Cellbased Microarrays Methods And Protocols 1st Edition Ella Palmer Auth

Cellbased Microarrays Methods And Protocols 1st
Edition Ella Palmer Auth download
https://ebookbell.com/product/cellbased-microarrays-methods-and-
protocols-1st-edition-ella-palmer-auth-2448470
Explore and download more ebooks at ebookbell.com

Here are some recommended products that we believe you will be
interested in. You can click the link to download.
Cellbased Microarrays Review Of Applications Developments And
Technological Advances 1st Edition Ella Palmer Auth
https://ebookbell.com/product/cellbased-microarrays-review-of-
applications-developments-and-technological-advances-1st-edition-ella-
palmer-auth-4661974
Cellbased Microarrays 1st Ed Peter Ertl Mario Rothbauer
https://ebookbell.com/product/cellbased-microarrays-1st-ed-peter-ertl-
mario-rothbauer-7146838
Cellbased Assays For Highthroughput Screening Methods And Protocols
1st Edition W Frank An
https://ebookbell.com/product/cellbased-assays-for-highthroughput-
screening-methods-and-protocols-1st-edition-w-frank-an-2127650
Cellbased Therapies In Stroke 1st Edition Stanley Hoang Md
https://ebookbell.com/product/cellbased-therapies-in-stroke-1st-
edition-stanley-hoang-md-4405348

Cellbased Therapy For Degenerative Retinal Disease 1st Ed Marco A
Zarbin
https://ebookbell.com/product/cellbased-therapy-for-degenerative-
retinal-disease-1st-ed-marco-a-zarbin-9964546
Cellbased Assays Using Ipscs For Drug Development And Testing 1st Ed
Carlfredrik Mandenius
https://ebookbell.com/product/cellbased-assays-using-ipscs-for-drug-
development-and-testing-1st-ed-carlfredrik-mandenius-10484684
Stem Cellbased Neural Model Systems For Brain Disorders Yuwen Alvin
Huang
https://ebookbell.com/product/stem-cellbased-neural-model-systems-for-
brain-disorders-yuwen-alvin-huang-50510400
Stem Cellbased Therapy For Neurodegenerative Diseases 1st Ed Fabin Han
https://ebookbell.com/product/stem-cellbased-therapy-for-
neurodegenerative-diseases-1st-ed-fabin-han-22477658
Singlecellbased Models In Biology And Medicine Mathematics And
Biosciences In Interaction 1st Edition Alexander Anderson
https://ebookbell.com/product/singlecellbased-models-in-biology-and-
medicine-mathematics-and-biosciences-in-interaction-1st-edition-
alexander-anderson-2423276

METHODS IN MOLECULAR BIOLOGY
TM
Series Editor
John M. Walker
School of Life Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK
For other titles published in this series, go to
www.springer.com/series/7651

Cell-Based Microarrays
Methods and Protocols
Edited by
Ella Palmer
QuantitativeSystems Biology,Faculty ofMedicine,
MRC ClinicalSciencesCentre,ImperialCollegeLondon,
London,UK

Editor
Ella Palmer
Quantitative Systems Biology
Faculty of Medicine
MRC Clinical Sciences Centre
Imperial College London
Du Cane Road
W12 ONN London
Hammersmith Hospital Campus
London, UK
e.l.palmer.01@cantab.net
ISSN 1064-3745 e-ISSN 1940-6029
ISBN 978-1-61737-969-7 e-ISBN 978-1-61737-970-3
DOI 10.1007/978-1-61737-970-3
Springer New York Dordrecht Heidelberg London
© Springer Science+Business Media, LLC 2011
All rights reserved. This work may not be translated or copied in whole or in part without the written permission of
the publisher (Humana Press, c/o Springer Science+Business Media, LLC, 233 Spring Street, New York, NY 10013,
USA), except for brief excerpts in connection with reviews or scholarly analysis. Use in connection with any form of
information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology
now known or hereafter developed is forbidden.
The use in this publication of trade names, trademarks, service marks, and similar terms, even if they are not identified
as such, is not to be taken as an expression of opinion as to whether or not they are subject to proprietary rights.
Printed on acid-free paper
Humana Press is part of Springer Science+Business Media (www.springer.com)

Preface
Cell-based microarrays are a technique first described by the Sabatini group in 2001. They
detail the printing of cDNA or siRNAs in a vector construct onto a coated glass slide using
a robotic microarrayer. The vector constructs are transfected in defined areas within cells
grown over the surface of the slide or microplate. These cell-based microarrays can be
used for a variety of high-throughput, downstream functional assays.
Since their development in 2001, they have advanced significantly, and this book,
intended for molecular biologists, geneticists, immunologists, and biochemists, covers
many aspects of their evolution.
Chapter 1 gives a detailed overview of the whole subject area, including a discussion
of the first paper describing the technique and detailed descriptions of the current work in
overexpression, RNAi, antibody, and small-molecule cell-based microarrays. The overview
also covers the adaptation of cell-based microarrays for a variety of cell types, advances in
array surface chemistry and transfection efficiencies, and imaging of cell-based microarrays.
Chapters 2, 3, 4, 5, and 6 describe protocols for overexpression arrays and down-
stream functional assays. In Chapters 2 and 3, Lai et al. and Palmer et al. provide clear
protocols for array printing and transfection with standard HEK23T cells. In Chapter 4,
Redmond et al. describe the use of a novel fluorescent reporter, and in Chapters 5 and 6,
Hu et al. provide a protocol for high-throughput sub-cellular localization, and Erfle et al.
include a protocol for high-throughput organelle imaging.
In Chapter 7, Niu et al. provide a protocol for a different cell type to standard mam-
malian cells: yeast cells (also see Chapter 11 for blood cells).
Chapter 8 discusses a protocol for shRNAs using adenoviruses, and, in Chapters 8
and 9, Konrad et al. and Volkmer et al. both discuss the protocols for infectious disease
research.
In Chapters 10 and 11, Lin et al. and Roupioz et al. provide protocols for antibody
arrays and describe their use with different cell types such as blood.
Chapters 12, 13, 14, and 15 discuss protocols for increasing transfection efficiencies
on cell-based microarrays. Yamaguchi et al and Hook et al, in Chapters 12 and 13, pro-
vide protocols for different slide coatings (also discussed in Chapter 8). Pernagallo et al.,
in Chapter 14, discuss the use of polymer arrays for functional tissue modelling, and Kato
et al., in Chapter 15, discuss the use of electroporation to increase transfection efficiency.
In Chapter 16, Damoiseaux et al. provide a protocol discussing the development of
cell-based array technology by use of microfluidic image cytometry for the analysis of small
diagnostic samples with few cells.
Together, the chapters provide an easy-to-use, up-to-date, and comprehensive set of
protocols on every aspect of cell-based microarrays.
Ella Palmer
v

