SlideShare a Scribd company logo
Data Mining and machine
Learning (CSE 321)
Summer 2021
Topic – 2: Data
Types of Data
Data Quality
Data Preprocessing
Measures of Similarity and Dissimilarity
Topic Contents
Recommended Reading
“Introduction to Data Mining,” Pang-Ning
Tan, Michael Steinbach and Vipin Kumar,
Addison Wesley, 2006.
 Chapter 2 (Data)
3
3
Types of Data
What is Data?
• Collection of data objects and
their attributes
• An attribute is a property or
characteristic of an object
– Examples: eye color of a person,
temperature, etc.
– Attribute is also known as variable,
field, characteristic, or feature
• A collection of attributes
describe an object
– Object is also known as record,
point, case, sample, entity, or
instance
5
Tid Refund Marital
Status
Taxable
Income Cheat
1 Yes Single 125K No
2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10
Attributes
Objects
Attribute Values
• Attribute values are numbers or symbols
assigned to an attribute
• Distinction between attributes and attribute
values
– Same attribute can be mapped to different
attribute values
• Example: height can be measured in feet or meters
– Different attributes can be mapped to the same set
of values
• Example: Attribute values for ID and age are integers
• But properties of attribute values can be different
– ID has no limit but age has a maximum and minimum value
6
Types of Attributes
• There are different types of attributes
– Nominal (Categorical)
• Examples: ID numbers, eye color, zip codes
– Ordinal
• Examples: rankings (e.g., taste of potato chips on a scale
from 1-10), grades, height in {tall, medium, short}
– Interval
• Examples: calendar dates, temperatures in Celsius or
Fahrenheit.
– Ratio
• Examples: temperature in Kelvin, length, time, counts
7
Properties of Attribute Values
• The type of an attribute depends on which of the
following 4 properties it possesses:
– Distinctness: =
– Order: < >
– Addition: + -
– Multiplication: * /
• Attributes with Properties
– Nominal attribute: distinctness
– Ordinal attribute: distinctness & order
– Interval attribute: distinctness, order & addition
– Ratio attribute: all 4 properties
8
Attribute
Type
Description Examples Operations
Nominal The values of a nominal attribute are
just different names, i.e., nominal
attributes provide only enough
information to distinguish one object
from another. (=, )
zip codes, employee
ID numbers, eye color,
sex: {male, female}
mode, entropy
Ordinal The values of an ordinal attribute
provide enough information to order
objects. (<, >)
hardness of minerals,
{good, better, best},
grades, street numbers
median, percentiles
Interval For interval attributes, the
differences between values are
meaningful, i.e., a unit of
measurement exists.
(+, - )
calendar dates,
temperature in Celsius
or Fahrenheit
mean, standard
deviation
Ratio For ratio variables, both differences and
ratios are meaningful. (*, /)
temperature in Kelvin,
monetary quantities,
counts, age, mass,
length, electrical
current
9
Attribute
Level
Transformation Comments
Nominal Any permutation of values If all employee ID numbers
were reassigned, would it
make any difference?
Ordinal An order preserving change of
values, i.e.,
new_value = f(old_value)
where f is a monotonic function.
An attribute encompassing
the notion of good, better
best can be represented
equally well by the values
{1, 2, 3} or by { 0.5, 1,
10}.
Interval new_value =a * old_value + b
where a and b are constants
Thus, the Fahrenheit and
Celsius temperature scales
differ in terms of where
their zero value is and the
size of a unit (degree).
Ratio new_value = a * old_value Length can be measured in
meters or feet.
10
Discrete and Continuous
Attributes
• Discrete Attribute
– Has only a finite or countably infinite set of values
– Examples: zip codes, counts, or the set of words in a collection of
documents
– Often represented as integer variables.
– Note: binary attributes are a special case of discrete attributes
• Continuous Attribute
– Has real numbers as attribute values
– Examples: temperature, height, or weight.
– Practically, real values can only be measured and represented
using a finite number of digits.
– Continuous attributes are typically represented as floating-point
variables.
11
Important Characteristics of
Structured Data
–Dimensionality
• Curse of Dimensionality
• What is the curse of dimensionality?
–Sparsity
• Only presence counts
• Given me an example of data that is probably sparse
–Resolution
• Patterns depend on the scale
• Give an example of how changing resolution can help
– Hint: think about weather patterns, rainfall over a time
period 12
Types of data sets
• Record
– Data Matrix
– Document Data
– Transaction Data
• Graph
– World Wide Web
– Molecular Structures
• Ordered
– Spatial Data
– Temporal Data
– Sequential Data
– Genetic Sequence Data
13
Record Data
• Data that consists of a collection of records,
each of which consists of a fixed set of
attributes
14
Tid Refund Marital
Status
Taxable
Income Cheat
1 Yes Single 125K No
2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10
Data Matrix
• If data objects have the same fixed set of numeric
attributes, then the data objects can be thought of as
points in a multi-dimensional space, where each
dimension represents a distinct attribute
• Such data set can be represented by an m by n matrix,
where there are m rows, one for each object, and n
columns, one for each attribute
15
1.1
2.2
16.22
6.25
12.65
1.2
2.7
15.22
5.27
10.23
Thickness
Load
Distance
Projection
of y load
Projection
of x Load
1.1
2.2
16.22
6.25
12.65
1.2
2.7
15.22
5.27
10.23
Thickness
Load
Distance
Projection
of y load
Projection
of x Load
Document Data
• Each document becomes a `term' vector,
– each term is a component (attribute) of the vector,
– the value of each component is the number of times
the corresponding term occurs in the document.
