The Zebrafish Genetics Genomics and Transcriptomics 4th Edition H. William Detrich

Visit https://ebookultra.com to download the full version and
explore more ebooks
The Zebrafish Genetics Genomics and
Transcriptomics 4th Edition H. William Detrich
_____ Click the link below to download _____
https://ebookultra.com/download/the-zebrafish-genetics-
genomics-and-transcriptomics-4th-edition-h-william-
detrich/
Explore and download more ebooks at ebookultra.com

Here are some suggested products you might be interested in.
Click the link to download
The Zebrafish Genetics Genomics and Informatics 3rd
Edition H. William Detrich
https://ebookultra.com/download/the-zebrafish-genetics-genomics-and-
informatics-3rd-edition-h-william-detrich/
The Zebrafish Disease Models and Chemical Screens 3rd
Edition H. William Detrich
https://ebookultra.com/download/the-zebrafish-disease-models-and-
chemical-screens-3rd-edition-h-william-detrich/
Cardiovascular Genetics and Genomics 1st Edition Dan M.
Roden
https://ebookultra.com/download/cardiovascular-genetics-and-
genomics-1st-edition-dan-m-roden/
Encyclopedia of Genetics Genomics Proteomics and
Bioinformatics 1st Edition Michael J. Dunn
https://ebookultra.com/download/encyclopedia-of-genetics-genomics-
proteomics-and-bioinformatics-1st-edition-michael-j-dunn/

Quantitative Genetics Genomics and Plant Breeding Cabi
First Edition M S Kang
https://ebookultra.com/download/quantitative-genetics-genomics-and-
plant-breeding-cabi-first-edition-m-s-kang/
Genetics Genomics and Breeding of Cucurbits 1st Edition
Yi-Hong Wang (Editor)
https://ebookultra.com/download/genetics-genomics-and-breeding-of-
cucurbits-1st-edition-yi-hong-wang-editor/
Genetics Genomics and Breeding of Grapes 1st Edition Anne-
Francoise Adam-Blondon
https://ebookultra.com/download/genetics-genomics-and-breeding-of-
grapes-1st-edition-anne-francoise-adam-blondon/
Flax Lipids Classes Biosynthesis Genetics and the Promise
of Applied Genomics for Understanding and Altering of
Fatty Acids Classes Biosynthesis Genetics and the Promise
of Applied Genomics for Understanding and Altering of
Fatty Acids 1st Edition Bourlaye Fofana
https://ebookultra.com/download/flax-lipids-classes-biosynthesis-
genetics-and-the-promise-of-applied-genomics-for-understanding-and-
altering-of-fatty-acids-classes-biosynthesis-genetics-and-the-promise-
of-applied-genomics-for-unders/
Emery and Rimoin s Principles and Practice of Medical
Genetics and Genomics Foundations Reed E Pyeritz
https://ebookultra.com/download/emery-and-rimoin-s-principles-and-
practice-of-medical-genetics-and-genomics-foundations-reed-e-pyeritz/

The Zebrafish Genetics Genomics and Transcriptomics
4th Edition H. William Detrich Digital Instant Download
Author(s): H. WilliamDetrich, Monte Westerfield and Leonard I. Zon (Eds.)
ISBN(s): 9780128034743, 0128034742
Edition: 4
File Details: PDF, 20.70 MB
Year: 2016
Language: english

Methods in Cell
Biology
The Zebrafish: Genetics,
Genomics, and Transcriptomics
Volume 135

Series Editors
Leslie Wilson
Department of Molecular, Cellular and Developmental Biology
University of California
Santa Barbara, California
Phong Tran
University of Pennsylvania
Philadelphia, USA &
Institut Curie, Paris, France

Methods in Cell
Biology
The Zebrafish: Genetics,
Genomics, and Transcriptomics
Volume 135
Edited by
H. William Detrich, III
Northeastern University Marine Science Center,
Nahant, MA, United States
Monte Westerfield
University of Oregon, Eugene, OR, United States
Leonard I. Zon
Harvard University, Boston, MA, United States
AMSTERDAM • BOSTON • HEIDELBERG • LONDON
NEW YORK • OXFORD • PARIS • SAN DIEGO
SAN FRANCISCO • SINGAPORE • SYDNEY • TOKYO
Academic Press is an imprint of Elsevier

Academic Press is an imprint of Elsevier
50 Hampshire Street, 5th Floor, Cambridge, MA 02139, USA
525 B Street, Suite 1800, San Diego, CA 92101-4495, USA
125 London Wall, London EC2Y 5AS, UK
The Boulevard, Langford Lane, Kidlington, Oxford OX5 1GB, UK
Fourth edition 2016
Copyright © 2016, 2011, 2004, 1999 Elsevier Inc. All rights reserved.
No part of this publication may be reproduced or transmitted in any form or by any means,
electronic or mechanical, including photocopying, recording, or any information storage
and retrieval system, without permission in writing from the publisher. Details on how to
seek permission, further information about the Publisher’s permissions policies and our
arrangements with organizations such as the Copyright Clearance Center and the
Copyright Licensing Agency, can be found at our website: www.elsevier.com/permissions.
This book and the individual contributions contained in it are protected under copyright by
the Publisher (other than as may be noted herein).
Notices
Knowledge and best practice in this field are constantly changing. As new research and
experience broaden our understanding, changes in research methods, professional
practices, or medical treatment may become necessary.
Practitioners and researchers must always rely on their own experience and knowledge in
evaluating and using any information, methods, compounds, or experiments described
herein. In using such information or methods they should be mindful of their own safety
and the safety of others, including parties for whom they have a professional responsibility.
To the fullest extent of the law, neither the Publisher nor the authors, contributors, or
editors, assume any liability for any injury and/or damage to persons or property as a
matter of products liability, negligence or otherwise, or from any use or operation of any
methods, products, instructions, or ideas contained in the material herein.
ISBN: 978-0-12-803474-3
ISSN: 0091-679X
For information on all Academic Press publications
visit our website at https://www.elsevier.com
Publisher: Zoe Kruze
Acquisition Editor: Zoe Kruze
Editorial Project Manager: Sarah Lay
Production Project Manager: Malathi Samayan
Designer: Victoria Pearson
Typeset by TNQ Books and Journals

Len, Monte, and I dedicate the 4th
Edition of Methods in Cell Biology:
The Zebrafish to the postdoctoral fellows and graduate students
who conducted the genetic screens that established the zebrafish as a
preeminent vertebrate model system for analysis of development.

Contributors
J. Ablain
Howard Hughes Medical Institute and Harvard Medical School, Boston, MA,
United States
K. Asakawa
SOKENDAI (The Graduate University for Advanced Studies), Mishima,
Shizuoka, Japan
H. Ata
Mayo Clinic, Rochester, MN, United States
J. Bakkers
Hubrecht Institute and University Medical Centre Utrecht, Utrecht, The
Netherlands
J. Bessa
IBMC-Instituto de Biologia Molecular e Celular, Porto, Portugal; Universidade do
Porto, Porto, Portugal
Y.M. Bradford
B.R. Cairns
University of Utah School of Medicine, Salt Lake City, UT, United States
W. Chen
Vanderbilt University School of Medicine, Nashville, TN, United States
J. Cibelli
Michigan State University, East Lansing, MI, United States; BIONAND,
Andalucı́a, Spain
K.J. Clark
P. Coucke
Ghent University, Ghent, Belgium
V.T. Cunliffe
University of Sheffield, Sheffield, United Kingdom
F. Del Bene
PSL Research University, Paris, France
xvii

A. De Paepe
F. De Santis
V. Di Donato
A. Eagle
S.C. Ekker
T. Erickson
Oregon Health & Science University, Portland, OR, United States
T. Evans
Weill Cornell Medical College, New York, NY, United States
D. Fashena
A. Felker
University of Zürich, Zürich, Switzerland
A. Fernández-Miñán
Centro Andaluz de Biologı́a del Desarrollo (CABD), Consejo Superior de
Investigaciones Cientı́ficas/Universidad Pablo de Olavide/Junta de Andalucı́a,
Sevilla, Spain
K. Frazer
A. Ghosha
Carnegie Institution for Science, Baltimore, MD, United States
M.G. Goll
Memorial Sloan Kettering Cancer Center, New York, NY, United States
J.L. Gómez-Skarmeta
Sevilla, Spain
a
Current address: Tata Institute of Fundamental Research, Mumbai, India
xviii Contributors

D.J. Grunwald
University of Utah, Salt Lake City, UT, United States
M.E. Halpern
Carnegie Institution for Science, Baltimore, MD, United States
J.K. Heath
Walter and Eliza Hall Institute of Medical Research, Parkville, VIC, Australia
K. Hoshijima
D.G. Howe
H. Huang
University of California Los Angeles, Los Angeles, CA, United States
J.P. Junker
Hubrecht Institute and University Medical Centre Utrecht, Utrecht, The
Netherlands
M.J. Jurynec
P. Kalita
K. Kawakami
SOKENDAI (The Graduate University for Advanced Studies), Mishima, Shizuoka,
Japan
M.C. Keightley
Australian Regenerative Medicine Institute, Clayton, VIC, Australia; Monash
University, Clayton, VIC, Australia
F. Kruse
Hubrecht Institute and University Medical Centre Utrecht, Utrecht,
The Netherlands
C. Lawrence
Boston Children’s Hospital, Boston, MA, United States
S. Lefever
C. Li
Memorial Sloan Kettering Cancer Center, New York, NY, United States; Weill
Cornell Graduate School of Medical Sciences, New York, NY, United States
Contributors xix

G.J. Lieschke
Australian Regenerative Medicine Institute, Clayton, VIC, Australia; Monash
University, Clayton, VIC, Australia
S. Lin
University of California Los Angeles, Los Angeles, CA, United States
C.G. Love
Walter and Eliza Hall Institute of Medical Research, Parkville, VIC, Australia;
University of Melbourne, Parkville, VIC, Australia
L.A. Maddison
P. Mani
S. Markmiller
University of California San Diego, La Jolla, CA, United States
R. Martin
S. Masuda
Tokyo Institute of Technology, Yokohama, Japan
A.C. Miller
C.B. Moens
Fred Hutchinson Cancer Research Center, Seattle, WA, United States
C. Mosimann
University of Zürich, Zürich, Switzerland
S.T. Moxon
M.C. Mullins
University of Pennsylvania Perelman School of Medicine, Philadelphia, PA,
United States
P.J. Murphy
University of Utah School of Medicine, Salt Lake City, UT,
United States
K.N. Murray
xx Contributors

A. Muto
Shizuoka, Japan
T. Nicolson
Oregon Health & Science University, Portland, OR, United States
C.J. Ott
Dana Farber Cancer Institute, Harvard Stem Cell Institute, Boston, MA,
United States
H. Paddock
F. Pelegri
University of WisconsineMadison, Madison, WI, United States
C. Pich
S. Prukudom
Kasetsart University, Bangkok, Thailand; Center of Excellence on Agricultural
Biotechnology: (AG-BIO/PERDO-CHE), Bangkok, Thailand
S. Ramachandran
J.E.J. Rasko
Centenary Institute, Camperdown, NSW, Australia; University of Sydney,
Sydney, NSW, Australia; Royal Prince Alfred Hospital, Newtown, NSW,
Australia
M.P. Rossmann
Harvard University, Harvard, Cambridge, MA, United States
L. Ruzicka
K. Schaper
A.N. Shah
Fred Hutchinson Cancer Research Center, Seattle, WA, United States
X. Shao
A. Singer
Contributors xxi

K. Siripattarapravat
Kasetsart University, Bangkok, Thailand; Center of Excellence on Agricultural
Biotechnology: (AG-BIO/PERDO-CHE), Bangkok, Thailand
F. Speleman
M. Superdock
Boston Children’s Hospital, Boston, MA, United States; Dana Farber Cancer
Institute, Harvard Stem Cell Institute, Boston, MA, United States; Harvard
Medical School and Howard Hughes Medical Institute, Boston, MA,
United States
M. Tanaka
Tokyo Institute of Technology, Yokohama, Japan
J.J. Tena
Sevilla, Spain
S. Toro
A. van Oudenaarden
Hubrecht Institute and University Medical Centre Utrecht, Utrecht,
The Netherlands
J. Vandesompele
S. Vanhauwaert
C. Van Slyke
Z.M. Varga
H. Wada
Shizuoka, Japan
M. Westerfield
xxii Contributors

A. Willaert
S. Yang
Medical School and Howard Hughes Medical Institute, Boston, MA, United
States
L. Yin
B. Zhang
Peking University, Beijing, People’s Republic of China
Y. Zhang
Peking University Shenzhen Graduate School, Shenzhen, China; University of
California Los Angeles, Los Angeles, CA, United States
Y. Zhou
States; Harvard University, Harvard, Cambridge, MA, United States
L.I. Zon
States; Harvard University, Harvard, Cambridge, MA, United States
Contributors xxiii