Contents
Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix
1. Cell-Based Microarrays: Overview . . . . . . . . . . . . . . . . . . . . . . . . . 1
Ella Palmer
2. Cell-Based Co-transfection Microarrays for Use with HEK293T Cells
on a Poly D-Lysine-Coated Polystyrene Microplate . . . . . . . . . . . . . . . . 13
Meenal Soni and Fang Lai
3. Large-Scale Cell-Based Microarrays and Their Use with HEK293T Cells
and Downstream Apoptotic Assays . . . . . . . . . . . . . . . . . . . . . . . . . 27
Ella Palmer and Tom C. Freeman
4. A Novel Fluorescent Transcriptional Reporter for Cell-Based
Microarray Assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41
Tanya M. Redmond and Michael D. Uhler
5. High-Throughput Subcellular Protein Localization Using Transfected-
Cell Arrays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53
Yuhui Hu and Michal Janitz
6. Cell Arrays for the Measurement of Organelle Dynamics in Living Cells . . . . . . 73
Holger Erfle, Tautvydas Lisauskas, Christoph Claas, Jürgen Reymann,
and Vytaute Starkuviene
7. High-Throughput Immunofluorescence Microscopy Using Yeast
Spheroplast Cell-Based Microarrays . . . . . . . . . . . . . . . . . . . . . . . . 83
Wei Niu, G. Traver Hart, and Edward M. Marcotte
8. Cell-Based Microarrays of Infectious Adenovirus Encoding Short Hairpin
RNA (shRNA) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97
Hansjürgen Volkmer and Frank Weise
9. Reverse Transfected Cell Microarrays in Infectious Disease Research . . . . . . . . 107
Andreas Konrad, Ramona Jochmann, Elisabeth Kuhn,
Elisabeth Naschberger, Priya Chudasama, and Michael Stürzl
10. Transfected Cell Microarrays for the Expression of Membrane-Displayed
Single-Chain Antibodies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 119
Baochuan Lin and James B. Delehanty
11. Blood Cell Capture on Antibody Microarrays and Monitoring of the Cell
Capture Using Surface Plasmon Resonance Imaging . . . . . . . . . . . . . . . . 139
Yoann Roupioz, Sarah Milgram, André Roget, and Thierry Livache
vii

viii Contents
12. Immobilized Culture and Transfection Microarray of Non-adherent Cells . . . . . 151
Satoshi Yamaguchi, Erika Matsunuma, and Teruyuki Nagamune
13. Plasma Polymer and PEG-Based Coatings for DNA, Protein
and Cell Microarrays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 159
Andrew L. Hook, Nicolas H. Voelcker, and Helmut Thissen
14. Polymer Microarrays for Cellular High-Content Screening . . . . . . . . . . . . 171
Salvatore Pernagallo and Juan J. Diaz-Mochon
15. High-Throughput Analyses of Gene Functions on a Cell Chip
by Electroporation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 181
Koichi Kato and Hiroo Iwata
16. Microfluidic Image Cytometry . . . . . . . . . . . . . . . . . . . . . . . . . . . 191
Ken-ichiro Kamei, Jing Sun, Hsian-Rong Tseng,
and Robert Damoiseaux
Subject Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 207

Contributors
PRIYA CHUDASAMA • Division of Molecular and Experimental Surgery, Department of
Surgery, University Medical Center Erlangen, Erlangen, Germany
CHRISTOPH CLAAS • BioQuant, University of Heidelberg, Heidelberg, Germany
ROBERT DAMOISEAUX • Molecular Screening Shared Resource, David Geffen School of
Medicine, University of California, Los Angeles, CA, USA
JAMES B. DELEHANTY • United States Naval Research Laboratory, Center for
Bio/Molecular Science and Engineering, Washington, DC, USA
JUAN J. DIAZ-MOCHON • School of Chemistry, University of Edinburgh, Edinburgh, UK
HOLGER ERFLE • BioQuant, University of Heidelberg, Heidelberg, Germany
TOM C. FREEMAN • Division of Genetics and Genomics, University of Edinburgh, Roslin
BioCentre, Midlothian, UK
G. TRAVER HART • Department of Chemistry and Biochemistry, Center for Systems and
Synthetic Biology, Institute for Cellular and Molecular Biology, University of Texas at
Austin, Austin, TX, USA
ANDREW L. HOOK • Laboratory of Biophysics and Surface Analysis, University of Not-
tingham, Nottingham, UK
YUHUI HU • The Berlin Institute for Medical Systems Biology, Max Delbrück Center for
Molecular Medicine (MDC), Berlin-Buch, Germany
HIROO IWATA • Institute for Frontier Medical Sciences, Kyoto University, Kyoto, Japan
MICHAL JANITZ • School of Biotechnology and Biomolecular Sciences, University of New
South Wales, Sydney NSW, Australia
RAMONA JOCHMANN • Division of Molecular and Experimental Surgery, Department of
KEN-ICHIRO KAMEI • Department of Molecular & Medical Pharmacology, David Geffen
School of Medicine, University of California, Los Angeles, CA, USA
KOICHI KATO • Institute for Frontier Medical Sciences, Kyoto University, Kyoto, Japan
ANDREAS KONRAD • Division of Molecular and Experimental Surgery, Department of
ELISABETH KUHN • Division of Molecular and Experimental Surgery, Department of
FANG LAI • Science and Technology Division Corning Inc, Corning, NY, USA
BAOCHUAN LIN • United States Naval Research Laboratory, Center for Bio/Molecular
Science and Engineering, Washington, DC, USA
TAUTVYDAS LISAUSKAS • BioQuant, University of Heidelberg, Heidelberg, Germany
THIERRY LIVACHE • CREAB Group, SPrAM-UMR 5819 (CEA-CNRS-UJF),
INAC/CEA-Grenoble, Grenoble, France
EDWARD M. MARCOTTE • Department of Chemistry and Biochemistry, Center for
Systems and Synthetic Biology, Institute for Cellular and Molecular Biology, University of
Texas at Austin, Austin, TX, USA
ERIKA MATSUNUMA • Department of Chemistry and Biotechnology, Graduate School of
Engineering, The University of Tokyo, Tokyo, Japan
ix