16
Document 1
season
timeout
lost
wi
n
game
score
ball
pla
y
coach
team
Document 2
Document 3
3 0 5 0 2 6 0 2 0 2
0
0
7 0 2 1 0 0 3 0 0
1 0 0 1 2 2 0 3 0
Transaction Data
• A special type of record data, where
– each record (transaction) involves a set of items.
– For example, consider a grocery store. The set of
products purchased by a customer during one shopping
trip constitute a transaction, while the individual
products that were purchased are the items.
17
TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk
Graph Data
• Examples: Generic graph and HTML Links
18
5
2
1
2
5
<a href="papers/papers.html#bbbb">
Data Mining </a>
<li>
<a href="papers/papers.html#aaaa">
Graph Partitioning </a>
<li>
<a href="papers/papers.html#aaaa">
Parallel Solution of Sparse Linear System of Equations </a>
<li>
<a href="papers/papers.html#ffff">
N-Body Computation and Dense Linear System Solvers
Chemical Data
• Benzene Molecule: C6H6
19
Ordered Data
• Sequences of transactions
20
An element of
the sequence
Items/Events
Ordered Data
• Genomic sequence data
21
GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG
Ordered Data
22
• Spatio-Temporal Data
Average Monthly
Temperature of
land and ocean
Data Quality
Data Quality
• What kinds of data quality problems?
• How can we detect problems with the data?
• What can we do about these problems?
• Examples of data quality problems:
– Noise and outliers
– missing values
– duplicate data
24
Noise
• Noise refers to modification of original values
– Examples: distortion of a person’s voice when talking
on a poor phone and “snow” on television screen
25
Two Sine Waves Two Sine Waves + Noise
Outliers
• Outliers are data objects with characteristics that are
considerably different than most of the other data
objects in the data set
26
Missing Values
• Reasons for missing values
– Information is not collected
(e.g., people decline to give their age and weight)
– Attributes may not be applicable to all cases
(e.g., annual income is not applicable to children)
• Handling missing values
– Eliminate Data Objects
– Estimate Missing Values
– Ignore the Missing Value During Analysis
– Replace with all possible values (weighted by their
probabilities)
27
Duplicate Data
• Data set may include data objects that are
duplicates, or almost duplicates of one
another
– Major issue when merging data from
heterogeneous sources
• Examples:
– Same person with multiple email addresses
• Data cleaning
– Process of dealing with duplicate data issues
28
Data Preprocessing
Data Preprocessing
• Aggregation
• Sampling
• Dimensionality Reduction
• Feature subset selection
• Feature creation
• Discretization and Binarization
• Attribute Transformation
30
Aggregation
• Combining two or more attributes (or objects)
into a single attribute (or object)
• Purpose
– Data reduction
• Reduce the number of attributes or objects
– Change of scale
• Cities aggregated into regions, states, countries, etc
– More “stable” data
• Aggregated data tends to have less variability
31
Aggregation
32
Standard Deviation of Average
Monthly Precipitation
Standard Deviation of Average
Yearly Precipitation
Variation of Precipitation in Australia
Sampling
• Sampling is often used for data selection
– It is often used for both the preliminary investigation of the
data and the final data analysis.
• Statisticians sample because obtaining the entire set of
data of interest is too expensive or time consuming
• Sampling is used in data mining because processing
the entire set of data of interest is too expensive or
time consuming
33
Sampling …
• The key principle for effective sampling is the
following:
– using a sample will work almost as well as using the
entire data sets, if the sample is representative
• May not be true if have relatively little data or are looking
for rare cases or dealing with skewed class distributions
• Learning curves can help assess how much data is needed
– A sample is representative if it has approximately the
same property (of interest) as the original set of data
• However, there are times when one purposefully
skews the sample
34
Types of Sampling
• Simple Random Sampling
– There is an equal probability of selecting any particular item
• Sampling without replacement
– As each item is selected, it is removed from the population
• Sampling with replacement
– Objects are not removed from the population as they are
selected for the sample.
• In sampling with replacement, the same object can be picked up
more than once
• Stratified sampling
– Split the data into several partitions; then draw random
samples from each partition
35
Sample Size
36
8000 points 2000 Points 500 Points
Sample Size
• What sample size is necessary to get at least one
object from each of 10 groups.