Preface
Len, Monte, and I are pleased to introduce the fourth edition of Methods in Cell
Biology: The Zebrafish. The advantages of the zebrafish, Danio rerio, are numerous,
including its short generation time and high fecundity, external fertilization, and the
optical transparency of the embryo. The ease of conducting forward genetic screens
in the zebrafish, based on the pioneering work of George Streisinger, culminated in
screens from the laboratories of Wolfgang Driever, Mark C. Fishman, and Christiane
Nüsslein-Volhard, published in a seminal volume of Development (volume 123,
December 1, 1996) that described a “candy store” of mutants whose phenotypes
spanned the gamut of developmental processes and mechanisms. Life for geneticists
who study vertebrate development became really fine.
Statistics derived from ZFIN (the Zebrafish Model Organism Database; http://zfin.
org) illustrate the dramatic growth of research involving zebrafish. The zebrafish
genome has been sequenced, and as of 2014, more than 25,000 genes have been
placed on the assembly. Greater than 15,500 of these genes have been established
as orthologs of human genes. The zebrafish community has grown from w1,400 re-
searchers in 190 laboratories as of 1998 to w7,000 in 930 laboratories in 2014. The
annual number of publications based on the zebrafish has risen from 1,913 to 21,995
in the same timeframe. Clearly, the zebrafish has arrived as a vertebrate biomedical
model system par excellence.
When we published the first edition (volumes 59 and 60) in 1998, our goal was to
encourage biologists to adopt the zebrafish as a genetically tractable model organism
for studying biological phenomena from the cellular through the organismal. Our
goal today remains unchanged, but the range of subjects and the suite of methods
have expanded rapidly and significantly in sophistication over the years. With the
second and third editions of MCB: The Zebrafish (volumes 76 and 77 in 2004;
volumes 100, 101, 104, and 105 in 2010e11), we documented this extraordinary
growth, again relying on the excellent chapters contributed by our generous col-
leagues in the zebrafish research community.
When Len, Monte, and I began planning the fourth edition, we found that the
zebrafish community had once more developed and refined novel experimental
systems and technologies to tackle challenging biological problems across the
spectrum of the biosciences. We present these methods following the organizational
structure of the third edition, with volumes devoted to Cellular and Developmental
Biology, to Genetics, Genomics, and Transcriptomics, and to Disease Models and
Chemical Screens. Here we introduce the third volume, Genetics, Genomics, and
Transcriptomics.
Genetics, Genomics, and Transcriptomics is divided into five sections that cover
genetic and genomics techniques. Part 1 covers forward and reverse genetics in nine
chapters, many of which employ the revolutionary CRISPR/Cas9 technology in
novel ways. Precision editing of the zebrafish genome through homologous recom-
bination has now become a reality. Part 2 contains five chapters that describe
xxv

advances in transgenesis and functional genomics approaches. Spatially resolved
transcriptomics at the organismal level, cell type-specific transcriptomics, and the
important companion technology, RT-qPCR, are presented in Part 3. We devote
Part 4 to five chapters on the emerging analysis of epigenetic regulation of gene
expression in the zebrafish. Part 5 concludes the volume with four important chap-
ters on zebrafish husbandry, health monitoring, disease prevention, and information
technology.
We anticipate that you, our readership, will apply these methods successfully in
your own zebrafish research programs and will develop your own technical advances
that may be considered for a future edition of Methods in Cell Biology: The Zebra-
fish. The zebrafish is a remarkable experimental systemdthe preeminent vertebrate
model for mechanistic studies of cellular and developmental processes in vivo.
We thank the series editors, Leslie Wilson and Phong Tran, and the staff of
Elsevier/Academic Press, especially Zoe Kruze and Sarah Lay, for their enthusiastic
support of our fourth edition. Their help, patience, and encouragement are pro-
foundly appreciated.
H. William Detrich, III
Monte Westerfield
Leonard I. Zon
xxvi Preface

Multiplex conditional
mutagenesis in zebrafish
using the CRISPR/Cas
system
1
L. Yina
, L.A. Maddisona
, W. Chen1
1
Corresponding author: E-mail: wenbiao.chen@vanderbilt.edu
CHAPTER OUTLINE
Introduction................................................................................................................ 4
1. Methods ................................................................................................................ 5
1.1 Assembly of U6-Based sgRNA Transgenic Constructs................................. 5
1.2 Construction of Cas9 Expression Vectors ................................................... 9
1.3 Screening and Evaluation of Stable sgRNA or Cas9 Transgenic Fish ............ 9
2. Discussion........................................................................................................... 14
Summary .................................................................................................................. 14
Acknowledgments..................................................................................................... 15
References ............................................................................................................... 15
Abstract
The clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-asso-
ciated protein (Cas) system is a powerful tool for genome editing in numerous organisms.
However, the system is typically used for gene editing throughout the entire organism.
Tissue and temporal specific mutagenesis is often desirable to determine gene function in
a specific stage or tissue and to bypass undesired consequences of global mutations. We
have developed the CRISPR/Cas system for conditional mutagenesis in transgenic
zebrafish using tissue-specific and/or inducible expression of Cas9 and U6-driven
expression of sgRNA. To allow mutagenesis of multiple targets, we have isolated four
distinct U6 promoters and designed Golden Gate vectors to easily assemble transgenes
with multiple sgRNAs. We provide experimental details on the reagents and applications
for multiplex conditional mutagenesis in zebrafish.
CHAPTER
a
These authors contributed equally.
Methods in Cell Biology, Volume 135, ISSN 0091-679X, http://dx.doi.org/10.1016/bs.mcb.2016.04.018
© 2016 Elsevier Inc. All rights reserved.
3

INTRODUCTION
The Cas9-based CRISPR system has been widely used to generate mutations in
many organisms including zebrafish (Doudna & Charpentier, 2014; Hsu, Lander,
& Zhang, 2014). The fusion of the native crRNA and tracrRNA as a single guide
RNA (sgRNA) has simplified this three-component system to a two-component
system (Hwang et al., 2013; Jinek et al., 2012). The two components can be deliv-
ered as synthetic RNAs, expression plasmids, or sgRNA-Cas9 protein complexes.
Both the sgRNA and Cas9 RNA can be easily synthesized using in vitro transcrip-
tion. By injecting the two components into zebrafish embryos, a target gene is
recognized by sgRNA and a double-strand break (DSB) is then created by Cas9
endonuclease (Chang et al., 2013; Hwang et al., 2013; Jao, Wente, & Chen,
2013). Repair of the DSB by error-prone nonhomologous end joining or microho-
mology-mediated end joining results in small indels (Doudna & Charpentier, 2014;
Hsu et al., 2014). Exogenous DNA can also be integrated at the DSB through ho-
mology-dependent and homology-independent repairs (Doudna & Charpentier,
2014; Hsu et al., 2014).
Conditional gene inactivation is critical to study gene function in particular
stages or tissues. It is especially necessary when conventional mutations are embry-
onic lethal or have defects in multiple organ systems. Conditional inactivation can
elucidate the function of genes more precisely. In zebrafish, Cre and Flp approaches
have been used to facilitate conditional manipulation of gene expression through
integration of gene-trapping cassettes (Floss & Schnutgen, 2008; Ni et al., 2012;
Schnutgen et al., 2003).
Considering the high mutagenesis efficiency by the CRISPR/Cas9 system in
somatic cells (Jao et al., 2013), we developed a transgenic CRISPR/Cas9 system
in zebrafish to allow for target gene mutagenesis in a conditional manner. Trans-
genic expression of sgRNA allows for longer expression and at later stages than
injection of in vitro synthesized RNA can achieve. The wide range of tissue-spe-
cific promoters, the temporal control of heat shock induction or tetracycline/ecdy-
sone-based methods, or a combination of different systems such as the HOTCre
system can provide a broad potential for tissue and temporal restricted Cas9
expression (Halloran et al., 2000; Hesselson, Anderson, Beinat, & Stainier,
2009; Huang et al., 2005; Knopf et al., 2010; Li, Maddison, Page-McCaw, &
Chen, 2014). Because the CRISPR/Cas9 system has only two components and
biallelic mutation is achievable, mutant phenotypes can be determined in a single
generation. Simultaneous expression of multiple sgRNAs targeting the same gene
should increase the likelihood of achieving high degrees of biallelic inactivation.
By crossing Cas9 and sgRNA transgenic fish, double positive transgenic fish are
putative mutants and can be used for functional studies. Because a substantial num-
ber of genes in zebrafish are duplicated (Howe et al., 2013), targeting both genes at
the same time can bypass functional redundancy.
4 CHAPTER 1 Multiplex conditional mutagenesis in zebrafish

1. METHODS
1.1 ASSEMBLY OF U6-BASED sgRNA TRANSGENIC CONSTRUCTS
Expression of multiple sgRNAs provides advantages for studying gene function. First,
the same gene can be targeted at multiple sites to increase mutagenesis. Second, gene
interaction can be studied by using sgRNAs against candidate genes in a pathway of
interest. Third, targeting duplicated genes can overcome redundancy and compensa-
tion. To facilitate these outcomes we isolated U6 promoters to drive expression of in-
dividual sgRNAs in a transgenic construct. Individual U6 promoters are used for each
sgRNA to minimize potential instability of expressing multiple sgRNAs in tandem.
Four high efficiency U6 promoters were isolated: U6a (chromosome21), U6b (chro-
mosome9), U6c (chromosome11), and U6d (chromosome6) (Clarke, Cummins,
McColl, Ward, & Doran, 2013; Yin, Maddison, et al., 2015). They have equivalent
promoter activity in transgenic fish (Yin, Maddison, et al., 2015).
1. Generation of U6-based expression vectors.
A series of U6 promoterebased expression cassettes were developed, which
contain the different U6 promoters and the sgRNA(F þ E)
scaffold (Chen et al.,
2013) (Fig. 1). They are available through Addgene (Addgene plasmid
# 64245, 64246, 64247, 64248, 64249). To design sgRNA targeting oligos, we
recommend the CRISPRscan tool http://www.crisprscan.org/ that predicts
efficient sgRNA with offtarget information (Moreno-Mateos et al., 2015).
Addition of the linker sequences outlined in Fig. 2 facilitates cloning using
BsmBI into either the U6-based expression vector or into the pT7-sgRNA
vector to allow for in vitro transcribed sgRNA (Addgene plasmid #46759) (Jao
et al., 2013).
a. Annealing of targeting oligonucleotides.
i. Add 2 mL of 100 mM for each oligo, 2 mL of 10 NEB Buffer 2.1, and
14 mL of distilled H2O for a total reaction volume of 20 mL.
ii. Incubate the mixture at 95C for 5 min, decrease to 50C at 0.1C/s,
incubate at 50C for 10 min, and chill to 4C at normal ramp speed.
b. Ligation to the U6 vector.
i. The choice of vector depends on the end goal of the transgenic construct.
For example, for a single sgRNA, use the U6a vector. If the goal is to
express four different sgRNAs, each annealed pair of oligos should be
placed in a different vector: pair 1 in U6a, pair 2 in U6b, pair 3 in U6c,
and pair 4 in U6d. Fig. 3 outlines the assembly of the transgenic con-
structs and can be used as a guide for vector choice.
ii. Mix together 1 mL 10 NEB CutSmart buffer, 1 mL T4 DNA ligase
buffer, 0.25 mL U6 plasmid (about 100 ng), 1 mL annealed oligos, 0.3 mL
T4 DNA ligase, 0.3 mL BsmBI, 0.2 mL PstI, and 0.2 mL SalI, and adjust
with distilled H2O for a total of 10 mL.
1. Methods 5

iii. Incubate for three cycles of 37C for 20 min and 16C for 15 min. Follow
this with 37C for 10 min, 55C for 15 min, and 80C for 15 min.
iv. Transform chemically competent Escherichia coli such as Top10
(Thermo Fisher) with 2 mL of the ligation. Plate 10% transformants onto
spectinomycin plates (50 mg/mL). Incubate the plates overnight at 37C.
- To increase the number of transformants, either increase the number of
cycles during the digestion/ligation step or plate a larger volume of the
transformation.
v. Pick single colonies and grow in Luria Broth (LB) medium with
50 mg/mL spectinomycin overnight at 37C. Prepare plasmid DNA
using standard protocols and confirm sgRNA insertion by sequencing
with primer pCR8 R1.
2. Construction of the sgRNA expressing transgenes via Golden Gate cloning.
To orderly assemble sgRNA cassettes with one, two, or more U6-driven sgRNAs,
we developed a Golden Gate strategy (Yin, Maddison, et al., 2015). We
generated a series of Tol2-based destination vectors, pGGDestTol2LC, all
containing cryaa:cerulean (LC) (Hesselson et al., 2009) for lens-specific
FIGURE 1 Schematics and cloning of the sgRNA expression vector.
Each vector contains a U6 promoter and an sgRNA scaffold. The inclusion of BsmBI and
BsaI sites simplifies the insertion of the sgRNA target oligo and subsequent Golden Gate
cloning. Digestion with BsmBI (gray dashes) leaves specific overhangs that will recognize the
linkers on the annealed primer pair for the target.