x Contributors
SARAH MILGRAM • CREAB Group, SPrAM-UMR 5819 (CEA-CNRS-UJF),
TERUYUKI NAGAMUNE • Departments of Chemistry & Biotechnology and Bioengineer-
ing, Graduate School of Engineering, and Center for NanoBio Integration (CNBI), The
University of Tokyo, Tokyo, Japan
ELISABETH NASCHBERGER • Division of Molecular and Experimental Surgery, Depart-
ment of Surgery, University Medical Center Erlangen, Erlangen, Germany
WEI NIU • Department of Genetics, Yale University, New Haven, CT, USA
ELLA PALMER • Clinical Sciences Centre, Hammersmith Hospital, London, UK
SALVATORE PERNAGALLO • School of Chemistry, University of Edinburgh, Edinburgh,
UK
TANYA M. REDMOND • Molecular, Behavioral Neuroscience Institute, University of
Michigan, Ann Arbor, MI, USA
JÜRGEN REYMANN • BioQuant, University of Heidelberg, Heidelberg, Germany
ANDRÉ ROGET • CREAB Group, SPrAM-UMR 5819 (CEA-CNRS-UJF), INAC/CEA-
Grenoble, Grenoble, France
YOANN ROUPIOZ • CREAB Group, SPrAM-UMR 5819 (CEA-CNRS-UJF),
MEENAL SONI • Science and Technology Division Corning Inc., Corning, NY, USA
VYTAUTE STARKUVIENE • BioQuant, University of Heidelberg, Heidelberg, Germany
MICHAEL STÜRZL • Division of Molecular and Experimental Surgery, Department of
JING SUN • Department of Molecular & Medical Pharmacology, David Geffen School of
Medicine, University of California, Los Angeles, CA, USA
HELMUT THISSEN • CSIRO Molecular and Health Technologies, Clayton, VIC, Aus-
tralia
HSIAN-RONG TSENG • Department of Molecular & Medical Pharmacology, David
Geffen School of Medicine, University of California, Los Angeles, CA, USA
MICHAEL D. UHLER • Molecular, Behavioral Neuroscience Institute, University of
Michigan, Ann Arbor, MI, USA
NICOLAS H. VOELCKER • Flinders University, Bedford Park, SA, Australia
HANSJÜRGEN VOLKMER • Natural and Medical Sciences Institute, University of
Tübingen, Reutlingen, Germany
FRANK WEISE • Natural and Medical Sciences Institute, University of Tübingen, Reut-
lingen, Germany
SATOSHI YAMAGUCHI • Department of Chemistry and Biotechnology, Graduate School of
Engineering, The University of Tokyo, Tokyo, Japan

Chapter 1
Cell-Based Microarrays: Overview
Ella Palmer
Abstract
Cell-based microarrays were first described by Ziauddin and Sabatini in 2001 as a novel method for
performing high-throughput screens of gene function. They reported a technique whereby expression
vectors containing the open reading frame (ORF) of human genes were printed onto glass microscope
slides to form a microarray. Transfection reagents were added pre- or post-spotting and cells grown over
the surface of the array. They demonstrated that cells growing in the immediate vicinity of the expression
vectors underwent ‘reverse transfection’ and that subsequent alterations in cell function could then be
detected by secondary assays performed on the array. Subsequent publications have adapted the technique
to a variety of applications and have also shown that the approach works when arrays are fabricated using
siRNAs and compounds. The potential of this method for performing analyses of gene function and
identification of novel therapeutic agents has now been clearly demonstrated. Current efforts are focused
on improving and harnessing this technology for high-throughput screening applications.
Key words: Cell-based microarray, reverse transfection, RNAi, siRNA.
1. Introduction
The utility of the microarray format was first effectively demon-
strated for gene expression profiling (1, 2). The availability of
whole genome sequences, a growing catalogue of genes, bet-
ter equipment, resources and the increased analytical power of
bioinformatic tools, has fuelled the development and application
of microarrays for gene expression analysis. As a result, high-
throughput, semi-quantitative analyses of gene expression using
this platform are now routine in many laboratories. The desir-
able characteristics of the microarray format platform also led
to a diversification in the use of microarray technology in areas
other than the study of gene expression. Over the last years,
many variations of the microarray format have evolved, including
arrays for performing comparative genomic hybridisations (3, 4),
E. Palmer (ed.), Cell-Based Microarrays, Methods in Molecular Biology 706,
DOI 10.1007/978-1-61737-970-3_1, © Springer Science+Business Media, LLC 2011
1