37
Curse of Dimensionality
• When dimensionality
increases, data
becomes increasingly
sparse in the space that
it occupies
• Definitions of density
and distance between
points, which is critical
for clustering and
outlier detection,
become less meaningful 38
• Randomly generate 500 points
• Compute difference between max and min
distance between any pair of points
Dimensionality Reduction
• Purpose:
– Avoid curse of dimensionality
– Reduce amount of time and memory required by
data mining algorithms
– Allow data to be more easily visualized
– May help to eliminate irrelevant features or
reduce noise
39
Feature Subset Selection
• Another way to reduce dimensionality of data
• Redundant features
– duplicate much or all of the information contained in one
or more other attributes
– Example: purchase price of a product and the amount of
sales tax paid
• Irrelevant features
– contain no information that is useful for the data mining
task at hand
– Example: students' ID is often irrelevant to the task of
predicting students' GPA
40
Feature Subset Selection
• Techniques:
– Brute-force approach:
• Try all possible feature subsets as input to DM algorithm
– Embedded approaches:
• Feature selection occurs naturally as part of the data
mining algorithm (decision trees)
– Filter approaches:
• Features are selected before data mining algorithm is run
– Wrapper approaches:
• Use the data mining algorithm as a black box to find best
subset of attributes
41
Feature Creation
• Create new attributes that can capture the
important information in a data set much
more efficiently than the original attributes
• Three general methodologies:
– Feature Extraction
• domain-specific
– Mapping Data to New Space
– Feature Construction
• combining features
– Example: calculate density from volume and mass
42
Discretization without Using
Class Labels
43
Data Equal interval width
Equal frequency K-means
Attribute Transformation
44
• A function that maps the entire set of values of a
given attribute to a new set of replacement values
such that each old value can be identified with one of
the new values
– Simple functions: xk, log(x), ex, |x|
– Standardization and Normalization
Measures of Similarity and
Dissimilarity
Similarity and Dissimilarity
• Why might you need to measure these things?
• Similarity
– Numerical measure of how alike two data objects are
– Is higher when objects are more alike
– Often falls in the range [0,1]
• Dissimilarity
– Numerical measure of how different are two data objects
– Lower when objects are more alike
– Minimum dissimilarity is often 0, upper limit varies
• Proximity refers to a similarity or dissimilarity
• How would you measure these?
46
Euclidean Distance
• Euclidean Distance
Where n is the number of dimensions (attributes) and pk
and qk are, respectively, the kth attributes (components)
or data objects p and q.
• Standardization is necessary, if scales differ.
47




n
k
k
k q
p
dist
1
2
)
(
Euclidean Distance
48
0
1
2
3
0 1 2 3 4 5 6
p1
p2
p3 p4
point x y
p1 0 2
p2 2 0
p3 3 1
p4 5 1
Distance Matrix
p1 p2 p3 p4
p1 0 2.828 3.162 5.099
p2 2.828 0 1.414 3.162
p3 3.162 1.414 0 2
p4 5.099 3.162 2 0
Minkowski Distance
• Minkowski Distance is a generalization of Euclidean
Distance
Where r is a parameter, n is the number of dimensions
(attributes) and pk and qk are, respectively, the kth
attributes (components) or data objects p and q.
49
r
n
k
r
k
k q
p
dist
1
1
)
|
|
( 



Minkowski Distance: Examples
• r = 1. City block (Manhattan, L1 norm) distance.
– A common example is the Hamming distance, which is the number of
bits that are different between two objects that have only binary
attributes, i.e., between two binary vectors.
50
CSEDIU
Minkowski Distance: Examples
51
Minkowski Distance
52
Distance Matrix
point x y
p1 0 2
p2 2 0
p3 3 1
p4 5 1
L1 p1 p2 p3 p4
p1 0 4 4 6
p2 4 0 2 4
p3 4 2 0 2
p4 6 4 2 0
L2 p1 p2 p3 p4
p1 0 2.828 3.162 5.099
p2 2.828 0 1.414 3.162
p3 3.162 1.414 0 2
p4 5.099 3.162 2 0
L p1 p2 p3 p4
p1 0 2 3 5
p2 2 0 1 3
p3 3 1 0 2
p4 5 3 2 0
Similarity between Binary Vectors
• Common situation is that objects, p and q, have only binary
attributes
• Compute similarities using the following quantities
M01 = the number of attributes where p was 0 and q was 1
M10 = the number of attributes where p was 1 and q was 0
M00 = the number of attributes where p was 0 and q was 0
M11 = the number of attributes where p was 1 and q was 1
• Simple Matching and Jaccard Coefficients
SMC = number of matches / number of attributes
= (M11 + M00) / (M01 + M10 + M11 + M00)
J = number of 11 matches / number of not-both-zero attributes values
= (M11) / (M01 + M10 + M11)
• Useful when almost all values are 0, since SMC would always be close to 1
53
SMC versus Jaccard: Example
p = 1 0 0 0 0 0 0 0 0 0
q = 0 0 0 0 0 0 1 0 0 1
M01 = 2 (the number of attributes where p was 0 and q was 1)
M10 = 1 (the number of attributes where p was 1 and q was 0)
M00 = 7 (the number of attributes where p was 0 and q was 0)
M11 = 0 (the number of attributes where p was 1 and q was 1)
SMC = (M11 + M00)/(M01 + M10 + M11 + M00)
= (0+7) / (2+1+0+7)
= 0.7
J = (M11) / (M01 + M10 + M11) = 0 / (2 + 1 + 0) = 0 54
Cosine Similarity
• If d1 and d2 are two document vectors, then
cos( d1, d2 ) = (d1 d2) / ||d1|| ||d2|| ,
where indicates vector dot (aka inner) product and ||d || is the length of
vector d (i.e., the square root of the vector dot product)
• Example:
d1 = 3 2 0 5 0 0 0 2 0 0
d2 = 1 0 0 0 0 0 0 1 0 2
d1 d2= 3*1 + 2*0 + 0*0 + 5*0 + 0*0 + 0*0 + 0*0 + 2*1 + 0*0 + 0*2 = 5
||d1|| = (3*3+2*2+0*0+5*5+0*0+0*0+0*0+2*2+0*0+0*0)0.5 = (42) 0.5 = 6.481
||d2|| = (1*1+0*0+0*0+0*0+0*0+0*0+0*0+1*1+0*0+2*2)0.5 = (6) 0.5 = 2.245
cos( d1, d2 ) = .3150
A value close to 1 means the vectors are similar and a value near 0
mean they are nearly totally dissimilar.
