV3 IM Mes
shLuciferaseshAXL#41shAXL#40
E-cadherin E-cadherinMerge Merge
OVCA429 IE Epi-A SKOV3 IM MesC
Fig. 6. AXL governs the sequential phenotypic and functional transition of EMT. (A) Western blotting of AXL in OVCA429 and SKOV3 cells upon transfection with one of the
two AXL shRNAs or a control (shLuciferase). (B) Phase-contrast images showing colony formation phenotype upon AXL knockdown in OVCA429 and SKOV3 cells. Scale bars, 200 mm.
(C) Immunostaining for E-cadherin and b-catenin abundance and localization in OVCA429 and SKOV3 cells upon AXL knockdown. Scale bars, 50 mm. (D) Schematic of partial EMT
reversal facilitated by AXL knockdown, from an “intermediate mesenchymal” to an “intermediate epithelial” state in SKOV3 cells, and from an “intermediate epithelial” state to a more
“epithelial” state in OVCA429 cells. (E and F) Proliferation in cultured SKOV3 (E) and OVCA429 (F) cells upon AXL knockdown. (G) Colony formation in soft agar in SKOV3 and OVCA429
cell lines upon AXL knockdown. Scale bars, 200 mm. (H) Spheroid invasion in complete medium in SKOV3 and OVCA429 cell lines upon AXL knockdown. Scale bars, 200 mm. (I and J)
Tumor number (I) and mass (J) in severe combined immunodeficient (SCID)–Beige mice 4 weeks after intraperitoneal injection with SKOV3 cells (5 × 106
cells, 200 ml of suspension)
transfected with either shLuciferase (control) or one of two AXL shRNAs. Data are means ± SEM from at least three experiments (E and F) or five mice per condition (I and J); *P < 0.05,
**P < 0.01, ***P < 0.001, and ****P < 0.0001 by Student’s t tests. Blots and microscopy images are representative of 3 experiments.

consistent with the notion that AXL overexpression is associated with
poor prognosis (26). The strong correlation between AXL and EMT
further highlighted its relevance in EMT modulation and subsequent
effects in promoting tumor dissemination and drug resistance, which
translates to patient survival. Analyzing RPPA data in the TCGA re-
vealed greater abundance of pMAPK in Mes-subtype cells (P =
0.0282) (Fig. 7F); we propose that this could at least partially be the
result of increased GAS6-AXL signaling and RTK cross-talk. An
increased phosphorylation of ERK in Mes-type cells was validated
by Western blotting tumor samples that had been previously stratified
by GEMS (Fig. 7G) (38).
Together, our data indicate that cells of different GEMS in ovarian
cancer show varied responses to the same kinase signaling axis that di-
rect functional and therapeutic consequences. In particular, our data
suggest that the Mes subtype is addicted to the GAS6-AXL-RTK
cross-talk. The recurrent temporal activation of ERK downstream to
GAS6-AXL results functionally in a motile and invasive phenotype that
is synonymous with EMT. Therapeutically, the amplified signaling sen-
sitizes the Mes subtype to AXL inhibition, thus providing evidence to
utilize AXL as a GEMS-specific target. Moreover, because our data in-
dicate that AXL mediates EMT, stratifying patients for AXL inhibition
on the basis of EMT status may also be a rational clinical strategy.
Mes vs. rest, Mann-Whitney
P = 1.39 ×10–120
P = 5.23 ×10–65
Ovarian cancer (n = 1142)
B
Mes
Stem-B
Epi-A
Epi-B
Stem-A
Tumour
Ov.aXLsignature
Ovarian-specific EMT
Rho = +0.4148
AEBP1
AXL
CDH11
COL10A1
COL1A1
COL3A1
COL5A1
COL5A2
CRISPLD2
CTSK
PTGIS
SERPINF1
SFRP4
SNAI2
SPARC
THBS1
THBS2
TIMP3
VCAM1
VCAN
ZEB1
CXCL12
DCN
EFEMP1
FAP
FBN1
FN1
INHBA
LUM
MMP2
OLFML3
AXL gene signatureA C
P = 0.0059
E-MTAB-611E
P = 0.0078
GSE30587
HR = 1.263P = 0.0096
AXLsig-high
AXLsig-low
D
HR = 1.58 P = 0.0003
Survival%
100
0
0 150Month
Survival%
100
0
0 150Month
Ovarian cancer overall survival (n = 978)
AXLsig-Q4
(highest 25%)
AXLsig-Q1
(lowest 25%)
G
pERK1/2
44−42 kDa
1-1140
1-0424
1-0444
1-1250
Stem-B
1-0286
1-1021
1-1281
1-0668
1-0682
1-0683
1-0156
Epi-A Epi-B
1-0378
1-0585
Stem-A
1-0237
1-0372
1-0626
Mes
-Actin
40 kDa
GSE69207 subtyped ovarian tumors
Mes vs. rest, Mann-Whitney
P = 0.0282
pMAPK(pT202)
TCGA ovarian tumor RPPA
Stem-B
Epi-A
Epi-B
Mes
Stem-A
F
Fig. 7. AXL signature positively correlates with EMT and confers worse prognosis. (A) AXL gene signature, defined by the cluster of genes that positively correlated with AXL
expression in a published microarray (3). (B) Expression pattern of the AXL gene signature in ovarian tumor samples [n = 1142 (3)] classified by ovarian GEMS. P = 1.39 × 10−120
by
Mann-Whitney test, Mes versus the rest. Ov., ovarian. (C) Correlation of AXL gene signature with ovarian-specific EMT score in tumor samples (3). Rho = +0.4148; P = 5.23 × 10−65
.
(D) Survival in ovarian cancer patients (3) classified by expression of the AXL gene signature (AXLsig) and analyzed either by median expression (left) or by the lowest and highest
quadrants(right). (E)AXL signature inplatinum-resistant relapsedtumorsfrom the E-MTAB-611dataset (left; P =0.0059) andin omentalmetastasesfromthe GSE30587dataset (right;
P = 0.0078), each compared to the paired primary tumor. (F) RPPA-based abundance of pMAPK (pThr202
) in Mes subtype ovarian tumors from the TCGA, P = 0.0282 by Mann-Whitney
test, Mes versus the rest. (G) Western blotting for pERK1 (Thr202
/Tyr204
) and phosphorylated (Thr185
/Tyr187
) ERK2 in epithelial ovarian cancer tumor samples classified by subtype.