2 Palmer
genotyping (5, 6) and DNA methylation (7), as well as for detect-
ing DNA–protein (8), protein–protein (9, 10), carbohydrate–
protein (11) and receptor–ligand interactions (12). Also in the
last few years, extensive collections of full-length cDNA resources
have been created for key model species such as C. elegans
(13) and D. melanogaster (14) and genome-wide clone sets are
also comprehensive for human and mouse (16–18). Likewise,
genome-wide RNAi reagents are also available for a range of
species (19–21), paving the way for cell-based microarray tech-
nology. See Fig. 1.1 for an overview of the cell-based transfection
methodology.
whole array
transfection
reagent
cDNA library RNAi library compound
library
sub-cellular
localisation
whole array
imaging
array onto
microscope slide
microarray
cells of
interest
Phenotype assay
or compound
addition
visualisation
microtitre
plate
cell culture
Fig. 1.1. Cell-based microarray methodology. Plasmids are prepared from cDNA or RNAi clone expression libraries,
alternatively compound libraries can be used directly. Transfection reagent used to transport DNA/RNA into the cell can
be either added directly to the plates prior to printing or used to treat the array just prior to cell culture. For compound
screening, a surface chemistry must be used that is compatible with the retention and controlled release of the com-
pounds. After printing, microarrays are cultured with cells until a confluent monolayer covers the surface of the slide. If
reagents are tagged, transfection events can be visualised at the slide or cellular level, or the cells stained to detect cells
with altered phenotype.

Cell-Based Microarrays 3
2. Developments
in Cell-Based
Microarrays
2.1. Contents and
Conclusions of the
First Cell-Based
Microarray Paper
The first paper describing cell-based microarrays powerfully illus-
trated the salient features of the technology (22). In initial stud-
ies, the Sabatini group printed 192 genes in a V5-epitope-tagged
expression vector. The arrays were probed with Cy3-labelled anti-
V5 antibody as a transfection control and then with Cy3-labelled
anti-phosphotyrosine antibody. Six genes were found to have
increased phosphotyrosine activity, five of which were known
tyrosine kinase proteins and the sixth gene encoded a protein
of unknown function. The cells were also observed for abnor-
mal morphologies, the apoptosis-inducing protein, TNFRSF10B
was associated with cells that appeared fragmented and was pos-
itive for the TdT-mediated dUTP nick-end labelling reaction.
As well, cells growing over the cell surface protein CD36, were
found to be in close contact. Sub-cellular localisation studies
were also performed on the arrays, many matched localisations
that had already been described for the proteins and sub-cellular
localisations were also demonstrated for proteins that had not
been studied previously. The authors concluded that the advan-
tages of the cell-based microarray technology were that the pro-
teins were translated within the environment of a mammalian cell
and were therefore likely to fold correctly and undergo molec-
ular interactions similar to the native protein. Furthermore, the
assays were quick compared to other over-expression strategies;
the signal was concentrated in small well-defined areas and the
arrays could be used to screen live cells. Finally, the arrays were
compact, easy to handle, economical and in principle the entire
set of human genes could be printed on a small number of
slides.
2.2. Downstream
Functional
Assay-Based
Microarrays
2.2.1. Over-Expression
Over-expression arrays of cDNAs expressing the gene of choice,
as published by the Sabatini group, were the first format of cell-
based microarrays, prior to the development of RNAi, and a num-
ber of groups still use arrays in this format for functional studies.
In initial studies, Webb et al. co-transfected expression vectors
containing the serum response element (SRE) reporter (which
activates MAPK and JNK pathways) coupled to GFP with five
known upstream activators of SRE. Each of the five SRE activa-
tors generated patches of cells with a significantly higher GFP
signal than the control vector demonstrating that members of

4 Palmer
signalling pathway initiation can be determined using cell-based
transfection microarrays (23). Mishina et al. demonstrated that
cell-based transfection arrays could be used to identify novel ther-
apeutic targets. G-protein coupled receptors (GPCRs) have a role
in mediating signalling in cellular metabolism and are therefore
prime candidates for drug targets. Nine hundred GPCRs were
printed onto a 96-well plate. GPCR agonists and a fluorescent
calcium indicator dye were added and 15 positive interactions
were discovered (24). In studies using the cAMP-response ele-
ment (CRE) activated by cAMP-dependent protein kinase (PKA)
coupled to GFP, GFP levels were also used to detect genes impor-
tant in activating this pathway (25).
Since the initial studies, Yamauchi et al., using the vascular
endothelial growth factor receptor (FLK1) promoter attached to
GFP on mouse embryonic stem cells lines and expressing a combi-
nation of transcription factors relevant to differentiation, demon-
strated that the level of GFP was an indicator of differentiation,
and they discovered a number of potent activators of differenti-
ation (26). Hu et al. have undertaken a high-throughput screen
of the sub-cellular localisation of genes on chromosome 21 using
organelle markers (27).
Various studies on apoptosis have been undertaken; Ziauddin
and Sabatini used a nick-mediated TUNEL assay to identify any
pro-apoptotic effects of over-expression (22), and in a study by
Palmer et al., TUNEL and caspase 3 assays were used to deter-
mine pro-apoptotic genes (28); Mannherz et al. also undertook a
screen for pro-apoptotic genes using EYFP attached to the genes
as a readout for apoptotic bodies (29).
2.2.2. RNAi Cell-Based
Microarrays
RNA interference (RNAi) is an enormously powerful tool for
investigating gene function. The process was first discovered in
Caenorhabditis elegans (30); it was demonstrated that double
stranded RNA (dsRNA) can direct the silencing of gene tar-
gets in a sequence-specific manner. In invertebrates such as C.
elegans and Drosophila melanogaster (31), when long dsRNA is
introduced into their cells it is processed by a dsRNA-specific
endonuclease, Dicer (32), into short interfering RNAs (siRNAs)
21–24 nucleotides in length. siRNAs are then incorporated
into an RNA-induced silencing complex (RISC) which cleaves
mRNAs homologous to the dsRNA originally introduced (33,
34). In mammalian cells, dsRNAs longer than 30 bp trigger the
antiviral/interferon pathways, which result in global shutdown of
protein synthesis (35). RNAi-mediated gene silencing is however
possible in mammalian cells either by delivery of chemically syn-
thesised short (less than 30 bp) double stranded siRNA molecules
(36) or by expression of short hairpin RNAs (shRNAs) bearing
fold-back stem–loop structures (37).