55
Ways to Visualize Data
• Data visualization tools are not Data Mining,
but can be used in the data mining process
• What kinds of tools are there?
– Bar charts and histrograms, scatter plots, pie
charts, etc.
– From kdnuggets.com I found this interesting site:
• http://services.alphaworks.ibm.com/manyeyes/home
56
Wk. 3.  Data [12-05-2021] (2).ppt

More Related Content

PPTX
Pengertian data dan Informasi pada mata kuliah analisa data
PPTX
Data types and Attributes1 (1).pptx
PPTX
Data mining Basics and complete description
PDF
Lecture 2 - Data Mining (Data mining).pdf
PDF
Data Mining - Introduction and Data
DOCX
Data Mining DataLecture Notes for Chapter 2Introduc.docx
DOCX
Data Mining DataLecture Notes for Chapter 2Introduc
PPTX
2-Data Preprocessing techniques Data minig.pptx
Pengertian data dan Informasi pada mata kuliah analisa data
Data types and Attributes1 (1).pptx
Data mining Basics and complete description
Lecture 2 - Data Mining (Data mining).pdf
Data Mining - Introduction and Data
Data Mining DataLecture Notes for Chapter 2Introduc.docx
Data Mining DataLecture Notes for Chapter 2Introduc
2-Data Preprocessing techniques Data minig.pptx

Similar to Wk. 3. Data [12-05-2021] (2).ppt (20)

PDF
Lect 2 getting to know your data
PDF
Lecture2.pdf
PPTX
Lect 2 getting to know your data
PPTX
Data Preprocessing
PDF
BIM Data Mining Unit2 by Tekendra Nath Yogi
PPTX
Data For Datamining
PPTX
Data For Datamining
PPTX
Module 2_Part 1 Preprocessing.pptx data minig
DOCX
© Tan,Steinbach, Kumar Introduction to Data Mining 418.docx
PDF
02Data-osu-0829.pdf
PPT
chap2_data.ppt
PPT
chap2_data.ppt
PPT
Its all about data mining
PDF
Module-2-DataAndDataTypes for data mining
PDF
lec02-DataAndDataTypes.pdfhejewkekjeeeee
DOCX
•  Compareandcontrastthefourartworksprovided(KongoCr.docx
PDF
Ch.3 Data Science Data Preprocessing.pdf
PPTX
datamining-lect2 - What is data The data mining pipeline. Preprocessing and ...
PPTX
Descriptive Statistics.pptx
PPTX
Abanandamengeneeringsdhrrghhhhhgggffffff
Lect 2 getting to know your data
Lecture2.pdf
Lect 2 getting to know your data
Data Preprocessing
BIM Data Mining Unit2 by Tekendra Nath Yogi
Data For Datamining
Data For Datamining
Module 2_Part 1 Preprocessing.pptx data minig
© Tan,Steinbach, Kumar Introduction to Data Mining 418.docx
02Data-osu-0829.pdf
chap2_data.ppt
chap2_data.ppt
Its all about data mining
Module-2-DataAndDataTypes for data mining
lec02-DataAndDataTypes.pdfhejewkekjeeeee
•  Compareandcontrastthefourartworksprovided(KongoCr.docx
Ch.3 Data Science Data Preprocessing.pdf
datamining-lect2 - What is data The data mining pipeline. Preprocessing and ...
Descriptive Statistics.pptx
Abanandamengeneeringsdhrrghhhhhgggffffff
Ad

Recently uploaded (20)

PPTX
Pilar Kemerdekaan dan Identi Bangsa.pptx
PDF
[EN] Industrial Machine Downtime Prediction
PPTX
STERILIZATION AND DISINFECTION-1.ppthhhbx
PPTX
Copy of 16 Timeline & Flowchart Templates – HubSpot.pptx
PDF
Transcultural that can help you someday.