DISCUSSION
AXL was originally identified as a transforming gene in human myeloid
leukemia cells (39). There is ectopic expression or overexpression in sev-
eralcancers including glioblastoma, lung, breast, colorectal, gastric, pan-
creatic, bladder, renal, endometrial, and ovarian cancer (17). In ovarian
cancer, AXL is crucial to initiate and sustain metastasis and tumor dis-
semination in mouse models (18). However, given the vast molecular
heterogeneity of the disease, the biology of AXL in the ovarian context is
unclear. Here, we illustrated the divergent roles of AXL among the
GEMS in ovarian cancer. AXL is significantly enriched in Mes, and
its activation potentiates cross-talk with EGFR and cMET, amplifying
downstream oncogenic signaling such as recurrent pERK peaks. The
differential pERK responses between Epi-A and Mes could potentially
be linked to an increased complex network of RTK interactions along
the EMT spectrum, resulting in the amplification of RTK signaling. Our
results indicate a reliance of the Mes subtype on the GAS6-AXL module
to propagate RTK signaling interactions. AXL has been previously
shown to interact with cMET (40), EGFR (14), and HER2 (41) in lung
and breast cancers. In head and neck and esophageal squamous cell
carcinomas, it has been reported that AXL dimerizes with EGFR to con-
fer resistance to PI3K inhibition (16). This AXL-RTK cross-talk might
exist in reciprocal control since activation of EGFR was shown to trans-
activate AXL in triple-negative breast cancer, thereby promoting addi-
tional signaling cascades to effect motility responses (42). Notably,
inhibiting AXL in MCF7 and T47D cell lines had no effect, whereas
the MDA-MB-231 and MDA-MB-157 showed loss of EGFR-mediated
functions when AXL was inhibited (42). The former two cell lines have a
negative EMT score and are classified as epithelial, whereas the latter
have a positive EMT score and are classified as mesenchymal (35).
Therefore, this AXL-RTK reciprocal cross-talk might be tightly
governed by the intrinsic EMT status that only exists in the mesenchy-
mal phenotype. This alludes to the conserved ability of one oncogenic
RTK to recruit and activate other receptors through clustering, leading
to the diversification of signaling pathways in cells that have undergone
an EMT, conferring the mesenchymal state with a more aggressive
phenotype. Additional evidence comes from targeting AXL with a
high-affinity RNA-based inhibitory aptamer GL21.T that abrogates
AXL-mediated invasion and tumor growth in mice (43). This aptamer
selectively accumulates in the AXL-overexpressing, mesenchymal-like
A549 xenograft (43) but not in the AXL-low, epithelial MCF7. In mes-
enchymal systems such as A459 and MDA-MB-231, AXL inhibition
improvesresponsestoerlotinibandreducesmetastasisinvivo(44). Col-
lectively, it is clear that anti-AXL therapy will principally be efficacious
in systems that have undergone EMT. However, it is worthwhile to note
that in pancreatic cancer models in mice, anti-AXL monoclonal antibo-
dies (mAbs) have inhibited the growth of xenografts derived from ep-
ithelial cell lines (such as BxPC-3) and mesenchymal cell lines (such as
MiaPaCa-2) alike (45).
Downstream the AXL-RTK network, several adapter proteins such
as SHC, SRC, and SHP-2 are activated in Mes but not in Epi-A. This is
paralleled to the recurrent ERK activation followed by FRA1 induction.
Consequently, the sustained ERK and FRA1 activation contributes to
an EMT-like phenotype in terms of enhanced motility. ERK activation
has been previously linked to motility (46) via the EMT-inducing
transcription factor Slug (47). The ERK/FRA1 axis is involved in mod-
ulating the EMT transcription factors Slug and ZEB1 and cell motility
(27, 48). Our data not only corroborate with these findings but also pro-
vide additional significance in the specific activation of this signaling
cascade in a clinically relevant subset of ovarian cancer, the Mes sub-
type. This might lead to a targetable conduit for the AXL-RTK-ERK axis
by precise patient stratification in ovarian cancer. The tendency of Mes
to amplify AXL signaling results into an increase in the sensitivity to
pharmacological inhibition of AXL compared to other ovarian cancer
GEMS. In lung cancer, mesenchymal cells are more sensitive to AXL
inhibition by the small-molecule inhibitor SGI-7079, and this is primar-
ily because of increased AXL abundance (15). However, our findings
further show that in addition to AXL abundance, the AXL-RTK-ERK
cross-talk pattern is another important feature to determine the sensi-
tivity to AXL inhibition.
AXL-associated EMT has been shown to mediate resistance to tar-
geted therapy (12, 14, 15, 49, 50). Pharmacologic inhibition of AXL ac-
tivity has been demonstrated to reverse the resistance. In non–small cell
lung cancer, mesenchymal cells show greater resistance to EGFR-targeted
therapy due to increased abundance of AXL. This resistance can be
reversed by inhibiting AXL (15), which suggests oncogenic dependence
on AXL in systems that have undergone EMT. Increased activation of
AXL in the absence of acquired EGFR T790M mutation or cMET ac-
tivation confers erlotinib resistance in multiple lung cancer models
in vitro and in vivo, with genetic or pharmacologic inhibition of AXL re-
storing sensitivity (14). These findings highlight the therapeutic
potential of AXL inhibition in drug-resistant tumors. Currently, there
are several AXL-targeted inhibitors, such as MGCD265, NPS-1034 (51),
S49076 (52), and CEP-40783, that cross-inhibit otherRTKs, particularly
cMet. Most of these inhibitors are positioned to be used as the second-
line treatment after acquiring EGFR resistance (51, 53). However, an-
other potential approach would be to target the mesenchymal system
with AXL inhibition as the first-line treatment. This rationale is based
on our finding that the RTK activation network exhibit increasingly
robust cross-talk along the EMT gradient, thereby drastically sensitizing
mesenchymal-like cancer cells to inhibition of the AXL signaling node.
Our data also imply that tumors of an epithelial phenotype will also show
some sensitivity at higher doses. We speculate that the epithelial cells are
likely to retain linear signaling axis, which shows a dose-dependent inhi-
bition. The linear signaling nature of the AXL axis in Epi-A–type tumors
has decreased dependency on AXL signaling and suggests that resistance
to selective AXL inhibitors would be more likely. It will be worth explor-
ing whether those inhibitors targeting both AXL and other RTKs would
be a better choice for the epithelial Epi-A subtype.
There are several strategies to target AXL. Several small–molecular
weight compounds that inhibit the kinase pocket of AXL are in the
clinical pipelines (54). A monoclonal antibody YW327.6S2 has proven
to be effective in blocking the GAS6-AXL axis by binding and inter-
nalizing AXL (44). Apart from targeting AXL directly, a “decoy recep-
tor” has been engineered to bind GAS6 and inhibitits function and has
shown to markedly reduce metastatic spread in SKOV3 intra-
peritoneal mouse model (55). Apart from pharmacological inhibition,
genetic inhibition of AXL using shRNA showed partial reversal of
EMT in ovarian cancer cell lines and reduction in motility and inva-
sion and in tumorigenesis in vivo.
In conclusion, molecular stratification of ovarian cancer by GEMS
enables the identification of key players in molecular networks that
modulate the functions of a specific molecular subtype, with AXL being
a crucial player in the Mes subtype. The GAS6-AXL pathway initiates a
recurrent and sustained ERK response exclusively for the Mes subtype,
which contributes to an increase in motility and signal amplification via
extensive cross-talks with other RTKs. This inherent amplification of
oncogenic signaling makes the Mes subtype more sensitive to AXL
inhibition. Thus, identifying the Mes-subtype ovarian cancer patients

followed by targeted AXL inhibition would be promising in a prospec-
tive clinical setting, such as in platinum-resistant diseases.