In initial studies on Drosophila cells, Sabatini’s group devel-
oped a prototype microarray with 384 different dsRNAs against
the majority of tyrosine kinases annotated in the D. melanogaster
genome and all predicted serine/threonine protein phosphatases.
The nucleus and actin were stained and the arrays scanned using
automated microscopy and image analysis software, which quan-
tified the number and size of nuclei in cells growing over each
dsRNA spot. Forty-four RNAis were identified that resulted in
features with at least two standard deviations below the mean
number of nuclei as compared to control dsRNA. These, there-
fore, represented genes likely to be essential for normal cell pro-
liferation, survival or adhesion. The group also found that it was
possible to knockdown two genes simultaneously, which opened
up the possibility of performing large-scale screens for synthetic
or epistatic genetic relationships (38).
Since then, several groups have described RNAi studies in
mammalian cells coupled with cell-based microarray technology.
A commonly used positive control is to co-transfect GFP expres-
sion vectors with vectors containing siRNAs or shRNAs targeting
GFP and demonstrate decreased GFP expression (39, 40). Silva
et al. printed an array of eight different shRNAs to EG5, a gene
involved in spindle formation. Using cells expressing a tubulin–
GFP fusion protein, they were able to show that cells growing
over two of the shRNAs had spindle defects (41). Erfle et al.
optimised a two-step procedure, where the transfection reagent
and siRNA are mixed before being printed onto the array. They
used siRNAs to knockdown the expression of three genes in
the secretory pathway, COP1, GM130 and Sec31, and also used
a marker assay to show that the COP1 gene was dysfunctional
(42). A further group developed a cell-based array system for
screening RNAi reagents, as not all siRNAs/shRNAs selected for
targeting a gene result in efficient gene silencing. They printed
MyoD, Lamin A/C and P53 siRNAs, and shRNAs onto a slide
and then added cells plus expression vectors containing the tar-
get gene attached to GFP for visualisation. They were able to
gauge the efficacy with which the siRNA and shRNA knocked
down the target gene by measuring the levels of GFP fluorescence
(43).
More recently, with the availability of genome-wide RNAi
reagents for a range of species (19–21), a number of groups
have reported high-throughput RNAi screens using cell-based
micorarrays.
Neumann et al. in studies led by Pepperkok, developed an
array-automated platform for high-content RNAi screening using
time-lapse fluorescence microscopy of live HeLa cells expressing
histone–GFP to determine chromosome segregation and struc-
ture using siRNA (44–46). More recently, Walter et al. have

6 Palmer
described a high-throughput RNAi screen of chromosome phe-
notypes (47).
2.2.3. Antibody
A variation on the theme of over-expression arrays was the
development of antibody cell-based microarrays. The poten-
tial to screen single-chain antibody fragments using cell-based
microarrays was first demonstrated by Delehanty et al. They
expressed a wild-type fluorescein antibody fragment and three
mutants on HEK293T cell membranes on a cell-based microar-
ray and demonstrated that fluorescein had a higher affinity for
the wild-type fluorescein antibody fragment than the antibody
mutants (48). Suranati et al. and Roupioz et al. have demon-
strated the use of antibody arrays for the detection of blood cells,
in particular lymphocytes on cell-based micorarrays (49, 50).
2.2.4. Drug Screening
on Cell-Based
Microarrays
The groups of Sabatini and Stockwell have explored the possi-
bility of combining RNAi and compound screens on cell-based
microarrays. To facilitate the retention and slow diffusion of
arrayed compounds, they first printed discs of a polymer matrix
onto the slide. They then printed 70 known active compounds
in triplicate at three concentrations on top of the polymer discs.
Seven siRNAs that knocked down proteins involved in cell death,
P53, PTEN, MDM2, EGFR, TSC2, BCL2 and BRCA1 were
transfected into the cells growing over the bioactive compounds.
Clusters of cells associated with three of the compounds were
observed to change in density, indicating that the drugs were
counteracting the effect of the genes that had been knocked down
(51).
2.3. Adaptation of
Cell-Based
Microarrays for a
Variety of Cell Types
The initial studies on cell-based microarrays were carried out in
HEK293T cells, as they are an easy to transfect cell line. How-
ever, the Sabatini group sought to circumvent this issue by print-
ing lentiviruses onto arrays. Lentiviruses have a high take-up rate
in a variety of cells including primary cells, and the group showed
that lentiviruses pseudotyped as vesicular stomatitis virus glyco-
protein were taken up by primary human BJ fibroblasts and pri-
mary mouse dendritic cells as well as HeLa, A549, HEK-293T
and DU145 cells (52).
Other groups also developed systems for less easy to trans-
fect cells. Oehmig et al. demonstrated the use of adenovirus
for cell-based microarrays; the transfection step is not necessary
when using adenovirus and this enables less easily transfected
cells to take up the gene of interest. The group demonstrated
the approach by the transfection of primary human umbilical vein
cells (HUVEC) (53).
Narayanaswamy et al. demonstrated the use of cell-based
microarrays with yeast cells; they applied 4,800 yeast deletion