PPT
ISS -ESG Data flows What is ESG and HowHow
PDF
Capcut Pro Crack For PC Latest Version {Fully Unlocked 2025}
DOCX
Factor Analysis Word Document Presentation
PPTX
Managing Community Partner Relationships
PDF
Introduction to the R Programming Language
PDF
Data Engineering Interview Questions & Answers Cloud Data Stacks (AWS, Azure,...
PDF
Jean-Georges Perrin - Spark in Action, Second Edition (2020, Manning Publicat...
PPTX
modul_python (1).pptx for professional and student
PPTX
IMPACT OF LANDSLIDE.....................
PDF
annual-report-2024-2025 original latest.
PPTX
QUANTUM_COMPUTING_AND_ITS_POTENTIAL_APPLICATIONS[2].pptx
PPTX
mbdjdhjjodule 5-1 rhfhhfjtjjhafbrhfnfbbfnb
PDF
Optimise Shopper Experiences with a Strong Data Estate.pdf
PPTX
IBA_Chapter_11_Slides_Final_Accessible.pptx
PPTX
Market Analysis -202507- Wind-Solar+Hybrid+Street+Lights+for+the+North+Amer...
Pilar Kemerdekaan dan Identi Bangsa.pptx
[EN] Industrial Machine Downtime Prediction
STERILIZATION AND DISINFECTION-1.ppthhhbx
Copy of 16 Timeline & Flowchart Templates – HubSpot.pptx
Transcultural that can help you someday.
ISS -ESG Data flows What is ESG and HowHow
Capcut Pro Crack For PC Latest Version {Fully Unlocked 2025}
Factor Analysis Word Document Presentation
Managing Community Partner Relationships
Introduction to the R Programming Language
Data Engineering Interview Questions & Answers Cloud Data Stacks (AWS, Azure,...
Jean-Georges Perrin - Spark in Action, Second Edition (2020, Manning Publicat...
modul_python (1).pptx for professional and student
IMPACT OF LANDSLIDE.....................
annual-report-2024-2025 original latest.
QUANTUM_COMPUTING_AND_ITS_POTENTIAL_APPLICATIONS[2].pptx
mbdjdhjjodule 5-1 rhfhhfjtjjhafbrhfnfbbfnb
Optimise Shopper Experiences with a Strong Data Estate.pdf
IBA_Chapter_11_Slides_Final_Accessible.pptx
Market Analysis -202507- Wind-Solar+Hybrid+Street+Lights+for+the+North+Amer...
Ad

Wk. 3. Data [12-05-2021] (2).ppt

  • 1. Data Mining and machine Learning (CSE 321) Summer 2021 Topic – 2: Data
  • 2. Types of Data Data Quality Data Preprocessing Measures of Similarity and Dissimilarity Topic Contents
  • 3. Recommended Reading “Introduction to Data Mining,” Pang-Ning Tan, Michael Steinbach and Vipin Kumar, Addison Wesley, 2006.  Chapter 2 (Data) 3 3
  • 5. What is Data? • Collection of data objects and their attributes • An attribute is a property or characteristic of an object – Examples: eye color of a person, temperature, etc. – Attribute is also known as variable, field, characteristic, or feature • A collection of attributes describe an object – Object is also known as record, point, case, sample, entity, or instance 5 Tid Refund Marital Status Taxable Income Cheat 1 Yes Single 125K No 2 No Married 100K No 3 No Single 70K No 4 Yes Married 120K No 5 No Divorced 95K Yes 6 No Married 60K No 7 Yes Divorced 220K No 8 No Single 85K Yes 9 No Married 75K No 10 No Single 90K Yes 10 Attributes Objects
  • 6. Attribute Values • Attribute values are numbers or symbols assigned to an attribute • Distinction between attributes and attribute values – Same attribute can be mapped to different attribute values • Example: height can be measured in feet or meters – Different attributes can be mapped to the same set of values • Example: Attribute values for ID and age are integers • But properties of attribute values can be different – ID has no limit but age has a maximum and minimum value 6
  • 7. Types of Attributes • There are different types of attributes – Nominal (Categorical) • Examples: ID numbers, eye color, zip codes – Ordinal • Examples: rankings (e.g., taste of potato chips on a scale from 1-10), grades, height in {tall, medium, short} – Interval • Examples: calendar dates, temperatures in Celsius or Fahrenheit. – Ratio • Examples: temperature in Kelvin, length, time, counts 7
  • 8. Properties of Attribute Values • The type of an attribute depends on which of the following 4 properties it possesses: – Distinctness: = – Order: < > – Addition: + - – Multiplication: * / • Attributes with Properties – Nominal attribute: distinctness – Ordinal attribute: distinctness & order – Interval attribute: distinctness, order & addition – Ratio attribute: all 4 properties 8
  • 9. Attribute Type Description Examples Operations Nominal The values of a nominal attribute are just different names, i.e., nominal attributes provide only enough information to distinguish one object from another. (=, ) zip codes, employee ID numbers, eye color, sex: {male, female} mode, entropy Ordinal The values of an ordinal attribute provide enough information to order objects. (<, >) hardness of minerals, {good, better, best}, grades, street numbers median, percentiles Interval For interval attributes, the differences between values are meaningful, i.e., a unit of measurement exists. (+, - ) calendar dates, temperature in Celsius or Fahrenheit mean, standard deviation Ratio For ratio variables, both differences and ratios are meaningful. (*, /) temperature in Kelvin, monetary quantities, counts, age, mass, length, electrical current 9