MATERIALS AND METHODS
Cell culture
Thirty eight of the 43 SGOCL panel of ovarian cancer cell lines used
have been documented previously (22). They were cultured in their spe-
cified media with requisite amounts of fetal bovine serum and 1% pen-
icillin and streptomycin (Sigma-Aldrich) and grown at 37°C in a 95%
air and 5% CO2–regulated incubator. For kinetic stimulation studies,
the 10 epithelial ovarian cancer cell lines were seeded to attain 70% con-
fluence, serum-starved overnight, and activated with GAS6 (400 ng ml−1
;
#885-GS, R&D Systems) for 0, 10, 20, and 30 min and 1, 3, 6, 12, and
24 hours, and lysates were collected for analysis. For AXL inhibitor stu-
dies, the 10 epithelial ovarian cancer cell lines were seeded to obtain 80%
confluence at the end of study, incubated with R428 (#BGB324, Selleck-
chem) at varying doses between 0 and 80 mM for 48 hours to calculate
GI50 doses. CellTiter MTS cell proliferation assay (#G3580, Promega)
was used to evaluate 50% inhibition. For GAS6 kinetics upon AXL in-
hibition, cells were serum-starved overnight and preincubated with
GI50
non-Mes
or GI50
Mes
concentrations of R428 for an hour, whereas con-
trol cells were incubated with DMSO and then stimulated with GAS6
(400 ng ml−1
) for requisite time points. For the MEK inhibitor studies,
cellswerepreincubatedwitheithernodrug(DMSO-onlycontrol)or2mM
PD0325901 for 4 hours and then stimulated with GAS6 to visualize
signaling kinetics and motility. For ERK inhibitor studies, cells were pre-
incubated with either DMSO (control) or 5 mM SCH772984 for the re-
quired time to study the time course–dependent effects. For transfection
experimentsinPEO4andTYKnucells,IRES-GFP-AXL-KDandpIRESpuro2
AXL were a gift from A. Meyer (plasmids #65498 and #65627, Addgene).
Antibodies
AXL C89E7 rabbit mAb (#8661), phospho-AXL Tyr702
D12B2 rabbit
mAb (#5724), phospho-AKT Ser473
D9E XP rabbit mAb (#4060),
phospho-AKT Thr308
D25E6 XP rabbit mAb (#13038), AKT pan
11E7 rabbit mAb (#4685), GAPDH D16H11 XP rabbit mAb (#5174),
Slug C19G7 rabbit mAb (#9585), phospho-FRA1 Ser265
D22B1 rabbit
mAb (#5841), phospho-HER2/Erb2 Tyr124
8 rabbit mAb (#2247),
HER2/Erb2 29D8 rabbit mAb (#2165), phospho-EGFR Tyr1068
D7A5
XP rabbit mAb (#3777), phospho-Met Tyr1234/1235
3D7 rabbit mAb
(#3129), and cMET 25H2 mouse mAb (#3127) were purchased from
Cell Signaling Technology (CST). Phospho-ERK1 pT202/pY204 +
phospho-ERK2 pT185/pY187 mouse mAb (#ab50011) and ERK1/2
rabbitpolyclonalantibody(pAb)(#ab17942)werepurchasedfromAbcam.
EGFR/ErbB1 goat pAb (#E1157) was purchased from Sigma-Aldrich. The
above listed primary antibodies were used in immunoblotting at 1:1000
dilution. b-Catenin D10A8 XP rabbit mAb (#8480) from CST and
E-Cadherin Clone 36/E mouse mAb (#610182) from BD Biosciences were
used 1:100 and 1:2000 for immunostaining, respectively. The phospho-
HER2, phospho-EGFR, phospho-Met, and AXL antibodies were used
at 1:100 for Duolink and immunostaining. The phospho-AXL and
phospho-ERK antibodies were used at 1:100 for immunostaining.
Western blotting
Whole-cell lysates were generated by lysis with radioimmunoprecipita-
tion assay (RIPA) buffer (Sigma-Aldrich), along with protease and
phosphatase inhibitor cocktails (Calbiochem). Tumor samples from
the National University Hospital cohort (GSE69207) that have been
previously subtyped (38) were lysed in 200 ml of RIPA buffer with pro-
tease and phosphatase inhibitor cocktails using a tissue homogenizer.
Bicinchoninic acid assay was used to evaluate protein concentrations
(#23225, Thermo Scientific). The Bio-Rad Mini Protean II apparatus
was used to perform gel electrophoresis on the lysates, and the Bio-Rad
Mini Trans-Blot apparatus was used to transfer the gel onto poly-
vinylidene difluoride membranes (#IPFL00010, Millipore). Membranes
were blocked with LI-COR blocking buffer (#927-40000) and subsequent-
ly probed with primary antibodies. Incubation with secondary antibodies
containing fluorophores at 1:20,000 dilution [IRDye 800CW–conjugated
goat anti-rabbit (#926-32211) and IRDye 680–conjugated goat anti-
mouse antibodies (#926-32220), LI-COR Biosciences] enabled visualiza-
tion on the Odyssey Infrared Imaging System from LI-COR Biosciences.
Full-length blots for the various experiments are shown in fig. S8.
Single-cell motility tracking
The 10 epithelialovarian cancercelllineswere seeded at50% confluence
in ibidi 24-well microplate and serum-starved overnight. They were
stained for an hour with Hoechst nuclear dye (1:500,000; #62249, Life
Technologies) and then stimulated with GAS6 (400 ng ml−1
), whereas
controlcells were left untreated andvisualizedunder the SP5 Leica Con-
focal system overnight at intervals of 10 min. The results were analyzed
in ImageJ software using TrackMate to calculate individual cellular dis-
placements, velocity of locomotion, speed, distance travelled, and direc-
tional persistence. In the R428 studies, the cells were serum-starved
overnight and preincubated with GI50
non-Mes
or GI50
Mes
concentrations
of R428 for an hour, whereas control cells were incubated with DMSO
and then stimulated with GAS6 (400 ng ml−1
).
Gap closure assays
The 10 epithelial ovarian cancer cell lines were seeded at 100% confluence
into culture inserts (#80209, ibidi) in a 24-well microplate and serum-
starved overnight. CellMask membrane dye (1:4000; #C10049, Life Tech-
nologies) was added for an hour, the insert was removed to generate a
500-mm gap and stimulated with GAS6 (400 ng ml−1
). Control cells were
not stimulated. The cells were visualized under the SP5 Leica Confocal sys-
tem overnight at intervals of 10 min. The results were analyzed in ImageJ
software to generate the gap closure at 12 hours after GAS6 stimulation.