strains to arrays to establish genes controlling the response of
yeast cells to mating pheromone (54).
Kato et al. coated the surface of a glass culture dish with a cell
membrane anchoring reagent, biocompatible anchor for mem-
brane (BAM), with an oleyl chain as a lipid anchor. They demon-
strated that non-adherent human erythroleukemic K562 cells and
liposomes could attach to the BAM (55, 56). Another approach
by Yoshikawa et al. was to use surface-deposited fibronectin on
the surface of the microarray, which enhanced transfection effi-
ciency and allowed transfection of primary human mesenchymal
stem cells (57).
2.4. Advances in
Array Surface
Chemistry and
Transfection
Efficiencies
A number of groups have tried to improve transfection efficiency
on cell-based arrays. One group has developed slides with cationic
polymers on the surface, so that cells can be added without the
need for a transfection reagent (58). A further group developed a
surface transfection and expression protocol (STEP) with recom-
binant proteins designed to enhance transfection when in a com-
plex with expression vector DNAs prior to spotting on glass slides
(25). Kato et al., as previously mentioned, coated the surface of
a glass culture dish with a biocompatible anchor for membrane
(BAM) (59). In a further study by the same group, Kato et al.
demonstrated that a liposome:plasmid expressing GFP mix spot-
ted onto the BAM surface was capable of transfecting cells. They
showed that an RNAi to GFP caused the knockdown of GFP
in a non-adherent K562 cell line stably expressing GFP (60).
Delehanty et al. compared glass slides coated with different sub-
strates to determine which gave the best transfection efficiencies.
They compared polystyrene, two types of aminosilane coating and
two types of polylysine-coated slides. They concluded that spot
size was proportional to substrate hydrophobicity, i.e. the polyly-
sine slides were the least hydrophobic and had the largest spot
size. However, the transfection rates were highest with the most
hydrophobic coating and polystyrene and lowest on the polylysine
slides (61). Yamauchi et al. used micro-patterned, self-assembled
monolayers (SAM) of alkanethiols formed on a gold-evaporated
glass plate for cell-based microarrays. They demonstrated that
by repeating layers of plasmid DNA and liposome:plasmid DNA
mixes, improved transfection efficiencies could be achieved (62).
How et al. have described the efficient formation of complexes
between plasmid DNA and dendrimers on cell-based microar-
rays that transfect efficiently into the cell after the addition of
lipoplexes (63). Isalan et al. achieved transfection in a variety
of cell lines in a cell-based microarray format using magnetically
defined positions and PCR product-coated paramagnetic beads
(64). To increase transfection efficiency further, Yamauchi et al.
described an electroporation method in which electric pulses were
used to detach plasmids from the microarray surface to introduce

8 Palmer
them into cells grown on the microarray (65). More recently the
Iwata group have developed this method for siRNA (66) and have
also prolonged the durability of the electroporation microarrays
by adding saccharides to nucleic acids (67).
Another approach by Yoshikawa et al. was to use surface-
deposited fibronectin on the surface of the microarray, which
enhanced transfection efficiency (57).
Hook et al. described a high-density poly (ethylene glycol)
coating on glass slides with phenylazide-modified polymers and
irradiation by UV to result in cross-linking of the polymer spots
to the surface and printing of plasmids for strong attachment; they
demonstrated that this coating provides a very adherent substrate
for DNA, protein and cell-based arrays (68).
Pernagallo et al. have investigated the use of polymer arrays
which allow non-adherent cell lines to adhere and proliferate; they
demonstrated that K562 human erythroleukemic cells, which
normally grow in suspension, adhered and proliferated on sev-
eral different polymers coated on slides for cell-based microarrays
(69).
2.5. Imaging of
Cell-Based
Microarrays
High-throughput imaging systems are necessary to systematically
record cell-based microarray readouts for fixed and live imaging,
and methods are being developed for cell-based microarrays and
the Pepperkok group is the forefront of the development of high-
throughput RNAi screens (44–47).
A cell image analysis software called CellProfiler has been
developed and is freely available to allow automatic quantitative
measurements to be made from thousands of images (70).
3. Conclusions
Cell-based microarrays are very powerful analysis tools. Their util-
ity in exploring gene function through both over- and knock-
down expression studies has now been clearly demonstrated due
to libraries of siRNA and cDNAs for different organisms becom-
ing comprehensive. Robust methods for attachment of cDNA to
glass slides have been implemented, transfection techniques have
been improved through electroporation and adeno- and lentivirus
work allowing a variety of different types of cells such as non-
adherent stem cells to be analysed in a high-throughput fashion.
Automated platforms for cell imaging have been developed and
image software is freely available. The compact format of cell-
based arrays and the ability to carry out thousands of independent
assays in parallel with the minimum reagent requirements make
the cell-based microarray approach a very attractive proposition
where routine high-throughput screening is required.