  • 10. Attribute Level Transformation Comments Nominal Any permutation of values If all employee ID numbers were reassigned, would it make any difference? Ordinal An order preserving change of values, i.e., new_value = f(old_value) where f is a monotonic function. An attribute encompassing the notion of good, better best can be represented equally well by the values {1, 2, 3} or by { 0.5, 1, 10}. Interval new_value =a * old_value + b where a and b are constants Thus, the Fahrenheit and Celsius temperature scales differ in terms of where their zero value is and the size of a unit (degree). Ratio new_value = a * old_value Length can be measured in meters or feet. 10
  • 11. Discrete and Continuous Attributes • Discrete Attribute – Has only a finite or countably infinite set of values – Examples: zip codes, counts, or the set of words in a collection of documents – Often represented as integer variables. – Note: binary attributes are a special case of discrete attributes • Continuous Attribute – Has real numbers as attribute values – Examples: temperature, height, or weight. – Practically, real values can only be measured and represented using a finite number of digits. – Continuous attributes are typically represented as floating-point variables. 11
  • 12. Important Characteristics of Structured Data –Dimensionality • Curse of Dimensionality • What is the curse of dimensionality? –Sparsity • Only presence counts • Given me an example of data that is probably sparse –Resolution • Patterns depend on the scale • Give an example of how changing resolution can help – Hint: think about weather patterns, rainfall over a time period 12
  • 13. Types of data sets • Record – Data Matrix – Document Data – Transaction Data • Graph – World Wide Web – Molecular Structures • Ordered – Spatial Data – Temporal Data – Sequential Data – Genetic Sequence Data 13
  • 14. Record Data • Data that consists of a collection of records, each of which consists of a fixed set of attributes 14 Tid Refund Marital Status Taxable Income Cheat 1 Yes Single 125K No 2 No Married 100K No 3 No Single 70K No 4 Yes Married 120K No 5 No Divorced 95K Yes 6 No Married 60K No 7 Yes Divorced 220K No 8 No Single 85K Yes 9 No Married 75K No 10 No Single 90K Yes 10
  • 15. Data Matrix • If data objects have the same fixed set of numeric attributes, then the data objects can be thought of as points in a multi-dimensional space, where each dimension represents a distinct attribute • Such data set can be represented by an m by n matrix, where there are m rows, one for each object, and n columns, one for each attribute 15 1.1 2.2 16.22 6.25 12.65 1.2 2.7 15.22 5.27 10.23 Thickness Load Distance Projection of y load Projection of x Load 1.1 2.2 16.22 6.25 12.65 1.2 2.7 15.22 5.27 10.23 Thickness Load Distance Projection of y load Projection of x Load
  • 16. Document Data • Each document becomes a `term' vector, – each term is a component (attribute) of the vector, – the value of each component is the number of times the corresponding term occurs in the document. 16 Document 1 season timeout lost wi n game score ball pla y coach team Document 2 Document 3 3 0 5 0 2 6 0 2 0 2 0 0 7 0 2 1 0 0 3 0 0 1 0 0 1 2 2 0 3 0
  • 17. Transaction Data • A special type of record data, where – each record (transaction) involves a set of items. – For example, consider a grocery store. The set of products purchased by a customer during one shopping trip constitute a transaction, while the individual products that were purchased are the items. 17 TID Items 1 Bread, Coke, Milk 2 Beer, Bread 3 Beer, Coke, Diaper, Milk 4 Beer, Bread, Diaper, Milk 5 Coke, Diaper, Milk
  • 18. Graph Data • Examples: Generic graph and HTML Links 18 5 2 1 2 5 <a href="papers/papers.html#bbbb"> Data Mining </a> <li> <a href="papers/papers.html#aaaa"> Graph Partitioning </a> <li> <a href="papers/papers.html#aaaa"> Parallel Solution of Sparse Linear System of Equations </a> <li> <a href="papers/papers.html#ffff"> N-Body Computation and Dense Linear System Solvers
  • 19. Chemical Data • Benzene Molecule: C6H6 19
  • 20. Ordered Data • Sequences of transactions 20 An element of the sequence Items/Events
  • 21. Ordered Data • Genomic sequence data 21 GGTTCCGCCTTCAGCCCCGCGCC CGCAGGGCCCGCCCCGCGCCGTC GAGAAGGGCCCGCCTGGCGGGCG GGGGGAGGCGGGGCCGCCCGAGC CCAACCGAGTCCGACCAGGTGCC CCCTCTGCTCGGCCTAGACCTGA GCTCATTAGGCGGCAGCGGACAG GCCAAGTAGAACACGCGAAGCGC TGGGCTGCCTGCTGCGACCAGGG
  • 22. Ordered Data 22 • Spatio-Temporal Data Average Monthly Temperature of land and ocean