Reverse-phase protein array
Mes-subtype SKOV3 cell line and Epi-A subtype PEO1 cell line were
serum-starved overnight and treatedwithGAS6(400 ng ml−1
) for 30min
or 12 hours, whereas control cells were untreated. RPPA procedure
involved serial dilution of samples and subsequent colorimetric detection
by antibodies upon tyramid amplification. Spot intensity assessment was
doneusingtheRpackagedevelopedin-houseattheMDAndersonCancer
Center with protein levels quantified by SuperCurve method (http://
bioinformatics.mdanderson.org/OOMPA). Data were log-transformed
(base 2) and median-control–normalized across all proteins within a
sample. The RPPA antibody list can be obtained at www.mdanderson.
org/education-and-research/resources-for-professionals/scientific-
resources/core-facilities-and-services/functional-proteomics-rppa-core/
antibody-lists-protocols/functional-proteomics-reverse-phase-protein-
array-core-facility-antibody-lists-and-protocols.html.
Also, for the abundance of pMAPK (pThr202
) in ovarian tumors,
level 3 RPPA data of ovarian cancer clinical samples were downloaded
from TCGA data portal (https://tcga-data.nci.nih.gov/tcga/). The sub-
type information was extracted from our previous gene expression
analysis of the corresponding samples (3).

Duolink PLA assay
For this proximity ligation amplification (PLA) assay (#DUO92102
and #DUO92104, Duolink, OLink Biosceinces, Sigma-Aldrich), cells
were seeded on glass coverslips, serum-starved overnight, and treated
with GAS6 (400 ng ml−1
) for 30 min; control cells were untreated. The
manufacturer’s instructions were followed.
Immunofluorescence staining
Cells were seeded on coverslips in full medium and left to adhere for
24 hours and to reach 50% confluence. After necessary serum deple-
tion and/or treatments, cells were fixed with ice-cold 100% methanol
for 5 min at −20°C and then rehydrated thrice in phosphate-buffered
saline (PBS) for 5 min each. Coverslips were blocked for 30 min with 3%
bovine serum albumin (BSA)/PBS and then incubated with primary
antibodies in 1% BSA/PBS for 1 hour in a moist environment. After
three washes with PBS, cells were incubated with fluorescently labeled
secondary antibodies (1:400; Alexa Fluor Life Technologies, donkey anti-
mouse, donkey anti-goat or donkey anti-mouse) in 1% BSA/PBS for
1 hour. After three washes with PBS, the coverslips were mounted using
ProLong Gold antifade with 4′,6-diamidino-2-phenylindole (DAPI)
with mounting medium.
Cholesterol depletion protocol
MBCD (#C4555, Sigma-Aldrich) was used to deplete cholesterol. PEO1,
OVCA429, SKOV3, and HEYA8 cells were grown on 13-mm coverslips
and treated with 5 mM MBCD for 30 min at 37°C; control cells were
maintained without cholesterol depletion. After MBCD treatment, cells
were allowed to recover for 0 and 30 min, and 12 hours in serum-free
medium and then fixed with ice-cold methanol for 5 min and rehydrated
thrice with PBS. The cells were stained with Filipin (0.05 mg ml−1
;
#C4767, Sigma-Aldrich), diluted in PBS for 1 hour at room temperature,
and rinsed thrice with PBS. The coverslips were mounted in non-DAPI
mounting medium, and the filipin staining was observed under the
405-nm wavelength of a fluorescent microscope.
Chick CAM model
Fertilized chicken eggs were purchased from Henry Stewart & Co. Ltd.,
washed, and incubated at 37°C with 60% relative humidity on embry-
onic day 1 (ED1), for implantation on ED4. The method for the prep-
aration of the CAM was a modification of a previously described
technique (56). Under sterile conditions, a small hole was pierced
through the pointed pole of the shell using a 19-gauge needle, and a
2-cm diameter window of shell was removed to expose the CAM.
The inner shell membrane was carefully removed with sterile forceps
to expose the CAM. This window was covered with a sterile 10-mm
tissue culture dish and sealed with Suprasorb F sterile wound healing
film (Lohmann & Rauscher). Between ED7 and ED10 of incubation,
the membranes are ready for the grafting of cancer cells. PEO1,
OVCA429, SKOV3, and HEYA8 cells were preincubated with
DMSO only (control cells) or with GI50
non-Mes
or GI50
Mes
concentra-
tions of R428 for 48 hours. Grafts were prepared by suspending 106
cells in 100 ml of Matrigel (BD Biosciences). A medium to large blood
vessel was then bruised using a sterile cotton bud, and 25 ml of the
prepared graft, containing 1 × 106
cells was then inoculated onto this
area. After inoculation, the window was covered, sealed, and placed
back in the incubator. Tumor growth and viability of the embryo
were checked daily. Tumor dimensions were measured using
SteREO Discovery.V8 microscope (Zeiss) with the Zen 2.0 blue edi-
tion software (Zeiss).
AXL knockdown
Five validatedAXLMISSION shRNAandcontrolshRNA (shLuciferase
targeting) bacterial glycerol stocks were purchased from Sigma-Aldrich.
DNA was purified and extracted using PureYield Plasmid Miniprep
System (Promega) and used to transfect 293T cells according to the
manufacturer’s protocol. The virus generated was subsequently filtered
to remove 293T cell debris and used to infect OVCA429 and SKOV3
with polybrene (4 mg ml−1
). The sequences that gave the maximum de-
crease in AXL protein abundance after infection and selection with pu-
romycin (5 mg ml−1
) were the following: TRCN0000001040 (clone ID,
NM_021913.x-2909s1c1; sequence, CCGGCGAAATCCTCTATGT-
CAACATCTCGAGATGTTGACATAGAGGATTTCGTTTTT) and
TRCN0000001041 (clone ID, NM_021913.x-2151s1c1; sequence,
CCGGGCTGTGAAGACGATGAAGATTCTCGAGAATCTT-
CATCGTCTTCACAGCTTTTT). The nonspecific shLuciferase had the
sequence CCGGCGCTGAGTACTTCGAAATGTCCTCGAGGA-
CATTTCGAAGTACTCAGCGTTTTT (#SHC007). For the single-cell
motility and gap closure assays, cells were seeded in complete medium
and the experiments were carried out as described.
Soft agar assay
Cells (106
) from shAXL clones and control of SKOV3 and OVCA429
were seeded in a six-well plate using a previously established protocol.
The anoikis-resistant cells formed colonies on the soft agar and were
visualized on day 14.
Spheroid invasion assay
Cells (5000) from shAXL clones and control of SKOV3 and OVCA429
were seeded in a Cultrex 96-well kit (3-D Spheroid BME Cell Invasion
Assay; #3500-096-K, Trevigen), and the assay was performed following
the manufacturer’s protocol. Cell invasion was monitored over time,
and optimal results were documents on day 3.
SKOV3 orthotopic xenograft mouse model
The SKOV3 orthotopic xenograft model was established by GenScript.