cerulean expression as a selection marker for positive transgenesis. Each
destination vector is designed to receive 1, 2, 3, 4, or 5 U6:sgRNA cassettes
(Addgene plasmid # 64239, 64240, 64241, 64242, 64243). Golden Gate cloning
is facilitated by BsaI sites in the U6:sgRNA vectors and for proper assembly the
correct combination of plasmid vectors must be used (Fig. 3). A U6a:sgRNA for
tyrosinase is available to use as the first cassette (Addgene plasmid # 64250).
This allows an easily identifiable pigmentation phenotype as an indication of
mutagenesis (Jao et al., 2013; Yin, Maddison, et al., 2015).
a. Golden gate assembly.
i. Choose the appropriate destination vector for the number of U6:sgRNA
cassettes to be assembled.
ii. Mix 50 ng of the pGGDestTol2LC vector and 100 ng of each pU6x-
sgRNA vector with 2 mL 10 NEB CutSmart buffer, 2 mL T4 DNA
ligase buffer, 1 mL BsaI, and 1 mL T4 DNA ligase, and adjust with
distilled H2O for a total volume of 20 mL.
iii. Incubate for three cycles of 37C for 20 min and 16C for 15 min. Follow
this with 80C for 15 min, and cool to room temperature.
iv. Use 10 mL of the ligation for the transformation and plate 50% of the
transformants on ampicillin (100 mg/mL) plates. Pick single clones and
grow in LB medium with 100 mg/mL ampicillin. Prepare plasmid DNA
using standard protocols.
v. Verify the multiplexed sgRNA vectors by PCR or sequencing. Each
sgRNA element can be verified using a U6 forward primer (Table 1) and
the corresponding sgRNA reverse primer (AMMCN18C).
FIGURE 2 Dual use linker sequences for sgRNA targets.
The relevant linker sequences for the forward and reverse primers are indicated. After
annealing of the oligos, the linkers allow cloning into either the U6 expression vectors or into
the vector allowing T7 RNA polymerase based in vitro transcription.
1. Methods 7

FIGURE 3 Golden Gate cloning of U6-based expression transgene.
(A) Golden Gate cloning is facilitated by the use of BsaI where the overhang following
digestion is specifically designed for each component. (B) Example showing the progressive
pairing of components in a five sgRNA vectors. Each BsaI site (triangle) is designed so
that ligation occurs in a specific order (dashed line) with the destination vector containing the
Tol2 repeats (TIR) and the cryaa:cerulean (LC) marker. (C) The choice of vectors is
dependent on the number of sgRNAs to be expressed. The overhang sequence produced by
BsaI digestion is specific for each vector and is indicated and color coded for visual simplicity.
For the successful production of the sgRNA expression transgenic construct, the correct
combination of destination vector and U6-based vector(s) needs to be used. (See color plate)

b. The confirmed plasmids can then be injected into one-cell stage embryos with
Tol2 transposase RNA using standard methods. Embryos that exhibit lens
cerulean expression can be selected and raised to maturity.
1.2 CONSTRUCTION OF Cas9 EXPRESSION VECTORS
To achieve conditional control of CRISPR mutagenesis, the expression of at least one
component of the CRISPR system needs to be spatially and/or temporally regulated.
Although Pol III promoter-driven sgRNA expression can be made to be dependent of
Cre activity or tetracycline as has been done for shRNA expression (Tiscornia,
Tergaonkar, Galimi, Verma, 2004; van de Wetering et al., 2003), this will increase
the complexity of its implementation since additional components are necessary to
achieve the regulation. In contrast, Pol II promoter-driven Cas9 expression can be
easily regulated using various tissue-specific promoters and inducible promoters.
1. The Tol2-based multisite Gateway system is used to prepare the conditional
Cas9-expression vector (Kwan et al., 2007). A codon-optimized version of Cas9
(Jao et al., 2013) was cloned into a middle-entry vector to generate a universal
pME-Cas9 (Addgene #64237). A destination vector containing a fluorescent
marker for simplified identification of transgenic carriers is recommended for
simple identification of transgenesis, as long as it does not obscure the lens-
cerulean expression used for the U6-sgRNA constructs. In combination with a
50 entry vector containing the promoter of interest, the Cas9 middle-entry
vector, and the 30 entry vector containing a poly A using standard multisite
Gateway reactions, the transgenic construct can be easily generated.
2. Once constructed, the Cas9 expression vector can then be injected into one-cell
stage embryos with Tol2 transposase RNA using standard methods. Embryos that
exhibit expression of the marker, if used, can be selected and raised to maturity.
1.3 SCREENING AND EVALUATION OF STABLE sgRNA or Cas9
TRANSGENIC FISH
1. Evaluation of sgRNA transgenic lines.
We have found that multiple transgenic lines need to be evaluated to produce
those that have the most robust expression of the sgRNA(s). Two rounds of
Table 1 Primers for Verifying Multiplex sgRNA Vectors
Primer Name Primer Sequence 50e30
U6aF TTTCTCCAGCCTCGGTCATT
U6bF CTCATTACCCTCCACGTGTCTGTC
U6cF CCAATCCGAGAGTCTGTGAATGTT
U6dF CCTGTGATTTGGTGGTTGTGAAAG
1. Methods 9

embryo production are needed to determine the optimal transgenic line (Fig. 4).
In the first round, founders are crossed to wild-type fish and germline integration
of the transgene evaluated by marker gene expression in F1 embryos. In the
second round, the founders with germline integration are crossed to a stable
transgenic line with ubiquitous expression of Cas9, and the degree of muta-
genesis of the target gene is evaluated in the F1 embryos. This saves both time
and resources in that only the optimal sgRNA transgenic lines are raised.
However, the second phase of evaluation can be done in subsequent generations
where the positive F1 carriers are raised to maturity and then crossed to the
ubiquitously expressed Cas9 transgenic line. This increases the number of
embryos that carry both transgenes but will take additional time and resources
to raise the F1 fish.
a. Cross individual injected founders with wild-type fish. Collect the embryos
from successful matings and hold the founder fish in a separate small tank.
i. At least 30 embryos are needed for screening. If fewer embryos have been
produced, return the injected fish to the unscreened tank for additional
mating.
ii. At 3e5 dpf, evaluate lens cerulean expression using a fluorescence mi-
croscope with a CFP filter.
- Positive F1 embryos can be raised to maturity for additional evaluation
if desired.
b. Cross the founder fish that exhibit germline integration to a stable transgenic
line with ubiquitous Cas9 expression.
i. We have developed two transgenic lines Tg(ubi:cas9;CG) and Tg(actb2:
cas9:LR) that have been fully characterized and are efficient in pro-
ducing mutagenesis in conjunction with transgenic sgRNA expression
(Yin, Maddison, et al., 2015) (Fig. 5).
ii. At 3e5 dpf, select embryos that have both the lens cerulean expression
and the marker gene for the Cas9 transgenic line.
iii. If the sgRNA for tyrosinase was included in the transgenic construct, the
degree of pigmentation in the double transgenic embryos can be easily
evaluated (Fig. 5). We have found that this is a good predictor of the
efficiency of the other sgRNAs within the construct (Yin, Maddison,
et al., 2015).
iv. If the sgRNA for tyrosinase was not included in the construct, the effi-
ciency for one or multiple sgRNAs can be evaluated by other methods.
We routinely use a heteroduplex mobility shift assay (HMA) although
other methods are available including sequencing and PCR-based ap-
proaches (Yin, Jao, Chen, 2015; Yu, Zhang, Yao, Wei, 2014). The
procedure for the HMA evaluation will be detailed here.
- Isolate genomic DNA by placing double transgenic embryos with one
embryo per well in PCR tubes. Include at least one embryo that is
either nontransgenic or is single transgenic as a negative control.
Incubate on ice to euthanize the embryos, then remove all water, and

FIGURE 4 Evaluation of efficiency of U6-based sgRNA transgenic lines.
Two rounds of embryo production are needed to evaluate each transgenic line. In the first
round, germline transmission is evaluated by crossing the F0 fish to a wild-type fish. In case
there is a low germline transmission rate, more than 30 embryos should be collected from
each mating. If there are embryos that have cerulean expression in the lens, the founder can
be evaluated for efficiency of mutagenesis. In this second round of embryo production, the
U6sgRNA F0 fish is crossed to a transgenic line with a high level of Cas9 expression
throughout the fish. These Cas9 fish also contain a fluorescent marker such as heart GFP
expression. Embryos that have both the lens cerulean expression and the heart GFP
expression are used to determine mutagenesis of the gene target(s) using assays such as the
heteroduplex mobility shift assay. Mutagenesis is indicated by a reduction or shifting of the
PCR product, compared to single or nontransgenic siblings.
1. Methods 11

add 30 mL of 20 mM NaOH. Incubate samples at 95C for 20 min and
then cool to 4C. Add 6 mL of 1 M Tris-HCl (not pH adjusted) to
neutralize the samples. Add 164 mL of 10 mM Tris-Cl, pH 8.5 to make
the final volume to 200 mL.
- Amplify the target region by PCR from 1 mL of the genomic DNA
solution using the primers that flank the predicted cleavage site in the
genome. Amplicons that are between 150 and 400 bp are desired for
this approach. Run 2 mL of the PCR product on a 0.8% agarose gel to
be sure that a single species of expected size is amplified.
- Add 10 stop solution to the PCR reaction for final concentration of
10 mM EDTA and 0.1% SDS.
Optional: The PCR product can be column purified or ethanol
precipitated. If the product is column purified, elute in 50 mL of
FIGURE 5 Global expression of Cas9 and tyrosinase mutagenesis.
Tg(ubi:cas9;CG) and Tg(actb2:cas9;LR) are two fully characterized transgenic lines with
global expression of Cas9. The Tg(U6a:gTyr) has expression of an sgRNA against tyrosinase.
In combination with either Cas9 transgenic line, a defect in pigmentation can be easily
observed in double transgenic embryos but not in single transgenic embryos. Analysis of the
tyrosinase gene also indicates efficient mutagenesis.

10 mM Tris-Cl, pH 8.5. If ethanol precipitated, resuspend the pellet
in 50 mL of 10 mM Tris-Cl, pH 8.5. Then mix 200 ng of the purified
product, 2 mL of 10 NEB buffer 2.1, and nuclease-free water to a
total volume of 20 mL.
- Melt and reanneal the product by incubation at 95C for 5 min,
decrease to 85C at 2.0C/s, decrease to 25C at 0.1C/s, and hold
at 16C until use.
- Run the products on a 10% polyacrylamide (29:1) TBE gel. If using
purified products, load 10 mL of the reaction. If using the PCR reaction
directly, load 5e10 mL of the reaction. Run at 120 V for 2e3 h
depending on the amplicon size.
- Stain the gel in 1 TBE buffer containing 0.5 mg/mL of ethidium
bromide 5 min before imaging.
- The presence of slow-migrating bands is indicative of DNA hetero-
duplexes (Fig. 5).
Caution: Presence of multiple bands in a known wild-type sample can
indicate polymorphisms present in the amplicon. If present, primers
may need to be redesigned to limit the inclusion of these regions.
2. Evaluation of Cas9 transgenic lines.
As with the sgRNA transgenic lines, multiple lines need to be evaluated before
choosing the one that drives the most robust mutagenesis. Again, two rounds of
embryo production are needed to determine the most useful transgenic line. In the
first round, founders are crossed to wild-type fish and germline integration of the
transgene evaluated bymarkergeneexpression inF1embryos.In the secondround
ofevaluation,thefounderswithgermlineintegrationarecrossedtoacharacterized,
stable transgenic line with efficient sgRNA expression, such as tyrosinase, and the
degree of mutagenesis of the target gene evaluated in the F1 embryos.
a. Cross individual injected founders with wild-type fish. Collect the embryos
from successful matings and hold the founder fish in a separate small tank.
i. At least 30 embryos are needed for screening. If fewer embryos have been
produced, return the injected fish to the unscreened tank for additional
mating.
ii. At 3e5 dpf, marker expression can be evaluated using a fluorescence
microscope with the appropriate filter. Positive F1 embryos can be raised
to maturity for additional evaluation if desired.
b. Cross the founder fish with germline integration to a stable transgenic line
with efficient expression of sgRNA such as tyrosinase.
i. Degree of mutagenesis can be evaluated using the HMA method presented
earlier as long as the population of mutated DNA is sufficiently large.
ii. If the expression pattern of the Cas9 is limited to a specific tissue, it may be
moreusefultouse a double transgeniclinewithGFP expression inthe tissue
ofinterestandansgRNA against GFP.EfficiencyoftheCas9transgenicline
being tested can be evaluated by examining the degree of EGFP fluores-
cence. Reduced or absent EGFP would be an indication of functional Cas9
1. Methods 13