Acknowledgments
Adapted from Pharmacogenomics (2005), 6(5), 527–534 with
permission of Future Medicine Ltd.
References
1. DeRisi, J., Iyer, V., Brown, P. (1997) Explor-
ing the metabolic and genetic control of gene
expression on a genomic scale. Science 278,
680–686.
2. Wodicka, L., Dong, H., Mittmann, M.,
Ho, M., Lockhart, D. (1997) Genome-wide
expression monitoring in Saccharomyces
cerevisiae. Nat Biotechnol 15, 1359–1367.
3. Pinkel, D., Segraves, R., Sudar, D., Clark,
S., Poole, I., Kowbel, D., Collins, C., Kuo,
W., Chen, C., Zhai, Y., Dairkee, S., et al.
(1998) High resolution analysis of DNA
copy number variation using comparative
genomic hybridization to microarrays. Nat
Genet 20, 207–211.
4. Pollack, J., Perou, C., Alizadeh, A., Eisen,
M., Pergamenschikov, A., Williams, C.,
Jeffrey, S., Botstein, D., Brown, P. (1999)
Genome-wide analysis of DNA copy-number
changes using cDNA microarrays. Nat Genet
23, 41–46.
5. Hacia, J., Fan, J., Ryder, O., Jin, L., Edge-
mon, K., Ghandour, G., Mayer, R., Sun, B.,
Hsie, L., Robbins, C., Brody, L., et al. (1999)
Determination of ancestral alleles for human
single-nucleotide polymorphisms using high-
density oligonucleotide arrays. Nat Genet 22,
164–167.
6. Mei, R., Galipeau, P., Prass, C., Berno, A.,
Ghandour, G., Patil, N., Wolff, R., Chee, M.,
Reid, B., Lockhart, D. (2000) Genome-wide
detection of allelic imbalance using human
SNPs and high-density DNA arrays. Genome
Res 10, 1126–1137.
7. Shi, M. H., Maier, S., Nimmrich, I., Yan,
P. S., Caldwell, C. W., Olek, A., Huang, T.
H. (2003) Oligonucleotide-based microarray
for DNA methylation analysis: principles and
applications. J Cel Biochem 88, 138–43.
8. Ren, B., Robert, F., Wyrick, J., Aparicio,
O., Jennings, E., Simon, I., Zeitlinger, J.,
Schreiber, J., Hannett, N., Kanin, E. (2000)
Genome-wide location and function of DNA
binding proteins. Science 290, 2306–2309.
9. Pavlickova, P., Schneider, E., Hug, H. (2004)
Advances in recombinant antibody microar-
rays. Clin Chim Acta 343, 17–35.
10. Uetz, P. (2001) Two-hybrid arrays. Curr
Opin Chem Biol 6, 57–62.
11. Fukui, S., Feizi, T., Galustian, C., Law-
son, A., Chai, W. (2002) Oligosaccharide
microarrays for high-throughput detection
and specificity assignments of carbohydrate-
protein interactions. Nat Biotechnol 20,
1011–1017.
12. MacBeath, G., Koehler, A. N., Schreiber,
S. L. (1999) Printing small molecules as
microarrays and detecting protein-ligand
interactions en masse. J Am Chem Soc 121,
7967–7968.
13. Lamesch, P., Milstein, S., Hao, T.,
Rosenberg, J., Li, N., Sequerra, R.,
Bosak, S., Doucette-Stamm, L., Vanden-
haute, J., Hill, D., Vidal, M. (2004)
C. Elegans ORFeome version 3.1: increas-
ing the coverage of ORFeome resources with
improved gene predictions. Genome Res 14,
2064–2069.
14. Stapleton, M., Carlson, J., Brokstein, P., Yu,
C., Champe, M., George, R., Guarin, H.,
Kronmiller, B., Pacleb, J., Park, S., Wan, K.,
Rubin, G., Celniker, S. (2002) A drosophila
full-length cDNA resource. Genome Biol 3,
RESEARCH0080.
15. Brizuela, L., Richardson, A., Marsischky, G.,
Labaer, J. (2002) The FLEXGene repository:
exploiting the fruits of the genome projects
by creating a needed resource to face the
challenges of the post-genomic era. Arch Med
Res 33, 318–324.
16. Mewes, H., Amid, C., Arnold, R., Frish-
man, D., Güldener, U., Mannhaupt, G.,
Münsterkötter, M., Pagel, P., Strack, N.,
Stümpflen, V., Warfsmann, J., Ruepp, A.
(2004) MIPS: analysis and annotation of pro-
teins from whole genomes. Nucleic Acids Res
32, D41–D44.
17. Strausberg, R., Feingold, E., Grouse, L.,
Derge, J., Klausner, R., Collins, F., Wagner,
L., Shenmen, C., Schuler, G., Altschul, S.,
et al. (2002) Generation and initial analysis
of more than 15,000 full-length human and
mouse cDNA sequences. Proc Natl Acad Sci
USA 99, 16899–16903.
18. Temple, G., Gerhard, D., Rasooly, R., Fein-
gold, E., Good, P., Robinson, C., Mandich,
A., Derge, J., Lewis, J., Shoaf, D., et al.
(2009) The completion of the mammalian

10 Palmer
gene collection (MGC). Genome Res 19,
2324–2333.
19. Berns, K., Hijmans, E., Mullenders, J.,
Brummelkamp, T., Velds, A., Heimerikx, M.,
Kerkhoven, R., Madiredjo, M., Nijkamp, W.,
Weigelt, B., et al. (2004) A large-scale RNAi
screen in human cells identifies new com-
ponents of the p53 pathway. Nature 428,
431–437.
20. Kamath, R., Fraser, A., Dong, Y., Poulin,
G., Durbin, R., Gotta, M., Kanapin, A., Le
Bot, N., Moreno, S., Sohrmann, M., et al.
(2003) Systematic functional analysis of the
Caenorhabditis elegans genome using RNAi.
Nature 421, 231–237.
21. Paddison, P. J., Silva, J. M., Conklin, D.
S., Schlabach, M., Li, M., Aruleba, S., Bal-
ija, V., O’Shaughnessy, A., Gnoj, L., Scobie,
K., Chang, K., Westbrook, T., et al. (2004)
A resource for large-scale RNA-interference-
based screens in mammals. Nature 428,
427–431.
22. Ziauddin, J., Sabatini, D. (2001) Microarrays
of cells expressing defined cDNAs. Nature
411, 107–110.
23. Webb, B., Díaz, B., Martin, G., Lai, F.
(2003) A reporter system for reverse trans-
fection cell arrays. J Biomol Screen 8,
620–623.
24. Mishina, Y., Wilson, C., Bruett, L., Smith,
J., Stoop-Myer, C., Jong, S., Amaral, L.,
Pedersen, R., Lyman, S., Myer, V., Kreider,
B., Thompson, C. (2004) Multiplex GPCR
assay in reverse transfection cell microarrays.
J Biomol Screen 9, 196–207.
25. Redmond, T., Ren, X., Kubish, G., Atkins, S.,
Low, S., Uhler, M. (2004) Microarray trans-
fection analysis of transcriptional regulation
by cAMP-dependent protein kinase. Mol Cell
Proteomics 3, 770–779.
26. Yamauchi, F., Okada, M., Kato, K., Jakt,
L., Iwata, H. (2007) Array-based func-
tional screening for genes that regulate
vascular endothelial differentiation of flk1-
positive progenitors derived from embry-
onic stem cells. Biochim Biophys Acta 1770,
1085–1097.
27. Hu, Y., Warnatz, H., Vanhecke, D., Wag-
ner, F., Fiebitz, A., Thamm, S., Kahlem,
P., Lehrach, H., Yaspo, M., Janitz, M.
(2006) Cell array-based intracellular localiza-
tion screening reveals novel functional fea-
tures of human chromosome 21 proteins.
BMC Genomics 7, 155.
28. Palmer, E., Miller, A., Freeman, T. (2006)
Identification and characterisation of human
apoptosis inducing proteins using cell-based
transfection microarrays and expression anal-
ysis. BMC Genomics 7, 145.
29. Mannherz, O., Mertens, D., Hahn, M.,
Lichter, P. (2006) Functional screening
for proapoptotic genes by reverse transfec-
tion cell array technology. Genomics 87,
665–672.
30. Fire, A., Xu, S., Montgomery, M. K., Kostas,
S. A., Driver, S. E., Mello, C. C. (1998)
Potent and specific genetic interference by
double-stranded RNA in caenorhabditis ele-
gans. Nature 391, 806–811.
31. Elbashir, S. M., Martinez, J., Patkaniowska,
A., Lendeckel, W., Tuschl, T. (2001) Func-
tional anatomy of siRNAs for mediating
efficient RNAi in drosophila melanogaster
embryo lysate. EMBO J 20, 6877–6888.
32. Hammond, S. M., Bernstein, E., Beach, D.,
Hannon, G. J. (2000) An RNA-directed
nuclease mediates post-transcriptional gene
silencing in drosophila cells. Nature 404,
293–296.
33. Huppi, K., Martin, S., Caplen, N. (2005)
Defining and assaying RNAi in mammalian
cells. Mol Cell 17, 1–10.
34. Stevenson, M. (2004) Therapeutic potential
of RNA interference. N Engl J Med 351,
1772–1777.
35. Gil, J., Esteban, M. (2000) Induction of
apoptosis by the dsRNA-dependent protein
kinase (PKR): mechanism of action. Apopto-
sis 5, 107–114.
36. Elbashir, S. M., Lendeckel, W., Tuschl, T.
(2000) RNA interference is mediated by
21- and 22-nucleotide RNAs. Gen Dev 15,
188–200.
37. Brummelkamp, T., Bernards, R., Agami, R.
(2002) A system for stable expression of
short interfering RNAs in mammalian cells.
Science 296, 550–553.
38. Wheeler, D., Bailey, S., Guertin, D., Car-
penter, A., Higgins, C., Sabatini, D. (2004)
RNAi living-cell microarrays for loss-of-
function screens in drosophila melanogaster
cells. Nat Methods 1, 127–132.
39. Baghdoyan, S., Roupioz, Y., Pitaval, A., Cas-
tel, D., Khomyakova, E., Papine, A., Sous-
saline, F., Gidrol, X. (2004) Quantitative
analysis of highly parallel transfection in cell
microarrays. Nucleic Acids Res 32, e77.
40. Mousses, S., Caplen, N., Cornelison, R.,
Weaver, D., Basik, M., Hautaniemi, S.,
Elkahloun, A., Lotufo, R., Choudary, A.,
Dougherty, E., et al. (2003) RNAi microar-
ray analysis in cultured mammalian cells.
Genome Res 13, 2341–2347.
41. Silva, J., Mizuno, H., Brady, A., Lucito,
R., Hannon, G. (2004) RNA interfer-
ence microarrays: high-throughput loss-of-
function genetics in mammalian cells. Proc
Natl Acad Sci USA 101, 6548–6552.