The procedures involving the care and use of animals were reviewed
and approved by the Institutional Animal Care and Use Committee
to ensure compliance with the regulations of the Association for Assess-
ment and Accreditation of Laboratory Animal Care. Five 6-week-old
female SCID-Beige mice were used per condition and inoculated by in-
traperitoneal injection with a single volume of 200 ml of cell suspension
with 5 × 106
cells to establish SKOV3 shLuciferase control, shAXL#40,
and shAXL#41 ovarian cancer models. The study was concluded 4 weeks
after injection of cells, and the number of tumors and tumor mass was
assessed in each mouse using calibrated calipers. Tumor volume was
calculated using the formula width2
× length × 0.5.
Gene expression analysis and AXL signature
Gene expression data were extracted from previously processed meta-
analysis of 1538 ovarian cancer (3). To derive the AXL signature, genes
that are most strongly and positively correlated with AXL gene expres-
sion (Rho > +0.45) were selected.
Statistical analysis
Statistical analyses were conducted using MATLAB R2012a version
7.14.0.739 and statistics toolbox version 8.0 (MathWorks). Statistical
significance of differential expression was evaluated using either Student’s
t test or Mann-Whitney U test. A Spearman correlation coefficient test
was applied to assess significance of correlation. Kaplan-Meier analyses

were conducted using GraphPad Prism version 5.04 (GraphPad Soft-
ware). Statistical significance of the Kaplan-Meier analysis was cal-
culated by log-rank test. To perform Kaplan-Meier analysis of overall
and disease-free survival for AXL signature in various cancers, stratifi-
cation of patients was based on AXL signature score, which segregates
patients into AXL-high and AXL-low groups referring to median score,
or AXL-Q1 and AXL-Q4 referring to lowest 25% and highest 25% sig-
nature scores, respectively.
SUPPLEMENTARY MATERIALS
www.sciencesignaling.org/cgi/content/full/9/448/ra97/DC1
Fig. S1. AXL rank and expression in GEMS and EMT phenotype.
Fig. S2. AXL signaling in GEMS has divergent biological consequences.
Fig. S3. GAS6-AXL signaling relies on MEK-ERK pathway to promote motility in Mes-subtype
tumor cells.
Fig. S4. Epi-A cells show membrane modulation of AXL-RTK networks and DUSP4 regulation of
the pERK response.
Fig. S5. Mes- subtype cells are more sensitive to AXL-specific inhibition.
Fig. S6. AXL mediates the phenotypic transitions of EMT.
Fig. S7. The AXL gene signature is enriched in Mes-subtype tumors and correlates with worse
prognosis in patients.
Fig. S8. Full-length blots.
Table S1. High AXL expression predicts poor prognosis in ovarian cancer in multivariate
analysis.
Table S2. High AXL expression predicts poor prognosis in ovarian cancer even when
accounting for the effect arising from the GEMS.
Table S3. The AXL gene signature is prognostically relevant in ovarian cancer.
REFERENCES AND NOTES
1. R. W. Tothill, A. V. Tinker, J. George, R. Brown, S. B. Fox, S. Lade, D. S. Johnson, M. K. Trivett,
D. Etemadmoghadam, B. Locandro, N. Traficante, S. Fereday, J. A. Hung, Y.-E. Chiew,
I. Haviv; Australian Ovarian Cancer Study Group, D. Gertig, A. deFazio, D. D. L. Bowtell,
Novel molecular subtypes of serous and endometrioid ovarian cancer linked to clinical
outcome. Clin. Cancer Res. 14, 5198–5208 (2008).
2. Cancer Genome Atlas Research Network, Integrated genomic analyses of ovarian
carcinoma. Nature 474, 609–615 (2011).
3. T. Z. Tan, Q. H. Miow, R. Y.-J. Huang, M. K. Wong, J. Ye, J. A. Lau, M. C. Wu,
L. H. Bin Abdul Hadi, R. Soong, M. Choolani, B. Davidson, J. M. Nesland, L.-Z. Wang,
N. Matsumura, M. Mandai, I. Konishi, B.-C. Goh, J. T. Chang, J. P. Thiery, S. Mori,
Functional genomics identifies five distinct molecular subtypes with clinical relevance
and pathways for growth control in epithelial ovarian cancer. EMBO Mol. Med. 5, 983–998
(2013).
4. A. Helland, M. S. Anglesio, J. George, P. A. Cowin, C. N. Johnstone, C. M. House,
K. E. Sheppard, D. Etemadmoghadam, N. Melnyk, A. K. Rustgi, W. A. Phillips, H. Johnsen,
R. Holm, G. B. Kristensen, M. J. Birrer; Australian Ovarian Cancer Study Group,
R. B. Pearson, A.-L. Børresen-Dale, D. G. Huntsman, A. deFazio, C. J. Creighton, G. K. Smyth,
D. D. L. Bowtell, Deregulation of MYCN, LIN28B and LET7 in a molecular subtype of
aggressive high-grade serous ovarian cancers. PLOS ONE 6, e18064 (2011).
5. M. Asad, M. K. Wong, T. Z. Tan, M. Choolani, J. Low, S. Mori, D. Virshup, J. P. Thiery,
R. Y.-J. Huang, FZD7 drives in vitro aggressiveness in Stem-A subtype of
ovarian cancer via regulation of non-canonical Wnt/PCP pathway. Cell Death Dis.
5, e1346 (2014).
6. J. P. Thiery, H. Acloque, R. Y. J. Huang, M. A. Nieto, Epithelial-mesenchymal transitions in
development and disease. Cell 139, 871–890 (2009).
7. V. Y. Chung, T. Z. Tan, M. Tan, M. K. Wong, K. T. Kuay, Z. Yang, J. Ye, J. Muller,
C. M. Koh, E. Guccione, J. P. Thiery, R. Y.-J. Huang, GRHL2-miR-200-ZEB1 maintains
the epithelial status of ovarian cancer through transcriptional regulation and histone
modification. Sci. Rep. 6, 19943 (2016).
8. R. M. A. Linger, A. K. Keating, H. S. Earp, D. K. Graham, TAM receptor tyrosine kinases:
Biologic functions, signaling, and potential therapeutic targeting in human cancer.
Adv. Cancer Res. 100, 35–83 (2008).
9. S. Goruppi, E. Ruaro, C. Schneider, Gas6, the ligand of Axl tyrosine kinase receptor, has
mitogenic and survival activities for serum starved NIH3T3 fibroblasts. Oncogene 12,
471–480 (1996).
10. C. Gjerdrum, C. Tiron, T. Høiby, I. Stefansson, H. Haugen, T. Sandal, K. Collett,
S. Li, E. McCormack, B. T. Gjertsen, D. R. Micklem, L. A. Akslen, C. Glackin, J. B. Lorens,
Axl is an essential epithelial-to-mesenchymal transition-induced regulator of breast
cancer metastasis and patient survival. Proc. Natl. Acad. Sci. U.S.A. 107, 1124–1129
(2010).