expression. Alternatively, a reporter line similar to the traffic light reporter
(Chu et al., 2015; Kuhar et al., 2014), in which expression of a fluorescent
protein is activated by Cas9 activity, may be generated and used for
evaluating the activity and tissue specificity of Cas9.
2. DISCUSSION
Conditional alleles have been instrumental for functional analysis in mice and will
likely be so in zebrafish. Previously we have generated conditional alleles using
gene-trap mutagenesis (Maddison, Li, Chen, 2014; Maddison, Lu, Chen,
2011; Ni et al., 2012). However, this approach relies on random integration of a con-
ditional gene-trap cassette, and its broad application requires the generation of a
large collection of such alleles. In contrast, the transgenic CRISPR approach
described in this chapter allows targeted conditional inactivation. Further, it allows
simultaneous inactivation of multiple genes, overcoming functional redundancy or
compensation of duplicated genes, and facilitating geneegene interaction studies.
Successful implementation of this approach of conditional mutagenesis requires
efficient sgRNAs and robust tissue-specific expression of Cas9. Although a number
of studies have identified features of active sgRNA and have incorporated these fea-
tures into algorithms for identification of active and specific sgRNAs (Chari, Mali,
Moosburner, Church, 2015; Doench et al., 2014; Gagnon et al., 2014; Moreno-
Mateos et al., 2015; Varshney et al., 2015; Wang, Wei, Sabatini, Lander, 2014;
Wong, Liu, Wang, 2015), these designing tools cannot substitute for empirical
testing. We recommend testing selected sgRNA using RNA injection into zygotes
and using multiple validated sgRNAs for each target gene. Identification of robust
and tissue-specific Cas9 drivers is also critical for the success of this approach. In
this regard, a reporter line for evaluating Cas9 function in a tissue restricted manner
is lacking. However, Cas9 expression may be determined by in situ hybridization
and/or immunofluorescence.
A potential concern of transgenic CRISPR mutagenesis is off-target effects. Careful
selection of specific sgRNA should largely mitigate this concern. However, long-term
coexpression of Cas9 and sgRNA could exacerbate the off-target effect. In this regard,
control of Cas9 expression using the HOTCre approach is advantageous (Hesselson
et al., 2009; Yin, Maddisson, et al., 2015), although its implementation requires one
additional transgene that confers tissue-specific Cre expression. Alternatively, replac-
ing Cas9 with one of the developed split-Cas9 systems may also achieve temporal
control of Cas9 activity (Davis, Pattanayak, Thompson, Zuris, Liu, 2015;
Nihongaki, Kawano, Nakajima, Sato, 2015; Zetsche, Volz, Zhang, 2015).
SUMMARY
We have presented here an approach to generate conditional mutations in zebrafish.
This CRISPR-based approach requires a transgenic line expressing sgRNA targeting

the gene of interest and a transgenic line expressing Cas9 in the desired spatial/tem-
poral pattern. Crossing the two transgenic lines allows CRISPR mutagenesis of the
target gene in the desired cell type at the desired time. In additional to zebrafish, this
approach should also be applicable to other genetically amenable organisms.
ACKNOWLEDGMENTS
We thank members in the Chen laboratory for discussions. The work is supported a grant from
National Institute Diabetes and Digestive and Kidney Diseases at NIH (DK088686) and
American Diabetes Association (1-13-BS-027).
REFERENCES
Chang, N., Sun, C., Gao, L., Zhu, D., Xu, X., Zhu, X., … Xi, J. J. (2013). Genome editing with
RNA-guided Cas9 nuclease in zebrafish embryos. Cell Research, 23, 465e472.
Chari, R., Mali, P., Moosburner, M., Church, G. M. (2015). Unraveling CRISPR-Cas9
genome engineering parameters via a library-on-library approach. Nature Methods, 12,
823e826.
Chen, B., Gilbert, L. A., Cimini, B. A., Schnitzbauer, J., Zhang, W., Li, G. W., … Huang, B.
(2013). Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/
Cas system. Cell, 155, 1479e1491.
Chu, V. T., Weber, T., Wefers, B., Wurst, W., Sander, S., Rajewsky, K., Kuhn, R. (2015).
Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise
gene editing in mammalian cells. Nature Biotechnology, 33, 543e548.
Clarke, B. D., Cummins, D. M., McColl, K. A., Ward, A. C., Doran, T. J. (2013). Charac-
terization of zebrafish polymerase III promoters for the expression of short-hairpin RNA
interference molecules. Zebrafish, 10, 472e479.
Davis, K. M., Pattanayak, V., Thompson, D. B., Zuris, J. A., Liu, D. R. (2015). Small mole-
cule-triggered Cas9 protein with improved genome-editing specificity. Nature Chemical
Biology, 11, 316e318.
Doench, J. G., Hartenian, E., Graham, D. B., Tothova, Z., Hegde, M., Smith, I., … Root, D. E.
(2014). Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene
inactivation. Nature Biotechnology, 32, 1262e1267.
Doudna, J. A., Charpentier, E. (2014). Genome editing. The new frontier of genome engi-
neering with CRISPR-Cas9. Science, 346, 1258096.
Floss, T., Schnutgen, F. (2008). Conditional gene trapping using the FLEx system. Methods
in Molecular Biology, 435, 127e138.
Gagnon, J. A., Valen, E., Thyme, S. B., Huang, P., Akhmetova, L., Pauli, A., … Schier, A. F.
(2014). Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and
large-scale assessment of single-guide RNAs. PLoS One, 9, e98186.
Halloran, M. C., Sato-Maeda, M., Warren, J. T., Su, F., Lele, Z., Krone, P. H., … Shoji, W.
(2000). Laser-induced gene expression in specific cells of transgenic zebrafish. Develop-
ment, 127, 1953e1960.
References 15

Hesselson, D., Anderson, R. M., Beinat, M., Stainier, D. Y. (2009). Distinct populations of
quiescent and proliferative pancreatic beta-cells identified by HOTcre mediated labeling.
Proceedings of the National Academy of Sciences of the United States of America, 106,
14896e14901.
Howe, K., Clark, M. D., Torroja, C. F., Torrance, J., Berthelot, C.,
Muffato, M., … Stemple, D. L. (2013). The zebrafish reference genome sequence and
its relationship to the human genome. Nature, 496, 498e503.
Hsu, P. D., Lander, E. S., Zhang, F. (2014). Development and applications of CRISPR-Cas9
for genome engineering. Cell, 157, 1262e1278.
Huang, C. J., Jou, T. S., Ho, Y. L., Lee, W. H., Jeng, Y. T., Hsieh, F. J., Tsai, H. J. (2005).
Conditional expression of a myocardium-specific transgene in zebrafish transgenic lines.
Developmental Dynamics: An Official Publication of the American Association of Anat-
omists, 233, 1294e1303.
Hwang, W. Y., Fu, Y., Reyon, D., Maeder, M. L., Tsai, S. Q., Sander, J. D., … Joung, J. K.
(2013). Efficient genome editing in zebrafish using a CRISPR-Cas system. Nature
Biotechnology, 31, 227e229.
Jao, L. E., Wente, S. R., Chen, W. (2013). Efficient multiplex biallelic zebrafish genome
editing using a CRISPR nuclease system. Proceedings of the National Academy of Sci-
ences of the United States of America, 110, 13904e13909.
Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., Charpentier, E. (2012). A
programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Sci-
ence, 337, 816e821.
Knopf, F., Schnabel, K., Haase, C., Pfeifer, K., Anastassiadis, K., Weidinger, G. (2010).
Dually inducible TetON systems for tissue-specific conditional gene expression in
zebrafish. Proceedings of the National Academy of Sciences of the United States of Amer-
ica, 107, 19933e19938.
Kuhar, R., Gwiazda, K. S., Humbert, O., Mandt, T., Pangallo, J., Brault, M., … Certo, M. T.
(2014). Novel fluorescent genome editing reporters for monitoring DNA repair pathway
utilization at endonuclease-induced breaks. Nucleic Acids Research, 42, e4.
Kwan, K. M., Fujimoto, E., Grabher, C., Mangum, B. D., Hardy, M. E.,
Campbell, D. S., … Chien, C. B. (2007). The Tol2kit: a multisite gateway-based construc-
tion kit for Tol2 transposon transgenesis constructs. Developmental Dynamics: An Official
Publication of the American Association of Anatomists, 236, 3088e3099.
Li, M., Maddison, L. A., Page-McCaw, P., Chen, W. (2014). Overnutrition induces beta-cell
differentiation through prolonged activation of beta-cells in zebrafish larvae. American
Journal of Physiology Endocrinology and Metabolism, 306, E799eE807.
Maddison, L. A., Li, M., Chen, W. (2014). Conditional gene-trap mutagenesis in zebrafish.
Methods in Molecular Biology, 1101, 393e411.
Maddison, L. A., Lu, J., Chen, W. (2011). Generating conditional mutations in zebrafish
using gene-trap mutagenesis. Methods in Cell Biology, 104, 1e22.
Moreno-Mateos, M. A., Vejnar, C. E., Beaudoin, J. D., Fernandez, J. P., Mis, E. K.,
Khokha, M. K., Giraldez, A. J. (2015). CRISPRscan: designing highly efficient sgRNAs
for CRISPR-Cas9 targeting in vivo. Nature Methods, 12, 982e988.
Ni, T. T., Lu, J., Zhu, M., Maddison, L. A., Boyd, K. L., Huskey, L., … Chen, W. (2012). Con-
ditional control of gene function by an invertible gene trap in zebrafish. Proceedings of the
National Academy of Sciences of the United States of America, 109, 15389e15394.
Nihongaki, Y., Kawano, F., Nakajima, T., Sato, M. (2015). Photoactivatable CRISPR-Cas9
for optogenetic genome editing. Nature Biotechnology, 33, 755e760.

Schnutgen, F., Doerflinger, N., Calleja, C., Wendling, O., Chambon, P., Ghyselinck, N. B.
(2003). A directional strategy for monitoring Cre-mediated recombination at the cellular
level in the mouse. Nature Biotechnology, 21, 562e565.
Tiscornia, G., Tergaonkar, V., Galimi, F., Verma, I. M. (2004). CRE recombinase-inducible
RNA interference mediated by lentiviral vectors. Proceedings of the National Academy of
Sciences of the United States of America, 101, 7347e7351.
Varshney, G. K., Pei, W., LaFave, M. C., Idol, J., Xu, L., Gallardo, V., … Burgess, S. M.
(2015). High-throughput gene targeting and phenotyping in zebrafish using CRISPR/
Cas9. Genome Research, 25, 1030e1042.
van de Wetering, M., Oving, I., Muncan, V., Pon Fong, M. T., Brantjes, H., van
Leenen, D., … Clevers, H. (2003). Specific inhibition of gene expression using a stably
integrated, inducible small-interfering-RNA vector. EMBO Reports, 4, 609e615.
Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. (2014). Genetic screens in human cells
using the CRISPR-Cas9 system. Science, 343, 80e84.
Wong, N., Liu, W., Wang, X. (2015). WU-CRISPR: characteristics of functional guide
RNAs for the CRISPR/Cas9 system. Genome Biology, 16, 218.
Yin, L., Jao, L. E., Chen, W. (2015). Generation of targeted mutations in zebrafish using the
CRISPR/Cas system. Methods in Molecular Biology, 1332, 205e217.
Yin, L., Maddison, L. A., Li, M., Kara, N., LaFave, M. C., Varshney, G. K., … Chen, W.
(2015). Multiplex conditional mutagenesis using transgenic expression of Cas9 and
sgRNAs. Genetics, 200, 431e441.
Yu, C., Zhang, Y., Yao, S., Wei, Y. (2014). A PCR based protocol for detecting indel mu-
tations induced by TALENs and CRISPR/Cas9 in zebrafish. PLoS One, 9, e98282.
Zetsche, B., Volz, S. E., Zhang, F. (2015). A split-Cas9 architecture for inducible genome
editing and transcription modulation. Nature Biotechnology, 33, 139e142.
References 17

Tol2-mediated
transgenesis, gene
trapping, enhancer
trapping, and Gal4-UAS
system
2
K. Kawakami1
, K. Asakawa, A. Muto, H. Wada
SOKENDAI (The Graduate University for Advanced Studies), Mishima, Shizuoka, Japan
1
Corresponding author: E-mail: kokawaka@nig.ac.jp
CHAPTER OUTLINE
Introduction.............................................................................................................. 20
1. Transgenesis by Using the Tol2 Transposable Element ........................................... 21
1.1 Rationale.............................................................................................. 21
1.2 Methods............................................................................................... 21
1.2.1 Synthesis of transposase mRNA in vitro .............................................. 21
1.2.2 Preparation of a Tol2-donor plasmid.................................................... 21
1.2.3 Microinjection..................................................................................... 23
1.2.4 Excision assay .................................................................................... 23
1.2.5 Identification of transgenic fish............................................................ 26
1.3 Materials .............................................................................................. 26
1.4 Discussion............................................................................................ 26
2. Gene Trap, Enhancer Trap Methods for the Gal4FF-UAS Methods............................. 27
2.1 Rationale.............................................................................................. 27
2.2 Methods............................................................................................... 27
2.2.1 Gene trap and enhancer trap screens ................................................. 27
2.2.2 Analysis of Tol2 insertions by Southern blot hybridization..................... 29
2.2.3 Identification of Tol2 integration sites by inverse PCR........................... 30
2.2.4 Search for useful gene trap and enhancer trap fish using the zTrap
database ............................................................................................ 31
2.3 Materials .............................................................................................. 32
2.4 Discussion............................................................................................ 32
3. Targeted Gene Expression With the Gal4-UAS System............................................. 32
3.1 Rationale.............................................................................................. 32
CHAPTER
Methods in Cell Biology, Volume 135, ISSN 0091-679X, http://dx.doi.org/10.1016/bs.mcb.2016.01.011
© 2016 Elsevier Inc. All rights reserved.
19