  • 24. Data Quality • What kinds of data quality problems? • How can we detect problems with the data? • What can we do about these problems? • Examples of data quality problems: – Noise and outliers – missing values – duplicate data 24
  • 25. Noise • Noise refers to modification of original values – Examples: distortion of a person’s voice when talking on a poor phone and “snow” on television screen 25 Two Sine Waves Two Sine Waves + Noise
  • 26. Outliers • Outliers are data objects with characteristics that are considerably different than most of the other data objects in the data set 26
  • 27. Missing Values • Reasons for missing values – Information is not collected (e.g., people decline to give their age and weight) – Attributes may not be applicable to all cases (e.g., annual income is not applicable to children) • Handling missing values – Eliminate Data Objects – Estimate Missing Values – Ignore the Missing Value During Analysis – Replace with all possible values (weighted by their probabilities) 27
  • 28. Duplicate Data • Data set may include data objects that are duplicates, or almost duplicates of one another – Major issue when merging data from heterogeneous sources • Examples: – Same person with multiple email addresses • Data cleaning – Process of dealing with duplicate data issues 28
  • 30. Data Preprocessing • Aggregation • Sampling • Dimensionality Reduction • Feature subset selection • Feature creation • Discretization and Binarization • Attribute Transformation 30
  • 31. Aggregation • Combining two or more attributes (or objects) into a single attribute (or object) • Purpose – Data reduction • Reduce the number of attributes or objects – Change of scale • Cities aggregated into regions, states, countries, etc – More “stable” data • Aggregated data tends to have less variability 31
  • 32. Aggregation 32 Standard Deviation of Average Monthly Precipitation Standard Deviation of Average Yearly Precipitation Variation of Precipitation in Australia
  • 33. Sampling • Sampling is often used for data selection – It is often used for both the preliminary investigation of the data and the final data analysis. • Statisticians sample because obtaining the entire set of data of interest is too expensive or time consuming • Sampling is used in data mining because processing the entire set of data of interest is too expensive or time consuming 33
  • 34. Sampling … • The key principle for effective sampling is the following: – using a sample will work almost as well as using the entire data sets, if the sample is representative • May not be true if have relatively little data or are looking for rare cases or dealing with skewed class distributions • Learning curves can help assess how much data is needed – A sample is representative if it has approximately the same property (of interest) as the original set of data • However, there are times when one purposefully skews the sample 34
  • 35. Types of Sampling • Simple Random Sampling – There is an equal probability of selecting any particular item • Sampling without replacement – As each item is selected, it is removed from the population • Sampling with replacement – Objects are not removed from the population as they are selected for the sample. • In sampling with replacement, the same object can be picked up more than once • Stratified sampling – Split the data into several partitions; then draw random samples from each partition 35
  • 36. Sample Size 36 8000 points 2000 Points 500 Points
  • 37. Sample Size • What sample size is necessary to get at least one object from each of 10 groups. 37
  • 38. Curse of Dimensionality • When dimensionality increases, data becomes increasingly sparse in the space that it occupies • Definitions of density and distance between points, which is critical for clustering and outlier detection, become less meaningful 38 • Randomly generate 500 points • Compute difference between max and min distance between any pair of points
  • 39. Dimensionality Reduction • Purpose: – Avoid curse of dimensionality – Reduce amount of time and memory required by data mining algorithms – Allow data to be more easily visualized – May help to eliminate irrelevant features or reduce noise 39
  • 40. Feature Subset Selection • Another way to reduce dimensionality of data • Redundant features – duplicate much or all of the information contained in one or more other attributes – Example: purchase price of a product and the amount of sales tax paid • Irrelevant features – contain no information that is useful for the data mining task at hand – Example: students' ID is often irrelevant to the task of predicting students' GPA 40
  • 41. Feature Subset Selection • Techniques: – Brute-force approach: • Try all possible feature subsets as input to DM algorithm – Embedded approaches: • Feature selection occurs naturally as part of the data mining algorithm (decision trees) – Filter approaches: • Features are selected before data mining algorithm is run – Wrapper approaches: • Use the data mining algorithm as a black box to find best subset of attributes 41