11. M. Ishikawa, M. Sonobe, E. Nakayama, M. Kobayashi, R. Kikuchi, J. Kitamura, N. Imamura,
H. Date, Higher expression of receptor tyrosine kinase Axl, and differential expression of
its ligand, Gas6, predict poor survival in lung adenocarcinoma patients. Ann. Surg. Oncol.
20 (Suppl. 3), S467–S476 (2013).
12. S. J. Holland, A. Pan, C. Franci, Y. Hu, B. Chang, W. Li, M. Duan, A. Torneros, J. Yu,
T. J. Heckrodt, J. Zhang, P. Ding, A. Apatira, J. Chua, R. Brandt, P. Pine, D. Goff, R. Singh,
D. G. Payan, Y. Hitoshi, R428, a selective small molecule inhibitor of Axl kinase, blocks
tumor spread and prolongs survival in models of metastatic breast cancer. Cancer Res. 70,
1544–1554 (2010).
13. X. Song, H. Wang, C. D. Logsdon, A. Rashid, J. B. Fleming, J. L. Abbruzzese, H. F. Gomez,
D. B. Evans, H. Wang, Overexpression of receptor tyrosine kinase Axl promotes
tumor cell invasion and survival in pancreatic ductal adenocarcinoma. Cancer 117,
734–743 (2011).
14. Z. Zhang, J. C. Lee, L. Lin, V. Olivas, V. Au, T. LaFramboise, M. Abdel-Rahman,
X. Wang, A. D. Levine, J. K. Rho, Y. J. Choi, C.-M. Choi, S.-W. Kim, S. J. Jang, Y. S. Park,
W. S. Kim, D. H. Lee, J.-S. Lee, V. A. Miller, M. Arcila, M. Ladanyi, P. Moonsamy,
C. Sawyers, T. J. Boggon, P. C. Ma, C. Costa, M. Taron, R. Rosell, B. Halmos, T. G. Bivona,
Activation of the AXL kinase causes resistance to EGFR-targeted therapy in lung
cancer. Nat. Genet. 44, 852–860 (2012).
15. L. A. Byers, L. Diao, J. Wang, P. Saintigny, L. Girard, M. Peyton, L. Shen, Y. Fan, U. Giri,
P. K. Tumula, M. B. Nilsson, J. Gudikote, H. Tran, R. J. G. Cardnell, D. J. Bearss, S. L. Warner,
J. M. Foulks, S. B. Kanner, V. Gandhi, N. Krett, S. T. Rosen, E. S. Kim, R. S. Herbst,
G. R. Blumenschein, J. J. Lee, S. M. Lippman, K. K. Ang, G. B. Mills, W. K. Hong,
J. N. Weinstein, I. I. Wistuba, K. R. Coombes, J. D. Minna, J. V. Heymach, An
epithelial–mesenchymal transition gene signature predicts resistance to EGFR
and PI3K inhibitors and identifies Axl as a therapeutic target for overcoming EGFR
inhibitor resistance. Clin. Cancer Res. 19, 279–290 (2013).
16. M. Elkabets, E. Pazarentzos, D. Juric, Q. Sheng, R. A. Pelossof, S. Brook,
A. O. Benzaken, J. Rodon, N. Morse, J. J. Yan, M. Liu, R. Das, Y. Chen, A. Tam, H. Wang,
J. Liang, J. M. Gurski, D. A. Kerr, R. Rosell, C. Teixidó, A. Huang, R. A. Ghossein,
N. Rosen, T. G. Bivona, M. Scaltriti, J. Baselga, AXL mediates resistance to PI3Ka inhibition
by activating the EGFR/PKC/mTOR axis in head and neck and esophageal squamous
cell carcinomas. Cancer Cell 27, 533–546 (2015).
17. D. K. Graham, D. DeRyckere, K. D. Davies, H. S. Earp, The TAM family: Phosphatidylserine-
sensing receptor tyrosine kinases gone awry in cancer. Nat. Rev. Cancer 14, 769–785
(2014).
18. E. B. Rankin, K. C. Fuh, T. E. Taylor, A. J. Krieg, M. Musser, J. Yuan, K. Wei, C. J. Kuo,
T. A. Longacre, A. J. Giaccia, AXL is an essential factor and therapeutic target for
metastatic ovarian cancer. Cancer Res. 70, 7570–7579 (2010).
19. C. Sotiriou, L. Pusztai, Gene-expression signatures in breast cancer. N. Engl. J. Med. 360,
790–800 (2009).
20. D. Yang, Y. Sun, L. Hu, H. Zheng, P. Ji, C. V. Pecot, Y. Zhao, S. Reynolds, H. Cheng,
R. Rupaimoole, D. Cogdell, M. Nykter, R. Broaddus, C. Rodriguez-Aguayo,
G. Lopez-Berestein, J. Liu, I. Shmulevich, A. K. Sood, K. Chen, W. Zhang, Integrated
analyses identify a master microRNA regulatory network for the mesenchymal subtype in
serous ovarian cancer. Cancer Cell 23, 186–199 (2013).
21. H. S. Leong, L. Galletta, D. Etemadmoghadam, J. George; Australian Ovarian Cancer
Study, M. Köbel, S. J. Ramus, D. Bowtell, Efficient molecular subtype classification of
high-grade serous ovarian cancer. J. Pathol. 236, 272–277 (2015).
22. R. Y.-J. Huang, M. K. Wong, T. Z. Tan, K. T. Kuay, A. H. C. Ng, V. Y. Chung, Y.-S. Chu,
N. Matsumura, H.-C. Lai, Y. F. Lee, W.-J. Sim, C. Chai, E. Pietschmann, S. Mori, J. J. H. Low,
M. Choolani, J. P. Thiery, An EMT spectrum defines an anoikis-resistant and
spheroidogenic intermediate mesenchymal state that is sensitive to e-cadherin
restoration by a src-kinase inhibitor, saracatinib (AZD0530). Cell Death Dis. 4, e915
(2013).
23. C. J. Marshall, Specificity of receptor tyrosine kinase signaling: Transient versus sustained
extracellular signal-regulated kinase activation. Cell 80, 179–185 (1995).
24. B. N. Kholodenko, J. F. Hancock, W. Kolch, Signalling ballet in space and time. Nat. Rev.
Mol. Cell Biol. 11, 414–426 (2010).
25. T. Sawabu, H. Seno, T. Kawashima, A. Fukuda, Y. Uenoyama, M. Kawada, N. Kanda,
A. Sekikawa, H. Fukui, M. Yanagita, H. Yoshibayashi, S. Satoh, Y. Sakai, T. Nakano, T. Chiba,
Growth arrest-specific gene 6 and Axl signaling enhances gastric cancer cell survival via
Akt pathway. Mol. Carcinog. 46, 155–164 (2007).