3.2 Methods............................................................................................... 32
3.2.1 Inhibition of neuronal activities via the Gal4-UAS system ..................... 32
3.2.2 Visualization of neuronal activities via the Gal4-UAS system................. 33
3.2.3 Visualization of in vivo microtubule structures via the Gal4-UAS
system ............................................................................................... 33
3.2.4 Inhibition of the Wnt-signaling pathway via the Gal4-UAS system......... 35
3.3 Materials .............................................................................................. 35
3.4 Discussion............................................................................................ 35
Acknowledgments..................................................................................................... 36
References ............................................................................................................... 36
Abstract
The Tol2 element is an active transposon that was found from the genome of the Japanese
medaka fish. Since the Tol2 transposition system is active in all vertebrate cells tested so
far, it has been applied to germ line transgenesis in various model animals including fish,
frog, chicken, and mouse, and to gene transfer in culture cells. In zebrafish, the Tol2
system consists of the transposase mRNA and a Tol2 transposon-donor plasmid, and is
introduced into fertilized eggs by microinjection. Thus genomic integrations of the Tol2
construct are generated in the germ lineage and transmitted to the offspring very effi-
ciently. By using the Tol2 transposition system, we have developed important genetic
methods, such as transgenesis, gene trapping, enhancer trapping, and the Gal4-UAS
system in zebrafish and applied to many aspects of biological studies. In this chapter, we
describe how these methods are performed.
INTRODUCTION
The Tol2 transposable element was identified from the genome of the Japanese
medaka fish, and its DNA sequence is similar to those of transposons of the hAT
family (Koga, Suzuki, Inagaki, Bessho, Hori, 1996). It was shown that the Tol2
element carries a gene encoding a fully functional transposase (Kawakami, Koga,
Hori, Shima, 1998; Kawakami Shima, 1999) (Fig. 1A). Thus the Tol2 element
is the first active transposon identified from a vertebrate genome. The Tol2 element
also contains DNA sequences that are recognized by the transposase. The minimal
cis-sequences essential for transposition were analyzed, and it was shown that 200-
bp from the left end and 150-bp DNA from the right end of the Tol2 element are
necessary and sufficient (Fig. 1A) (Urasaki, Morvan, Kawakami, 2006). Any
DNA fragment can be cloned between these cis-sequences.
The Tol2 transposition system consists of two components, a transposon-donor
plasmid carrying a Tol2 construct and the transposase activity supplied as a form
of mRNA or an expression plasmid. It has been shown that the Tol2 system is active
in all vertebrate cells tested so far (Kawakami, 2007). In zebrafish, a transposon-
donor plasmid and mRNA synthesized in vitro by using the transposase cDNA as
20 CHAPTER 2 Tol2-mediated genetic methods in zebrafish

a template are injected into fertilized eggs. The Tol2 construct is excised from the
donor plasmid and integrated into the genome of the germ lineage during embryonic
development, and the transposon insertions are transmitted to the next generation
very efficiently (Kawakami, Shima, Kawakami, 2000; Kawakami et al., 2004)
(Fig. 2B). Thus the Tol2 system has served as an essential tool for transgenesis in
zebrafish. Furthermore, important genetic methods, such as gene trapping, enhancer
trapping, and the Gal4-UAS system (Asakawa et al., 2008; Davison et al., 2007;
Kawakami et al., 2004; Nagayoshi et al., 2008; Parinov, Kondrichin, Korzh,
Emelyanov, 2004; Scott et al., 2007) were developed by using the Tol2 system.
Transgenic zebrafish generated by these methods that express GFP or Gal4 in
spatially and temporally restricted fashions have been powerful tools for the study
of developmental biology, organogenesis, and neuroscience.
1. TRANSGENESIS BY USING THE Tol2 TRANSPOSABLE
ELEMENT
1.1 RATIONALE
A Tol2-donor plasmid DNA and the transposase mRNA (Fig. 1A) are introduced into
zebrafish fertilized eggs by microinjection. In the injected embryos, the transposase
protein is synthesized and catalyzes excision of the Tol2 construct from the donor
plasmid. The excised Tol2 construct is integrated into the genome during embryonic
development, in the future germ cells. Thus transgenic fish will be obtained in the
progeny from the injected fish (Fig. 2B).
1.2 METHODS
1.2.1 Synthesis of transposase mRNA in vitro
1. Linearize pCS-zT2TP (Fig. 1A) by digestion with NotI and synthesize mRNA
using mMESSAGE mMACHINE SP6 Kit (Ambion Inc.).
2. Purify the transposase mRNA by using “Quick Spin Columns for radiolabeled
RNA purification” (Roche), then precipitate the mRNA and resuspend it in
nuclease-free water at 250 ng/mL.
3. Analyze the product by gel electrophoresis. For electrophoresis of RNA, a
denaturing gel is preferable, but, alternatively a standard agarose/TAE gel can
be used (Fig. 2A).
1.2.2 Preparation of a Tol2-donor plasmid
1. Clone the desired DNA fragment into an appropriate Tol2 vector, for instance,
either by using the XhoI and BglII sites on T2AL200R150G (Urasaki et al.,
2006) (Fig. 1A) or by using the Tol2 vectors with the Gateway system (Kwan
et al., 2007; Villefranc, Amigo, Lawson, 2007).
1. Transgenesis by using the Tol2 transposable element 21

T2AL200R150G
egfp pA
SA
SD
500 bp
XhoI BglII
ClaI
BamHI
T2KhspGFF
T2KSAGFF
UAS:GFP
UAS:TeTxLC:CFP
BglII, SalI, EcoRI, MluI, EcoRV, XhoI
TATA
UASMCS
5xUAS
Tol2
AAAA
4682 bp
L R
gal4ﬀ pA
SA
hsp70-p gal4ﬀ pA
pA
TATA
5xUAS
pA
egfp
TATA
5xUAS
pA
tetxlc:cfp
L R
L
R
L
R
L
R
L
R
L
R
transposase mRNA
pCS-zT2TP
NotI
Tol2 transposase pA
CMV-p (SP6)
Tol2
Tol2
UAS:GCaMP7a
5xUAS
pA
gcamp7a
L
R
UAS:Gtuba2
5xUAS
pA
egfp:tuba2
L
R
UAS:Dkk2:RFP
5xUAS
pA
dkk2:rfp
L
R
ef1 -p
(A)
(B)
(C)
FIGURE 1
The structures of Tol2 vectors used in zebrafish. (A) The full-length Tol2 element, the
minimal Tol2 vector T2AL200R150G, and pCS-zT2TP. Tol2 is 4682 bp in length and
encodes mRNA for the transposase (dotted lines indicate introns). T2AL200R150G contains
200-bp and 150-bp DNA from the left (L) and right (R) terminals of Tol2, the Xenopus EF1a
promoter (ef1a-p), the rabbit-b-globin intron (from SD to SA), the egfp gene, and the SV40

2. Prepare the transposon-donor plasmid DNA using QIAfilter Plasmid Maxi Kit
(QIAGEN), purify the recombinant plasmid once by phenol/chloroform
extraction, precipitate it with ethanol, and suspend the plasmid in nuclease-free
water at 250 ng/mL.
1.2.3 Microinjection
1. Set up male and female adult zebrafish in a mating box in the evening and collect
fertilized eggs in the next morning (Fig. 3A). Microinjection should be carried
out at the one-cell stage within 30 min postfertilization.
2. Make an injection ramp by using 1% agarose, a glass plate, and a 6-cm plastic
dish (Fig. 3B). Create fine needles for microinjection by using a glass capillary
(GC-1, Narishige, Japan) and a puller (PC-10, Narishige, Japan). Cut the tip
with a surgical blade (No. 11, Akiyama MEDICAL MFG. CO., Japan).
3. Prepare DNA/RNA solution by mixing the following components; 10 mL of
0.4 M KCl, 2 mL of phenol red solution (SigmaeAldrich), 2 mL of 250 ng/mL
transposase mRNA, 2 mL of 250 ng/mL Tol2-donor plasmid DNA, and 4 mL of
nuclease-free water (final volume 20 mL). Before injection, centrifuge the
mixture at the maximum speed for 1 min to precipitate and remove debris that
may clog the injection needle. Transfer the upper 18 mL to a new tube.
4. Fill the DNA/RNA solution into the glass capillary from the backside by using a
Microloader tip (Eppendorf, Germany). Attach the filled capillary to a holder
(No. 11520145, Leica, Germany) and connect the holder to a 10-mL syringe via
a Teflon tube (inner diameter: 0.56 mm, Chukoh Chemical Industries, Japan)
(Fig. 3C).
5. Inject w1 nL of the DNA/RNA solution (the approximate volume can be
measured by observing the diameter of the injected bolus by eye) into the
cytoplasm of fertilized eggs (Fig. 3D). Incubate the injected embryos in a plastic
dish at 28C.
1.2.4 Excision assay
1. To confirm the transposition reaction, the excision assay should be performed in
a subsample of embryos (Kawakami Shima, 1999) (Fig. 2A and B).
=
----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
polyA signal (pA). pCS-zT2TP contains the codon-optimized transposase coding sequence
downstream of the CMV and SP6 promoters. Unique restriction enzyme sites are indicated.
(B) The gene and enhancer trap constructs. T2KSAGFF contains the splice acceptor (SA)
and the gal4ff gene. T2KhspGFF contains the hsp70 promoter and the gal4ff gene. (C) The
UAS-reporter and effector constructs. UASMCS is a cloning vector that contains five tandem
repeats of the Gal4-target sequence (5xUAS), followed by a minimal TATA sequence, the
multicloning site, and polyA. UAS:GFP, UAS:TeTxLC:CFP, UAS:GCaMP7a, UAS:Gtuba2, and
UAS:Dkk2:RFP contain egfp, the tetanus toxin light chain gene fused to CFP, the calcium
indicator gcamp7a gene, the a-tubulin gene fused to egfp, and the dickkopf2 gene fused to
rfp downstream of UAS, respectively. Note that UAS:GFP was created by using an old version
of Tol2 vectors with longer arms.

+ mRNA - mRNA
1kb ladder zT2TP mRNA
(A)
(B)
GFP posiƟve embryo GFP negaƟve embryo
in vitro transcripƟon
GFP
promoter
Tol2 Tol2
Tol2 transposase mRNA
AAAAAAA
plasmid DNA with a transposon construct
co-injecƟon of
a Tol2 donor plasmid and
transposase mRNA
Tol2 vector construcƟon
microinjecƟon
stable transgenesis
founder fish wild type fish
F1
genomic DNA
excision
exL exR
integraƟon
(C)
in vitro transcripƟon
excision assay
excision assay
FIGURE 2
Transgenesis by using the Tol2 transposable element. (A) Electrophoresis of the transposase
mRNA synthesized in vitro on a standard agarose/TAE gel. Two bands are detected
presumably due to its higher-order structure. (B) A scheme for transgenesis in zebrafish. The
transposase mRNA synthesized in vitro and a Tol2-donor plasmid DNA are coinjected into
fertilized eggs. The transposase protein produced in the injected embryos catalyzes excision

2. About 10 h after microinjection, transfer several embryos one by one into 0.2-
mL strip tubes (eight tubes per strip). Remove water and add 50 mL of lysis
buffer (10-mM Tris-HCl pH 8.0, 10-mM EDTA, 200-mg/mL proteinase K).
Incubate the sample at 50C for 2 h to overnight.
3. Inactivate the proteinase K by heating at 95C for 5 min. Prepare PCR reaction
mixture containing 1-mM primers (exL and exR), buffer, Hi-Fi taq (Roche), and
1 mL of the sample. Perform PCR; 35 cycles of 94C for 30 s; 55C for 30 s;
=
----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
of the Tol2 construct from the plasmid and integration into the genome. The injected
embryos are raised and crossed with wild-type fish. The integrated Tol2 construct is
transmitted to the F1 generation. (C) Electrophoresis of PCR products generated by excision
assay. After excision of the Tol2 construct, the double strand break on the donor plasmid is
repaired and re-ligated. Therefore PCR using the exL and exR primers located at both sides
of the Tol2 construct generates short PCR products from the backbone plasmid in embryos
injected with both the transposase mRNA and the donor plasmid but not in embryos injected
only with the donor plasmid.
(A)
(C) (D)
(B)
FIGURE 3
Apparatus and tools for microinjection. (A) A zebrafish mating box (Aquaschwarz, Germany).
Male/female pairs of adult zebrafish are placed in a plastic tank with a sieve insert. (B) An
agarose ramp for microinjection. Melted 1% agarose is poured in a 60-mm petri dish, and
then a glass plate is placed to create a slant. (C) Microinjection apparatus. A glass capillary is
attached to a holder and connected to a syringe through a Teflon tube. The DNA/RNA
mixture is backloaded into the capillary prior to attachment to the holder. (D) Microinjection is
performed under a stereoscope. The left hand provides air pressure to the capillary.