  • 42. Feature Creation • Create new attributes that can capture the important information in a data set much more efficiently than the original attributes • Three general methodologies: – Feature Extraction • domain-specific – Mapping Data to New Space – Feature Construction • combining features – Example: calculate density from volume and mass 42
  • 43. Discretization without Using Class Labels 43 Data Equal interval width Equal frequency K-means
  • 44. Attribute Transformation 44 • A function that maps the entire set of values of a given attribute to a new set of replacement values such that each old value can be identified with one of the new values – Simple functions: xk, log(x), ex, |x| – Standardization and Normalization
  • 45. Measures of Similarity and Dissimilarity
  • 46. Similarity and Dissimilarity • Why might you need to measure these things? • Similarity – Numerical measure of how alike two data objects are – Is higher when objects are more alike – Often falls in the range [0,1] • Dissimilarity – Numerical measure of how different are two data objects – Lower when objects are more alike – Minimum dissimilarity is often 0, upper limit varies • Proximity refers to a similarity or dissimilarity • How would you measure these? 46
  • 47. Euclidean Distance • Euclidean Distance Where n is the number of dimensions (attributes) and pk and qk are, respectively, the kth attributes (components) or data objects p and q. • Standardization is necessary, if scales differ. 47     n k k k q p dist 1 2 ) (
  • 48. Euclidean Distance 48 0 1 2 3 0 1 2 3 4 5 6 p1 p2 p3 p4 point x y p1 0 2 p2 2 0 p3 3 1 p4 5 1 Distance Matrix p1 p2 p3 p4 p1 0 2.828 3.162 5.099 p2 2.828 0 1.414 3.162 p3 3.162 1.414 0 2 p4 5.099 3.162 2 0
  • 49. Minkowski Distance • Minkowski Distance is a generalization of Euclidean Distance Where r is a parameter, n is the number of dimensions (attributes) and pk and qk are, respectively, the kth attributes (components) or data objects p and q. 49 r n k r k k q p dist 1 1 ) | | (    
  • 50. Minkowski Distance: Examples • r = 1. City block (Manhattan, L1 norm) distance. – A common example is the Hamming distance, which is the number of bits that are different between two objects that have only binary attributes, i.e., between two binary vectors. 50 CSEDIU
  • 52. Minkowski Distance 52 Distance Matrix point x y p1 0 2 p2 2 0 p3 3 1 p4 5 1 L1 p1 p2 p3 p4 p1 0 4 4 6 p2 4 0 2 4 p3 4 2 0 2 p4 6 4 2 0 L2 p1 p2 p3 p4 p1 0 2.828 3.162 5.099 p2 2.828 0 1.414 3.162 p3 3.162 1.414 0 2 p4 5.099 3.162 2 0 L p1 p2 p3 p4 p1 0 2 3 5 p2 2 0 1 3 p3 3 1 0 2 p4 5 3 2 0
  • 53. Similarity between Binary Vectors • Common situation is that objects, p and q, have only binary attributes • Compute similarities using the following quantities M01 = the number of attributes where p was 0 and q was 1 M10 = the number of attributes where p was 1 and q was 0 M00 = the number of attributes where p was 0 and q was 0 M11 = the number of attributes where p was 1 and q was 1 • Simple Matching and Jaccard Coefficients SMC = number of matches / number of attributes = (M11 + M00) / (M01 + M10 + M11 + M00) J = number of 11 matches / number of not-both-zero attributes values = (M11) / (M01 + M10 + M11) • Useful when almost all values are 0, since SMC would always be close to 1 53
  • 54. SMC versus Jaccard: Example p = 1 0 0 0 0 0 0 0 0 0 q = 0 0 0 0 0 0 1 0 0 1 M01 = 2 (the number of attributes where p was 0 and q was 1) M10 = 1 (the number of attributes where p was 1 and q was 0) M00 = 7 (the number of attributes where p was 0 and q was 0) M11 = 0 (the number of attributes where p was 1 and q was 1) SMC = (M11 + M00)/(M01 + M10 + M11 + M00) = (0+7) / (2+1+0+7) = 0.7 J = (M11) / (M01 + M10 + M11) = 0 / (2 + 1 + 0) = 0 54
  • 55. Cosine Similarity • If d1 and d2 are two document vectors, then cos( d1, d2 ) = (d1 d2) / ||d1|| ||d2|| , where indicates vector dot (aka inner) product and ||d || is the length of vector d (i.e., the square root of the vector dot product) • Example: d1 = 3 2 0 5 0 0 0 2 0 0 d2 = 1 0 0 0 0 0 0 1 0 2 d1 d2= 3*1 + 2*0 + 0*0 + 5*0 + 0*0 + 0*0 + 0*0 + 2*1 + 0*0 + 0*2 = 5 ||d1|| = (3*3+2*2+0*0+5*5+0*0+0*0+0*0+2*2+0*0+0*0)0.5 = (42) 0.5 = 6.481 ||d2|| = (1*1+0*0+0*0+0*0+0*0+0*0+0*0+1*1+0*0+2*2)0.5 = (6) 0.5 = 2.245 cos( d1, d2 ) = .3150 A value close to 1 means the vectors are similar and a value near 0 mean they are nearly totally dissimilar. 55
  • 56. Ways to Visualize Data • Data visualization tools are not Data Mining, but can be used in the data mining process • What kinds of tools are there? – Bar charts and histrograms, scatter plots, pie charts, etc. – From kdnuggets.com I found this interesting site: • http://services.alphaworks.ibm.com/manyeyes/home 56