26. K. Rea, P. Pinciroli, M. Sensi, F. Alciato, B. Bisaro, L. Lozneanu, F. Raspagliesi, F. Centritto,
S. Cabodi, P. Defilippi, G. C. Avanzi, S. Canevari, A. Tomassetti, Novel Axl-driven
signaling pathway and molecular signature characterize high-grade ovarian cancer
patients with poor clinical outcome. Oncotarget 6, 30859–30875 (2015).
27. E. Vial, C. J. Marshall, Elevated ERK-MAP kinase activity protects the FOS family member
FRA-1 against proteasomal degradation in colon carcinoma cells. J. Cell Sci. 116,
4957–4963 (2003).

28. L. Bakiri, S. Macho-Maschler, I. Custic, J. Niemiec, A. Guío-Carrión, S. C. Hasenfuss,
A. Eger, M. Müller, H. Beug, E. F. Wagner, Fra-1/AP-1 induces EMT in mammary
epithelial cells by modulating Zeb1/2 and TGFb expression. Cell Death Differ. 22,
336–350 (2015).
29. K.-N. Chua, W.-J. Sim, V. Racine, S.-Y. Lee, B. C. Goh, J. P. Thiery, A cell-based small
molecule screening method for identifying inhibitors of epithelial-mesenchymal
transition in carcinoma. PLOS ONE 7, e33183 (2012).
30. E. J. Morris, S. Jha, C. R. Restaino, P. Dayananth, H. Zhu, A. Cooper, D. Carr, Y. Deng, W. Jin,
S. Black, B. Long, J. Liu, E. Dinunzio, W. Windsor, R. Zhang, S. Zhao, M. H. Angagaw,
E. M. Pinheiro, J. Desai, L. Xiao, G. Shipps, A. Hruza, J. Wang, J. Kelly, S. Paliwal, X. Gao,
B. S. Babu, L. Zhu, P. Daublain, L. Zhang, B. A. Lutterbach, M. R. Pelletier, U. Philippar,
P. Siliphaivanh, D. Witter, P. Kirschmeier, W. R. Bishop, D. Hicklin, D. G. Gilliland,
L. Jayaraman, L. Zawel, S. Fawell, A. A. Samatar, Discovery of a novel ERK inhibitor with
activity in models of acquired resistance to BRAF and MEK inhibitors. Cancer Discov. 3,
742–750 (2013).
31. J. Yang, S. A. Mani, J. L. Donaher, S. Ramaswamy, R. A. Itzykson, C. Come, P. Savagner,
I. Gitelman, A. Richardson, R. A. Weinberg, Twist, a master regulator of morphogenesis,
plays an essential role in tumor metastasis. Cell 117, 927–939 (2004).
32. A. S. Meyer, A. J. M. Zweemer, D. A. Lauffenburger, The AXL receptor is a sensor of ligand
spatial heterogeneity. Cell Syst. 1, 25–36 (2015).
33. K. Simons, E. Ikonen, Functional rafts in cell membranes. Nature 387, 569–572
(1997).
34. N. L. G. Sieben, J. Oosting, A. M. Flanagan, J. Prat, G. M. J. M. Roemen, S. M. Kolkman-Uljee,
R. van Eijk, C. J. Cornelisse, G. J. Fleuren, M. van Engeland, Differential gene expression in
ovarian tumors reveals Dusp 4 and Serpina 5 as key regulators for benign behavior of
serous borderline tumors. J. Clin. Oncol. 23, 7257–7264 (2005).
35. T. Z. Tan, Q. H. Miow, Y. Miki, T. Noda, S. Mori, R. Y.-J. Huang, J. P. Thiery, Epithelial-
mesenchymal transition spectrum quantification and its efficacy in deciphering
survival and drug responses of cancer patients. EMBO Mol. Med. 6, 1279–1293
(2014).
36. A. S. Brodsky, A. Fischer, D. H. Miller, S. Vang, S. MacLaughlan, H.-T. Wu, J. Yu, M. Steinhoff,
C. Collins, P. J. S. Smith, B. J. Raphael, L. Brard, Expression profiling of primary and
metastatic ovarian tumors reveals differences indicative of aggressive disease. PLOS ONE
9, e94476 (2014).
37. S. Marchini, R. Fruscio, L. Clivio, L. Beltrame, L. Porcu, I. Fuso Nerini, D. Cavalieri,
G. Chiorino, G. Cattoretti, C. Mangioni, R. Milani, V. Torri, C. Romualdi, A. Zambelli,
M. Romano, M. Signorelli, S. di Giandomenico, M. D’Incalci, Resistance to platinum-based
chemotherapy is associated with epithelial to mesenchymal transition in epithelial
ovarian cancer. Eur. J. Cancer 49, 520–530 (2013).
38. T. Z. Tan, H. Yang, J. Ye, J. Low, M. Choolani, D. S. P. Tan, J.-P. Thiery, R. Y.-J. Huang,
CSIOVDB: A microarray gene expression database of epithelial ovarian cancer subtype.
Oncotarget 6, 43843–43852 (2015).
39. J. P. O’Bryan, R. A. Frye, P. C. Cogswell, A. Neubauer, B. Kitch, C. Prokop, R. Espinosa III,
M. M. Le Beau, H. S. Earp, E. T. Liu, axl, a transforming gene isolated from primary human
myeloid leukemia cells, encodes a novel receptor tyrosine kinase. Mol. Cell. Biol. 11,
5016–5031 (1991).
40. T. S. Gujral, R. L. Karp, A. Finski, M. Chan, P. E. Schwartz, G. MacBeath, P. Sorger, Profiling
phospho-signaling networks in breast cancer using reverse-phase protein arrays.
Oncogene 32, 3470–3476 (2013).
41. L. Liu, J. Greger, H. Shi, Y. Liu, J. Greshock, R. Annan, W. Halsey, G. M. Sathe, A.-M. Martin,
T. M. Gilmer, Novel mechanism of lapatinib resistance in HER2-positive breast tumor cells:
Activation of AXL. Cancer Res. 69, 6871–6878 (2009).
42. A. S. Meyer, M. A. Miller, F. B. Gertler, D. A. Lauffenburger, The receptor AXL diversifies
EGFR signaling and limits the response to EGFR-targeted inhibitors in triple-negative
breast cancer cells. Sci. Signal. 6, ra66 (2013).
43. L. Cerchia, C. L. Esposito, S. Camorani, A. Rienzo, L. Stasio, L. Insabato, A. Affuso,
V. de Franciscis, Targeting Axl with an high-affinity inhibitory aptamer. Mol. Ther. 20,
2291–2303 (2012).
44. X. Ye, Y. Li, S. Stawicki, S. Couto, J. Eastham-Anderson, D. Kallop, R. Weimer, Y. Wu, L. Pei,
An anti-Axl monoclonal antibody attenuates xenograft tumor growth and enhances the
effect of multiple anticancer therapies. Oncogene 29, 5254–5264 (2010).