72C for 30 s, and analyze the PCR product on 1.5% gel electrophoresis. When
the Tol2 portion is excised from the donor plasmid, the backbone plasmid is re-
ligated and DNA without Tol2 will be amplified (Fig. 2C).
exL: 50-ACCCTCACTAAAGGGAACAAAAG-30
exR: 50-CAAGGCGATTAAGTTGGGTAAC-30
1.2.5 Identification of transgenic fish
1. Raise the remaining injected embryos to the sexual maturity (w3 months).
2. Cross the injected fish with wild-type fish and analyze the offspring. When the
construct contains a fluorescent marker such as GFP, observe embryos by a
fluorescent stereoscope and select GFP-positive embryos.
3. Alternatively, collect a subsample (w50) of the day-1 embryos for PCR analysis.
Place embryos in a microtube, add 250-mL DNA extraction buffer (10-mM Tris-
HCl pH 8.2, 10-mM EDTA, 200-mM NaCl, 0.5% SDS, 200-mg/mL proteinase
K) and incubate them at 50C overnight. Purify embryonic DNA by phenol/
chloroform extraction, precipitate with ethanol, and resuspend in 50-mLTE. Use
1 mL of the DNA sample for PCR (35 cycles of 94C for 30 s; 55C for 30 s;
72C for 30 s) using transgene specific primers. When a PCR-positive F1 pool is
found, raise their siblings and analyze them individually at the adult stage for
the presence of the transgene by PCR of caudal fin clips.
4. We highly recommend analyzing the F1 fish by Southern blot hybridization to
identify fish with single Tol2 insertions. F1 fish often carry multiple insertions,
and this may complicate further analyses. When the F1 fish of interest carry
multiple insertions, cross the F1 fish with the smallest number of insertions to
wild-type fish, raise F2 offspring, and analyze F2 fish again by Southern blot
hybridization.
1.3 MATERIALS
pCS-zT2TP: contains a codon-optimized version of the transposase cDNA
downstream of the CMV and SP6 promoters (Fig. 1A).
pT2AL200R150G: contains 200-bp and 150-bp DNA from the left and right ends
of Tol2, respectively (Fig. 1A) (Urasaki et al., 2006). A DNA fragment can be
cloned between unique BglII and XhoI sites.
1.4 DISCUSSION
Transgenesis using the Tol2 transposon system is highly efficient. 50e70% of fish
injected with the Tol2 system at the one-cell stage and grown up to the adulthood
will become germ lineetransmitting founder fish that transmit transgenes to the
offspring. From such germ lineetransmitting founder fish, six to seven insertions
are transmitted on average (Kawakami et al., 2004; Urasaki et al., 2006). This
feature, together with high germ line transmission rates, enables generation of thou-
sands of transposon insertions in a mid-scale laboratory. Tol2 transposonemediated

transgenesis has the following merits. First, since a transposon construct is inte-
grated as a single copy, the expression of the transgene on the construct is less sen-
sitive to silencing in comparison to multimeric or concatemeric transgene
integrations. Second, since a transposon vector functions as a cassette, end-to-end
integration of a transgene is guaranteed. Third, the transposon insertion does not
cause unwanted rearrangements at the integration locus. Forth, the Tol2 vector has
fairly large cargo capacity. 10-kb DNA can be cloned without reducing the transpo-
sitional activity (Urasaki et al., 2006), and, furthermore, a BAC-size DNA, namely
100e200 kb DNA, can be cloned into the Tol2 vector (Suster, Sumiyama, Kawa-
kami, 2009).
2. GENE TRAP, ENHANCER TRAP METHODS FOR THE Gal4FF-
UAS METHODS
2.1 RATIONALE
The Gal4-UAS system allows targeted expression of any desired gene in the
Gal4-expressing cells. We employed Gal4FF, a modified version of the Gal4 yeast
transcription activator, that has the Gal4 DNA-binding domain and two short tran-
scription activator segments from the herpes simplex viral protein VP16 (Asakawa
et al., 2008). To generate transgenic fish with various different patterns of Gal4FF
expression, we constructed a gene trap construct T2KSAGFF that contains a splice
acceptor and the gal4ff gene, and an enhancer trap construct T2KhspGFF that
contains the zebrafish hsp70 promoter and the gal4ff gene (Fig. 1B). When the
gene trap construct was integrated within a gene and the splice acceptor “trapped”
its endogenous transcript, the gal4ff gene is expressed under the control of the pro-
moter activity, and, when the enhancer trap construct was integrated in the genome
and the hsp70 promoter was influenced by a nearby enhancer, the gal4ff gene is
expressed in a pattern dictated by the trapped enhancer.
2.2 METHODS
2.2.1 Gene trap and enhancer trap screens
1. Coinject a plasmid containing harboring T2KSAGFF or T2KhspGFF (Fig. 1B)
and the transposase mRNA to fertilized eggs. Raise the injected fish.
2. Cross the injected fish (founder fish) with UAS:GFP reporter fish (Fig. 2B). GFP
is expressed where Gal4FF is expressed. Collect GFP-positive F1 embryos by
observing them under a fluorescent microscope at different developmental
stages (eg, 24 hpf, 48 hpf, 72 hpf, and 5 dpf). Raise the F1 embryos to adulthood
(Fig. 4A).
3. To identify a gene or an enhancer trapped by the insertion, analyze genomic
DNA surrounding the insertion by Southern blot hybridization and inverse PCR.
2. Gene trap, enhancer trap methods for the Gal4FF-UAS methods 27

(A)
GFP posiƟve embryo GFP negaƟve embryo
Gal4FF
Tol2 Tol2
Tol2 transposase mRNA
AAAAAAA
plasmid DNA with a gene trap or
enhancer trap construct
microinjecƟon
founder fish UAS:GFP fish
F1
(B)
Gal4FF UAS:GFP
ON
1 2 3 4 5 6 7 8 9 10 11 12 13
founder #1 founder #2
FIGURE 4

2.2.2 Analysis of Tol2 insertions by Southern blot hybridization
1. Because transgenic fish often carry multiple insertions, we recommend
Southern blot analyses to identify an insertion responsible for the observed
expression pattern.
2. Clip caudal fins of the F1 fish and lyse the tissue in 200 mL of DNA extraction
buffer (10-mM Tris-HCl pH 8.2, 10-mM EDTA, 200-mM NaCl, 0.5% SDS,
200-mg/mL proteinase K) at 50C for 3 h to overnight. Purify DNA by phenol/
chloroform extraction, precipitate with ethanol, and suspend in 50-mL TE.
Approximately 20e30 mg DNA will be obtained.
3. Digest 5 mg of the genomic DNA with BglII, which cuts most of our transposon
constructs once. Perform electrophoresis by using 1% TAE-agarose gel.
4. Soak the gel in 0.25-N HCl for 15 min. Rinse with deionized water, soak in
0.25-N NaOH for 30 min, rinse with water, and transfer in 10X SSC (1X SSC:
0.15-M NaCl, 0.015-M sodium citrate).
5. Place the gel in a vacuum transfer apparatus (BS-31, BIO CRAFT, Japan) with
Hybond-XL (15 15 cm; GE Healthcare, England) presoaked in 10X SSC.
Perform transfer according to the manufacturer’s instructions. After transfer,
rinse the membrane in 1X SSC and dry completely at 50C for 2 h to
overnight.
6. Make a DIG (digoxigenin)-labeled probe using DIG probe synthesis KIT
(Roche). Perform PCR by using the Gal4FF-f and Gal4FF-r primers and the
gal4ff gene.
Gal4FF-f: 50-ATGAAGCTACTGTCTTCT-30
Gal4FF-r: 50-TCTAGATTAGTTACCCGG-30
7. Place the membrane into a hybridization bag, and add prewarmed 22.5-mL DIG
Easy Hyb (Roche) to the bag. Incubate at 42C for more than 30 min.
8. Replace the prehybridization solution with the hybridization buffer (8 mL of
DIG Easy Hyb with 7 mL of a denatured DIG-labeled probe). Incubate at 42C
overnight.
9. Rinse the membrane with 2X washing buffer (2X SSC, 0.1% SDS) twice and
then wash with 0.5X washing buffer (0.5X SSC, 0.1% SDS) at 65C for
15 min twice.
10. Transfer the membrane to a new plastic container containing 100-mL MABT
(0.1-M maleic acid, 0.15-M NaCl, 0.3% Tween). Incubate at room temperature
for 2 min with shaking.
=
------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Gene trapping and enhancer trapping for the Gal4-UAS system. (A) A scheme for gene
trapping and enhancer trapping. A trap construct containing gal4ff is injected into fertilized
eggs with the transposase mRNA. Injected fish are raised and mated with homozygous UAS:
GFP reporter fish. Doubly transgenic F1 embryos express GFP in regions where Gal4FF is
expressed. (B) Southern blot hybridization analysis. Lanes 1e9 and 10e13 represent F1 fish
from two different founder fish. Fish carrying a single Tol2 insertion are identified.

11. Discard MABT. Add 150-mL blocking solution, 1% blocking reagent (Roche)
in MAB (0.1-M maleic acid, 0.15-M NaCl). Incubate at room temperature for
2 min with shaking.
12. Discard blocking solution. Add 50-mL antibody solution (1/10,000 of anti-
digoxigenin-AP in blocking solution). Incubate at room temperature for
30 min with shaking.
13. Discard the antibody solution. Wash the membrane twice with 100-mL MABT.
14. Soak the membrane in 20-mL detection buffer (0.1-M Tris-HCl pH 9.5, 0.1-M
NaCl) and transfer into a hybridization bag.
15. Add 2e3 mL CDP-Star (Roche). Soak the membrane evenly in the solution.
Incubate at room temperature for 5 min. Analyze the membrane using LAS-
1000 (Fuji Film). Exposure time longer than 10 min is recommended
(Fig. 4B).
2.2.3 Identification of Tol2 integration sites by inverse PCR
1. Digest 1 mg of genomic DNA with MboI in 10 mL of reaction buffer at 37C for
1 h. Incubate the sample at 70C for 15 min. Add 430-mL H2O to the sample,
incubate at 70C for 10 min, and cool to 16C.
2. Add 50 mL 10X T4 DNA ligation buffer (TAKARA, Japan) and 2-mL T4 DNA
ligase, then incubate the sample at 16C for 3 h to overnight.
3. Add 50 mL of 3 M sodium acetate and 1 mL ethanol to the sample. Chill the
sample at 20C for 30 min. Centrifuge the sample at 15,000 rpm at 4C for
20 min. Rinse once with 70% ethanol and suspend in 20-mL H2O.
4. First PCR: using 10 mL of the ligation sample, perform the first PCR (30 cycles
of 94C for 30 s; 57C for 30 s; 72C for 1 min) using Tol2-50inv-f1 and Tol2-
50inv-r1 primers for the 50 junction or Tol2-30inv-f1 and Tol2-30inv-r1 primers
for the 30 junction.
Tol2-50inv-f1: 50-GTCATGTCACATCTATTACCAC-30
Tol2-50inv-r1: 50-CTCAAGTAAAGTAAAAATCC-30
Tol2-30inv-f1: 50-AGTACAATTTTAATGGAGTACT-30
Tol2-30inv-r1: 50-TGAGTATTAAGGAAGTAAAAGT-30
5. Second PCR: using 2 mL of the first PCR product, perform the second PCR (30
cycles of 94C for 30 s; 57C for 30 s; 72C for 1 min) using Tol2-50inv-f2 and
Tol2-50inv-r2 primers for the 50 junction or Tol2-30inv-f2 and Tol2-30inv-r2
primers for the 30 junction.
Tol2-50inv-f2: 50-AATGCACAGCACCTTGACCTGG-30
Tol2-50inv-r2: 50-CAGTAATCAAGTAAAATTACTC-30
Tol2-30inv-f2: 50-TTTACTCAAGTAAGATTCTAG-30
Tol2-30inv-r2: 50-AAAGCAAGAAAGAAAACTAGAG-30
4. Analyze the PCR product on a 1.5% TAE-agarose gel, then purify and sequence
using primers L100-out for the 50 junction, and R100-out for the 30 junction.
L100-out: 50-AGTATTGATTTTTAATTGTA-30
R100-out: 50-AGATTCTAGCCAGATACT-30

2.2.4 Search for useful gene trap and enhancer trap fish using the zTrap
database
We developed a database zTrap (zebrafish gene trap and enhancer trap database;
http://kawakami.lab.nig.ac.jp/ztrap/) that contains the data for expression patterns
and transposon integration sites (Kawakami et al., 2010) (Fig. 5). Transgenic fish
that express Gal4FF (visualized by UAS:GFP expression) in specific cells, tissues,
and organs can be searched using the zTrap database. For instance, when you click
“heart” on the “by region” column, transgenic fish lines that show Gal4FF (GFP)
expression in the heart appear on the space in the right. Then by clicking the
FIGURE 5
The gene and enhancer trap database zTrap (http://kawakami.lab.nig.ac.jp/ztrap/).
Transgenic lines that express GFP and Gal4FF in regions of interest are shown by clicking a
region name in the left column. By clicking icons, information of the transposon insertion site
and links to the internal (z!) and ensemble (e!) browsers are seen. (See color plate)

“transposon icon,” the information about the transposon integration site can be seen
as a new tub. “z!” and “e!” icons are link to internal genome browser and ensemble
genome browser, respectively.
2.3 MATERIALS
T2KSAGFF: a gene trap construct containing the gal4ff gene downstream of a
rabbit b-globin splice acceptor (Fig. 1B).
T2KhspGFF: an enhancer trap construct containing the gal4ff gene downstream
of the zebrafish hsp70 promoter (Fig. 1B).
UAS:GFP reporter fish: transgenic fish line carrying the egfp gene downstream of
UAS (Fig. 1C).
2.4 DISCUSSION
We employed Gal4FF to develop the Gal4-UAS system in zebrafish. In previous
studies, full-length Gal4 and Gal4-VP16 were used in zebrafish. These showed
some disadvantages; namely, the transcriptional activity of the full-length Gal4
was not strong, and Gal4-VP16, which contained a strong transcription activator
domain, showed some developmental toxicity (Koster Fraser, 2001; Scheer
Campos-Ortega, 1999). We found Gal4FF could reliably induce transcription
from UAS and showed no obvious toxicity (Asakawa et al., 2008). We demonstrate
that the gene trapping and enhancer trapping are powerful to generate transgenic fish
expressing Gal4FF in various specific cells, tissues, and organs. Further, analysis of
the genomic DNA surrounding the transposon insertions identifies genes expressed
in such specific patterns.
3. TARGETED GENE EXPRESSION WITH THE Gal4-UAS
SYSTEM
3.1 RATIONALE
The Gal4-expressing transgenic fish are powerful tools to visualize and manipulate
specific cell types. For this purpose, desired reporter or effector genes should be
cloned into the multicloning site (MCS) of T2MUASMCS (Fig. 1C), and transgenic
fish carrying these genes downstream of the Gal4-binding sequence (5xUAS) and
the E1b TATA sequence should be generated. The Gal4-expressing fish and UAS-
reporter and UAS-effector fish are kept independently, and phenotypes can be
analyzed in double transgenic offspring obtained by the cross of these fish.
3.2 METHODS
3.2.1 Inhibition of neuronal activities via the Gal4-UAS system
1. The UAS:TeTxLC:CFP transgenic fish carries a gene encoding the tetanus toxin
light chain fused to the CFP gene downstream of UAS (Fig. 1C) and is used to

inhibit neuronal functions in the Gal4-expressing neurons (Asakawa et al.,
2008). The UAS:TeTxLC:CFP fish is crossed with transgenic lines that express
Gal4FF in specific subpopulations of neurons. Selection of CFP-positive
offspring will be easier if the Gal4FF-expressing fish are maintained as double
transgenic with UAS:RFP.
2. The UAS:TeTxLC:CFP fish is crossed with SAGFF36B or SAGFF31B fish that
expresses Gal4FF in the sensory neurons or interneurons in the spinal cord,
respectively. At 2 dpf, touch the tails of the embryos gently with a needle, and
take images by using a high-speed digital video camera (FASTCAM-512PC1,
Photoron, Japan). Wild-type embryos respond to the gentle touch to the tail and
swim rapidly away from the stimulus. However, the SAGFF36B;UAS:TeTxLC:
CFP embryos do not respond to the touch, and the SAGFF31B;UAS:TeTxLC:
CFP embryos show abnormal escape behaviors (Fig. 6A) (Asakawa et al.,
2008).
3.2.2 Visualization of neuronal activities via the Gal4-UAS system
1. The UAS:GCaMP7a transgenic fish carries the codon-optimized GCaMP7a
gene, encoding an improved version of the calcium indicator GCaMP, down-
stream of UAS (Fig. 1C), and is used to monitor cellular Ca2þ
concentration.
When the UAS:GCaMP7a fish is crossed with appropriate Gal4FF lines,
neuronal activities are visualized (Muto, Ohkura, Abe, Nakai, Kawakami,
2013).
2. To analyze neuronal activities in the optic tectum, the UAS:GCaMP7a fish is
crossed with the gSA2AzGFF49A fish (tectum-gal4 driver). A
gSA2AzGFF49A;UAS:GCaMP7a larva at 6 dpf and a paramecium are put in a
recording chamber under an epifluorescent microscope Imager.Z1 (Zeiss).
Images are taken by using a scientific CMOS camera (ORCA-Flash 4.0 V2,
Hamamatsu Photonics) or a cooled CCD camera (ORCA-R2, Model, Hama-
matsu Photonics) at 10 fps (Fig. 6B, left). Alternatively, the larva is immobi-
lized in agarose, and a paramecium is put in a space in front of the larva
(Fig. 6B, right). The data are analyzed with ImageJ. To quantify changes in
fluorescence intensity, divide the individual frames by a reference image (an
averaged image over all frames or an averaged image over a period with no
calcium signals).
3.2.3 Visualization of in vivo microtubule structures via the Gal4-UAS
system
1. The UAS:Gtuba2 transgenic fish carries the tuba2 gene encoding an a-tubulin
fused to the egfp gene downstream of UAS (Fig. 1C). The GFP-Tuba2 fusion
protein (Gtuba2) forms heterodimer with b-tubulin and is incorporated into
microtubule (MT) filament. Thus, the UAS:Gtuba2 fish is used to visualize MT-
based cytoskeletal structures in vivo (Asakawa Kawakami, 2010).
3. Targeted gene expression with the Gal4-UAS system 33

wild type
SAGFF36B
(sensory neurons-gal4);
UAS:TeTxLC:CFP
SAGFF31B
(interneurons-gal4);
UAS:TeTxLC:CFP
prometaphase metaphase telophase
T = 0 min 6 min 12 min
yolk
control
1046 mm2
DiAsp
cldn:gfp
48hpf
krt4p:gal4ﬀ (skin-gal4);
UAS:dkk2-rfp
405 mm2
49hpf
gSA2AzGFF49A
(tectum-gal4);
UAS:GCaMP7a
SAGFF73A
(ubiquitous-gal4);
UAS:Gtuba2
krt4p:gal4;
UAS:dkk2-rfp
DiAsp
cldn:gfp
(A)
(B)
(C)
(D)
FIGURE 6
Targeted expression via the Gal4FF-UAS system. (A) Inhibition of neuronal activities via the
Gal4-UAS system. A wild-type embryo at 2 dpf rapidly escapes from a gentle touch to the tail.
The SAGFF36B;UAS:TeTxLC:CFP fish, which expresses TeTxLC:CFP in the sensory neurons,
does not respond to the touch. The SAGFF31B;UAS:TeTxLC:CFP fish, which expresses
TeTxLC:CFP in subsets of interneurons and motor neurons, responds to the touch but shows
abnormal escape swimming. (B) Visualization of neuronal activities via the Gal4-UAS system.
The gSA2AzGFF49A;UAS:GCaMP7a larva at 6 dpf expresses the calcium indicator
GCaMP7a in the optic tectum. (Left) Calcium signal in the right tectum of a freely behaving

Another Random Scribd Document
with Unrelated Content

The Project Gutenberg eBook of The Impudent
Comedian, Others

This ebook is for the use of anyone anywhere in the United States
and most other parts of the world at no cost and with almost no
restrictions whatsoever. You may copy it, give it away or re-use it
under the terms of the Project Gutenberg License included with this
ebook or online at www.gutenberg.org. If you are not located in the
United States, you will have to check the laws of the country where
you are located before using this eBook.
Title: The Impudent Comedian, Others
Author: Frank Frankfort Moore
Release date: May 1, 2016 [eBook #51923]
Most recently updated: October 23, 2024
Language: English
Credits: Produced by David Widger from page images generously
provided by Google Books
*** START OF THE PROJECT GUTENBERG EBOOK THE IMPUDENT
COMEDIAN, OTHERS ***

By Frank Frankfort Moore
Herbert S. Stone Co
1897

CONTENTS
THE IMPUDENT COMEDIAN
KITTY CLIVE, ACTRESS

A QUESTION OF ART
THE MUSE OF TRAGEDY
THE WAY TO KEEP HIM
THE CAPTURE OF THE DUKE

N
THE IMPUDENT COMEDIAN
elly—Nelly—Nell! Now, where's the wench?” cried Mrs. Gwyn,
before she had more than passed the threshold of her
daughter's house in St. James's Park—the house with the
terrace garden, where, as the sedate Evelyn records, the charming
Nelly had stood exchanging some very lively phrases with her royal
lover on the green walk below, giving the grave gentleman cause to
grieve greatly. But, alas! the record of his sorrow has only made his
untold readers mad that they had not been present to grieve, also,
over that entrancing tableau. “Nelly—Nell! Where's your mistress,
sirrah?” continued the somewhat portly and undoubtedly
overdressed mother of the “impudent comedian,” referred to by
Evelyn, turning to a man-servant who wore the scarlet livery of the
king.
“Where should she be, madam, at this hour, unless in the hands of
her tirewomen? It is but an hour past noon.”
“You lie, knave! She is at hand,” cried the lady, as the musical lilt
of a song sounded on the landing above the dozen shallow oak
stairs leading out of the square hall, and a couple of fat spaniels, at
the sound, lazily left their place on a cushion, and waddled towards
the stairs to meet and greet their mistress.
She appeared in the lobby, and stood for a moment or two looking
out of a window that commanded a fine view of the trees outside—
they were in blossom right down to the wall. She made a lovely
picture, with one hand shading her eyes from the sunlight that
entered through the small square panes, singing all the time in pure
lightness of heart. She wore her brown hair in the short ringlets of
the period, and they danced on each side of her face as if they were
knowing little sprites for whose ears her singing was meant.

“Wench!” shouted her mother from below. The sprites that danced
to the music of the mother's voice were of a heavier order
altogether.
“What, mother? I scarce knew that you were journeying hither to-
day,” cried Nelly, coming down the stairs. “'T is an honour, and a
surprise as well; and, i' faith, now that I come to think on't, the
surprise is a deal greater than the honour. If you say you have n't
come hither for more money, my surprise will be unbounded.”
It was nothing to Nelly that she spoke loud enough to be heard by
the footmen in the hall, as well as by the servants in the kitchen.
She knew that they knew all about her, and all about her mother as
well. Perhaps some of them had bought oranges from her or her
mother in the old days at Drury Lane, before she had become
distinguished as an actress, and in other ways.
“I 'm not come for money, though a trifle would be welcome,” said
the mother, when Nelly had shown her the way into one of the
rooms opening off a corridor at one side of the hall—a large
apartment, furnished with ludicrous incongruity. A lovely settee,
made by the greatest artist in France, and upholstered in bright
tapestry, was flanked by a couple of hideous chairs made by the
stage carpenter of Drury Lane, and by him presented to Nelly. A pair
of Sèvres vases, which had for some years been in St. James's
Palace stood on a side-board among some rubbish of porcelain that
Nelly had picked up in the purlieus of Westminster.
The mother was about to seat herself heavily on the gilded settee,
when Nelly gave a little scream, startling the elder lady so that she,
too, screamed—a little hoarsely—in sympathy.
“What's the matter, girl—what's the matter?” she cried.
“Nothing is the matter, so far, mother, but a mighty deal would
have been the matter, if you had seated yourself other where than in
that chair.'Snails, madam, who are you that you should plump your
person down on a seat that was made for a legitimate monarch?”
“I'm a legitimate wife, hear you that, you perky wench?” cried the
mother, craning her neck forward after the most approved fashion of

pending belligerents at Lewkinor Street, Drury Lane.
“The greater reason you should avoid that settee, dear mother; it
has never been other than the chattel of a prince,” laughed Nelly.
“And now, prithee, why the honour of this visit, while the month is
not yet near its close?”
“I have met with an old friend of yours, this day, Nell,” said the
mother, “and he is coming hither,—'t is that hath brought me.”
“An old friend! I' faith, good mother, 't is the young friends are
more to my taste. The savour of Lewkinor Street doth not smell
sweet, and it clings most foully to all our old friends.”
“Oh, ay, but you once was n't so dainty a madam!”
“'T were vain to deny it, mother, since it can be urged against me
that I became your daughter. No, no, good mother, friend me no old
friends—I like them new—the newer the better—plenty of gilding—
none of it rubbed off—gingerbread and courtiers—plenty of gilding,
and plenty of spice beneath. But the old life in Lewkinor Street—in
the coal-yard—ah! 't was like to sour oranges, mother, thick skin
above, and sourness under. 'Snails! it doth set my teeth on edge to
think of it.”
“Oh, ay; but now and again we lighted upon a Levant orange in
the midst of a basketful—a sweet one to suck, and one to leave a
sweet taste behind it.”
“The best were mightily improved by the addition of a lump of
sugar. But what hath all this vegetable philosophy to do with your
visit to me to-day? If you mean to stay, I'll send out for a couple of
stone of sugar without delay!”
“Philosophy, Madame Impudence! You accuse your mother of
philosophy, when everyone knows that your own language was—”
“Worthy of a lady of quality, mother. It seemeth that you are
anxious to hear whether or not I retain anything of my old skill in
that direction, and by my faith, dear mother, you shall learn more
than will satisfy your curiosity, if you beat about the bush much
longer. Whom say you that you met to-day?”