45. W. Leconet, C. Larbouret, T. Chardès, G. Thomas, M. Neiveyans, M. Busson, M. Jarlier,
N. Radosevic-Robin, M. Pugnière, F. Bernex, F. Penault-Llorca, J.-M. Pasquet, A. Pèlegrin,
B. Robert, Preclinical validation of AXL receptor as a target for antibody-based pancreatic
cancer immunotherapy. Oncogene 33, 5405–5414 (2014).
46. E. Vial, E. Sahai, C. J. Marshall, ERK-MAPK signaling coordinately regulates activity of Rac1
and RhoA for tumor cell motility. Cancer Cell 4, 67–79 (2003).
47. H.-J. Lee, Y.-M. Jeng, Y.-L. Chen, L. Chung, R.-H. Yuan, Gas6/Axl pathway promotes tumor
invasion through the transcriptional activation of Slug in hepatocellular carcinoma.
Carcinogenesis 35, 769–775 (2014).
48. S. Shin, J. Blenis, ERK2/Fra1/ZEB pathway induces epithelial-to-mesenchymal transition.
Cell Cycle 9, 2483–2484 (2010).
49. C. Wilson, X. Ye, T. Pham, E. Lin, S. Chan, E. McNamara, R. M. Neve, L. Belmont,
H. Koeppen, R. L. Yauch, A. Ashkenazi, J. Settleman, AXL inhibition sensitizes
mesenchymal cancer cells to antimitotic drugs. Cancer Res. 74, 5878–5890 (2014).
50. F. Wu, J. Li, C. Jang, J. Wang, J. Xiong, The role of Axl in drug resistance and epithelial-to-
mesenchymaltransitionofnon-smallcelllungcarcinoma.Int.J.Clin.Exp.Pathol.7,6653–6661(2014).
51. J. K. Rho, Y. J. Choi, S. Y. Kim, T. W. Kim, E. K. Choi, S.-J. Yoon, B. M. Park, E. Park, J. H. Bae,
C.-M. Choi, J. C. Lee, MET and AXL inhibitor NPS-1034 exerts efficacy against lung cancer
cells resistant to EGFR kinase inhibitors because of MET or AXL activation. Cancer Res. 74,
253–262 (2014).
52. M. F. Burbridge, C. J. Bossard, C. Saunier, I. Fejes, A. Bruno, S. Léonce, G. Ferry,
G. Da Violante, F. Bouzom, V. Cattan, A. Jacquet-Bescond, P. M. Comoglio, B. P. Lockhart,
J. A. Boutin, A. Cordi, J.-C. Ortuno, A. Pierré, J. A. Hickman, F. H. Cruzalegui, S. Depil,
S49076 is a novel kinase inhibitor of MET, AXL, and FGFR with strong preclinical activity
alone and in association with bevacizumab. Mol. Cancer Ther. 12, 1749–1762 (2013).
53. X. Wu, X. Liu, S. Koul, C. Y. Lee, Z. Zhang, B. Halmos, AXL kinase as a novel target for
cancer therapy. Oncotarget 5, 9546–9563 (2014).
54. R. A. Okimoto, T. G. Bivona, AXL receptor tyrosine kinase as a therapeutic target in NSCLC.
Lung Cancer Targets and Ther. 2015, 27–34 (2015).
55. M. S. Kariolis, Y. R. Miao, D. S. Jones II, S. Kapur, I. I. Mathews, A. J. Giaccia, J. R. Cochran, An
engineered Axl ‘decoy receptor’ effectively silences the Gas6-Axl signaling axis. Nat.
Chem. Biol. 10, 977–983 (2014).
56. D. H. Ausprunk, D. R. Knighton, J. Folkman, Vascularization of normal and neoplastic
tissues grafted to the chick chorioallantois. Role of host and preexisting graft blood
vessels. Am. J. Pathol. 79, 597–618 (1975).
Funding: This work was supported by the National Research Foundation Singapore and
the Singapore Ministry of Education under its Research Centres of Excellence initiative to J.P.T.,
and the National Medical Research Council under its Centre Grant scheme to the National
University Cancer Institute under the EMT Theme to J.P.T. and R.Y.-J.H. Author contributions:
H.G., C.R., J.P.T., and R.Y.-J.H. devised the project, and H.G., J.P.T., and R.Y.-J.H. obtained
funding; J.A., T.Z.T., C.R., and R.Y.-J.H. wrote the paper; J.A. performed all the experiments;
T.Z.T. performed bioinformatics analyses; Z.K. performed the CAM assays; and J.L. and
M.C. provided clinical samples. Competing interests: The authors declare that they
have no competing interests.
Submitted 4 April 2016
Accepted 13 September 2016
Published 4 October 2016
10.1126/scisignal.aaf8175
Citation: J. Antony, T. Z. Tan, Z. Kelly, J. Low, M. Choolani, C. Recchi, H. Gabra, J. P. Thiery,
R. Y.-J. Huang, The GAS6-AXL signaling network is a mesenchymal (Mes) molecular
subtype–specific therapeutic target for ovarian cancer. Sci. Signal. 9, ra97 (2016).

(448), ra97. [doi: 10.1126/scisignal.aaf8175]9Science Signaling
Yun-Ju Huang (October 4, 2016)
Choolani, Chiara Recchi, Hani Gabra, Jean Paul Thiery and Ruby
Jane Antony, Tuan Zea Tan, Zoe Kelly, Jeffrey Low, Mahesh
cancer
specific therapeutic target for ovarian−molecular subtype
The GAS6-AXL signaling network is a mesenchymal (Mes)
This information is current as of October 5, 2016.
The following resources related to this article are available online at http://stke.sciencemag.org.
Article Tools
http://stke.sciencemag.org/content/9/448/ra97
article tools:
Visit the online version of this article to access the personalization and
Materials
Supplemental
http://stke.sciencemag.org/content/suppl/2016/09/30/9.448.ra97.DC1
"Supplementary Materials"
Related Content
http://stke.sciencemag.org/content/sigtrans/6/287/ra66.full
http://stke.sciencemag.org/content/sigtrans/9/448/fs14.full
's sites:ScienceThe editors suggest related resources on
References
http://stke.sciencemag.org/content/9/448/ra97#BIBL
This article cites 56 articles, 16 of which you can access for free at:
Permissions
http://www.sciencemag.org/about/permissions.dtl
Obtain information about reproducing this article:
reserved.
DC 20005. Copyright 2016 by the American Association for the Advancement of Science; all rights
American Association for the Advancement of Science, 1200 New York Avenue, NW, Washington,
(ISSN 1937-9145) is published weekly, except the last December, by theScience Signaling

The GAS6-AXL signaling network is a mesenchymal (Mes) molecular subtype–specific therapeutic target for ovarian cancer

More Related Content

What's hot (17)

Similar to The GAS6-AXL signaling network is a mesenchymal (Mes) molecular subtype–specific therapeutic target for ovarian cancer (9)

The GAS6-AXL signaling network is a mesenchymal (Mes) molecular subtype–specific therapeutic target for ovarian cancer