“What should you say if I told you that his name was Dick
Harraden?”
“What, Dick! Dick!—Dick Harraden!”
Nell had sprung to her feet, and had grasped her mother by the
shoulder, eagerly peering into her face. After a moment of silence
following her exclamation, she gave her mother a little push, in the
act of taking her hand off her shoulder, and threw herself back in her
own chair again with a laugh—a laugh that surrounded a sigh, as a
bright nimbus surrounds the sad face of a saint in a picture.
“What should I say, do you ask me?” she cried. “Well, I should say
that you were a liar, good mother.” Nell was never particular in her
language. As an exponent of the reaction against the Puritanism of
the previous generation, she was admitted by very competent
judges to have scarcely an equal.
“I'm no liar,” said the mother. “'T was Dick himself I met, face to
face.”
“It puzzles me to see wherein lies your hope of getting money
from me by telling me such a tale,” said Nell.
“I want not your money—at least not till the end of the month, or
thereabouts. I tell you, I saw Dick within the hour.”
“'T was his ghost. You know that when he threw away his link he
took to the sea, and was drowned in a storm off the Grand Canary.
What did the seafaring man tell us when I asked him if he had seen
Dick?”
“A maudlin knave, who offered you a guinea for a kiss at the pit
door of Drury Lane, and then bought a basket of oranges and gave
them away singly to all comers.”
“But he said he had sailed in the same ship as Dick, and that it
had gone down with all aboard save only himself.”
“Oh, ay; and he wept plentifully when he saw how you wept—ay,
and offered to be your sweetheart in the stead of poor Dick, the
knave! For I saw Dick with these eyes, within the hour.”
“Oh, mother—and you told him—no, you durs n't tell him—”

“He had just this morning come to London from the Indies, and it
was luck—ill-luck, maybe—that made him run against me. He plied
me with question after question—all about Nell—his Nell, he called
you, if you please.”
“His Nell—ah, mother! his Nell! Well, you told him—”
“I told him that you would never more need his aid to buy foot-
gear. Lord! Nell, do you mind how he bought you the worsted
stockings when you were nigh mad with the chilblains?”
“And you told him... For God's sake, say what you told him!”
“I did n't mention the king's name—no, I'm loyal to his Majesty,
God save him! I only told him that you had given up selling oranges
in the pit of Drury Lane, and had taken to the less reputable part of
the house, to wit, the stage.”
“Poor Dick! he did n't like to hear that. Oh, if he had stayed at
home and had carried his link as before, all would have been well!”
“What is the wench talking about? Well—all would have been well?
And is not all well, you jade? 'T were rank treason to say else. Is n't
this room with its gilded looking-glasses and painted vases pretty
well for one who had been an orange girl? The king is a gentleman,
and a merry gentleman, too. Well, indeed!”
“But Dick!—what more did you say to him, mother?”
“I asked him after himself, to be sure. I' faith the lad has
prospered, Nell—not as you have prospered, to be sure—”
“Nay, not as I have prospered.”
“Of course not; but still somewhat. He will tell you all, himself.”
“What? You told him where I dwelt?”
“'I meant it not, Nelly; but he had it from me before I was aware.
But he knows nothing. I tell you he only came to London from Bristol
port in the morning. He will have no time to hear of the king and the
king's fancies before he sees you.”
“He is coming hither, then? No, he must not come! Oh, he shall
not come! Mother, you have played me false!”

“I? Oh, the wench is mad! False? What could I say, girl, when he
pressed me?”
“You could have said that I was dead—that would have been the
truth. The girl he knew is dead. He must not come to this house.”
“Then give your lacqueys orders not to admit him, and all will be
well. But I thought that you would e'en see the lad, Nell, now that
he has prospered. If he had n't prospered it would be different.”
“Only an orange-seller, and yet with the precepts of a lady of
quality! I'll not see him. Did he say he'd come soon?”
“Within an hour, he said.” Instinctively, Nell looked at her reflection
in a mirror.
“I'll not see him,” she repeated. “That gown will do well enough
for one just returned from the Indies,” said the mother, with a leer.
“Oh, go away, go away,” cried her daughter. “You have done
enough mischief for one morning. Why could not you have let things
be? Why should you put this man on my track?”
“'T is a fool that the wench is, for all her smartness,” said the
mother. “She was picked out of the gutter and set down among the
noblest in the land, and all that held on to her gown were landed in
pleasant places; and yet she talks like a kitchen jade with no sense.
If you will not see the lad, hussy, lock your door and close your
shutters, after giving orders to your lacqueys to admit him not. If
needful, the king can be petitioned to send a guard to line the Park
with their pikes to keep out poor Dick, as though he was the devil,
and the Park the Garden of Eden.”
“Oh, go away—go away!”
“Oh, yes; I 'll go—and you 'll see him, too—no fear about that. A
girl, however well provided for—and you're well provided for—would
n't refuse to see an old sweetheart, if he was the old serpent
himself; nay, she'd see him on that account alone. And so good day
to you, good Mistress Eve.”
She made a mock courtesy, the irony of which was quite as broad
as that of her speech, and marched out of the room, holding her

narrow skirts sufficiently high to display a shocking pair of flat-footed
boots beneath.
Her daughter watched her departure, and only when she had
disappeared burst into a laugh. In a moment she was grave once
again. She remained seated without changing her attitude or
expression for a long time. At last she sprang to her feet, saying out
loud, as though some one were present to hear her:
“What a fool thou art, friend Nell, to become glum over a boy
sweetheart—and a link boy, of all boys. Were I to tell Mr. Dryden of
my fancy, he would write one of his verses about it, making out that
poor Dick was the little god Cupid in disguise, and that his link was
the torch of love. But I'll not see him.'T were best not. He'll hear all,
soon enough, and loathe me as at times I loathe myself—no, no; not
so much as that, not so much as that: Dick had always a kind heart.
No; I'll not see him.” She went resolutely to the bell-pull, but when
there, stood irresolute with the ornamental ring of brass in her hand,
for some moments before pulling it. She gave it a sudden jerk, and
when it was responded to by a lacquey, she said:
“Should a man call asking to see me within the next hour, he is to
be told—with civility, mind you: he is a gentleman—that—that I am
in this room, and that I will see him for five minutes—only five
minutes, mind you, sirrah.”
“And the man—the gentleman—is to be admitted, madam?”
“Certainly—for five minutes.”
“Your ladyship will regulate the time?”
“Go away, you numbskull! How could I regulate the time? I'm no
astronomer.”
“Madam, I meant but to inquire if you are to be interrupted at the
end of five minutes.”
“I gave you no such instruction, sirrah. It is enough for you to
carry out the instruction I gave you. Carry it out, and yourself in the
bargain.”

The man bowed and withdrew. He was familiar with the colloquial
style of his mistress and her moods.
When the man had gone Nelly laughed again, but suddenly
became graver even than she had yet been.
“What have I done?” she cried. “Oh, there never was so great a
fool as me! No, no; I'll not see him! I have as kind a heart as Dick,
and I'll prove it by not seeing him.”
And yet, when she had her hand on the lock of the door, she
stood irresolute once again for some moments. Then she went out
with a firm step, her intention being to countermand in the hall the
instructions she had given to the servant in the parlour; but in the
hall she found herself face to face with her old friend, Sir Charles
Sedley. He had brought her a bunch of violets.
“The satyr offers flowers to Aurora,” said the courtier to the
courtesan, bowing as gracefully as a touch of rheumatism permitted.
“And Aurora was so fond of flowers that she accepted them, even
from the most satiric of satyrs,” said Nell, sinking into a courtesy.
“I plucked these flowers for the fairest flower that—”
“Ah, that is one of Mr. Dryden's images in the reverse,” laughed
Nell. “What was the name of t' other young thing?—Proserpine,
that's it—who was plucking flowers, and was herself plucked. 'Snails!
that's not the word—she was n't a fowl.”
“'Fore Gad, Nell, I never heard that story; it sounds scandalous, so
tell it us,” said Sir Charles. “What was the name of the wench, did
you say?”
“Her name was Nell Gwyn, and she was gathering oranges to sell
in the pit of Drury Lane, when, some say Satan, and some say
Sedley—the incongruity between the two accounts is too trifling to
call for notice—captivated her, and she had nothing more to do with
oranges or orange blossoms.”
“And her life was all the merrier, as I doubt not Madame
Proserpine's was when she left the vale of Enna for—well, the Pit—
not at Drury Lane.”

“That were a darker depth still. You 've heard the story, then. Mr.
Dryden says the moral of it is that the devil has got all the pretty
wenches for himself.”
“Not so; he left a few for the king.”
“Nay, the two are partners in the game; but the King, like t' other
monarch, is not so black as he is painted.”
“Nor so absolutely white as to be tasteless as the white of an egg,
Nell.”
“His Majesty is certainly not tasteless.”
“On the contrary, he is in love with you still, Nell.”
They were standing apart from the group of servants in the hall.
Nell Gwyn had pretended that she was about to ascend the stairs,
but loitered on the second step, with her right elbow resting on the
oak banister, while she smelt at the violets with her head poised
daintily, looking with eyes full of mischief and mirth at the courtier
standing on the mat, the feathers of his broad-leafed hat sweeping
the ground, as he swung it in making his bows.
Suddenly Nell straightened herself as she looked down the hall
toward the door; she started and dropped her violets. All the
mischief and mirth fled from her eyes as a man was admitted, with
some measure of protestation, by the porter. He was a young man
with a very brown face, and he carried no sword, only the hanger of
a sailor; his dress was of the plainest—neither silk nor lace entered
into its manufacture.
Before Sir Charles had time to turn to satisfy himself as to the
identity of the man at whom Nell was gazing so eagerly, she had run
down the hall, and seized the newcomer by both hands, crying:
“Dick—Dick—It is you, yourself, Dick, and no ghost!”
“No ghost, I dare swear, Nell,” cried the man, in a tone that made
the candles in the chandelier quiver, and Sir Charles Sedley to be all
but swept off his feet. “No ghost, but—O Lord, how you've grown,
Nell! Why, when I burnt my last link seeing you home, you was only
so high!” He put his hand within a foot of the floor.

“And you, too, Dick! Why, you're a man now—you'll grow no more,
Dick,” cried Nell, still standing in front of him, 'with his hands fast
clasped in her own. Suddenly recollecting the servants who were
around, she dropped his hands, saying: “Come along within, Dick,
and tell me all your adventures since last we were together.”
“Lord! Adventures! You do n't know what you 've set yourself
down for, Nell. If I was to tell you all, I should be in your company
for at least a week.”

She led him past Sir Charles Sedley, without so much as glancing
at the courtier, and the newcomer had no eyes for anyone save Nell.
A servant threw open the door of the room where she had been with
her mother, and the two entered.
Sir Charles took snuff elaborately, after he had replaced his hat on
his head.
“If his Majesty should arrive, let him know that I am in the long
parlour,” he said to a servant, as he walked toward a door on the
left.
He paused for a space with his hand on the handle of the door, for
there came from the room into which Nell Gwyn and Dick Harraden
had gone a loud peal of laugh ter—not a solo, but a duet.
He turned the handle.
So soon as he had disappeared, there came another ripple of
laughter from the other room, and the lacqueys lounging in the hall
laughed, too. Within the room, Nell was seated on the settee and
Dick Harraden by her side. She had just reminded him of the gift of
the worsted stockings which he had made to her, when he was a
link-boy, and she an orange-girl in Drury Lane. They had both
laughed when she had pushed out a little dainty shoe from beneath
her gown, displaying at the same time a tolerably liberal amount of
silk stocking, as she said:
“Ah, Dick, it 's not in worsted my toes are clad now. I have
outgrown your stockings.”
“Not you, Nell!” he cried. “By the Lord Harry! your feet have got
smaller instead of larger during these years—I swear to you that is
so.”
“Ah, the chilblains do make a difference, Dick,” said she, “and you
never saw my feet unless they were covered with chilblains. Lord!
how you cried when you saw my feet well covered for the first time.”
“Not I—-I didn't cry. What was there to cry about, Nell?” he said.
She felt very much inclined to ask him the same question at that
moment, for his face was averted from her, and he had uttered his

words spasmodically.
“Poor Dick! You wept because you had eaten nothing for three
days in order to save enough to buy my stockings,” she said.
“How know you that?” he cried, turning to her suddenly.
“I knew it not at the time,” she replied, “but I have thought over it
since.”
“Think no more of it, Nell. O Lord! to think that I should live to see
Nell again! No—no; I'll not believe it. That fine lady that I see in the
big glass yonder cannot be Nell Gwyn!”
“Oh, Dick, would any one but Nell Gwyn remember about Nell
Gwyn's chilblains?”
“Hearsay, mere hearsay, my fine madam!”
“By what means shall I convince you that I'm the Nell you knew?
Let me see—ah, I know. Dick, I 'll swear for you; you know well that
there was not one could match me in swearing. Let me but begin.”
“O Lord! not for the world. You always knew when to begin, Nell,
but you ne'er knew when to stop. And how doth it come that you
have n't forgot the brimstone of the Lane, Nelly, though you have
become so mighty fine a lady?”
“'Snails, Dick, the best way to remember a language is to keep
constantly talking it!”
“But in silks and satins?”
“Oh, I soon found that I only needed to double the intensity of my
language in the Lane in order to talk the mother tongue of fashion.”
“If swearing make the fine lady, you'll be the leader of the town,
Nell, I'll warrant. But do n't say that you doubled your language—
that would be impossible.”
“Oh, would it, indeed?”
“Not so? Then for God's sake do n't give me a sample of what you
reached in that way, for I 've only lived among the pirates and
buccaneers of the Indies since.”

Welcome to our website – the ideal destination for book lovers and
knowledge seekers. With a mission to inspire endlessly, we offer a
vast collection of books, ranging from classic literary works to
specialized publications, self-development books, and children's
literature. Each book is a new journey of discovery, expanding
knowledge and enriching the soul of the reade
Our website is not just a platform for buying books, but a bridge
connecting readers to the timeless values of culture and wisdom. With
an elegant, user-friendly interface and an intelligent search system,
we are committed to providing a quick and convenient shopping
experience. Additionally, our special promotions and home delivery
services ensure that you save time and fully enjoy the joy of reading.
Let us accompany you on the journey of exploring knowledge and
personal growth!
ebookultra.com

The Zebrafish Genetics Genomics and Transcriptomics 4th Edition H. William Detrich

More Related Content

Similar to The Zebrafish Genetics Genomics and Transcriptomics 4th Edition H. William Detrich (20)

Recently uploaded (20)

The Zebrafish Genetics Genomics and Transcriptomics 4th Edition H. William Detrich