42. Erfle, H., Simpson, J., Bastiaens, P., Pep-
perkok, R. (2004) SiRNA cell arrays for high-
content screening microscopy. Biotechniques
37, 454–458.
43. Kumar, R., Conklin, D., Mittal, V. (2003)
High-throughput selection of effective RNAi
probes for gene silencing. Genome Res 13,
2333–2340.
44. Erfle, H., Neumann, B., Liebel, U., Rogers,
P., Held, M., Walter, T., Ellenberg, J.,
Pepperkok, R. (2007) Reverse transfection
on cell arrays for high content screening
microscopy. Nat Protoc 2, 392–399.
45. Neumann, B., Held, M., Liebel, U., Erfle,
H., Rogers, P., Pepperkok, R., Ellenberg, J.
(2006) High-throughput RNAi screening by
time-lapse imaging of live human cells. Nat
Methods 3, 385–390.
46. Simpson, J., Cetin, C., Erfle, H., Joggerst,
B., Liebel, U., Ellenberg, J., Pepperkok, R.
(2007) An RNAi screening platform to iden-
tify secretion machinery in mammalian cells.
J Biotechnol 129, 352–365.
47. Walter, T., Held, M., Neumann, B., Hériché,
J., Conrad, C., Pepperkok, R., Ellenberg, J.
(2009) Automatic identification and cluster-
ing of chromosome phenotypes in a genome
wide RNAi screen by time-lapse imaging. J
Struct Biol 170, 1–9.
48. Delehanty, J., Shaffer, K., Lin, B. (2004)
Transfected cell microarrays for the expres-
sion of membrane-displayed single-chain
antibodies. Anal Chem 76, 7323–7328.
49. Roupioz, Y., Berthet-Duroure, N., Leïchlé,
T., Pourciel, J., Mailley, P., Cortes, S., Vil-
liers, M., Marche, P., Livache, T., Nicu,
L. (2009) Individual blood-cell capture and
2d organization on microarrays. Small 5,
1493–1497.
50. Suraniti, E., Sollier, E., Calemczuk, R.,
Livache, T., Marche, P., Villiers, M., Rou-
pioz, Y. (2007) Real-time detection of lym-
phocytes binding on an antibody chip using
SPR imaging. Lab Chip 7, 1206–1208.
51. Bailey, S., Sabatini, D., Stockwell, B. (2004)
Microarrays of small molecules embedded
in biodegradable polymers for use in mam-
malian cell-based screens. Proc Natl Acad Sci
USA 101, 16144–16149.
52. Bailey, S., Ali, S., Carpenter, A., Hig-
gins, C., Sabatini, D. (2006) Microarrays
of lentiviruses for gene function screens in
immortalized and primary cells. Nat Methods
3, 117–122.
53. Oehmig, A., Klotzbücher, A., Thomas, M.,
Weise, F., Hagner, U., Brundiers, R., Wald-
herr, D., Lingnau, A., Knappik, A., Kubbu-
tat, M., et al. (2008) A novel reverse trans-
duction adenoviral array for the functional
analysis of shRNA libraries. BMC Genomics
9, 441.
54. Narayanaswamy, R., Niu, W., Scouras, A.,
Hart, G., Davies, J., Ellington, A., Iyer,
V., Marcotte, E. (2006) Systematic pro-
filing of cellular phenotypes with spotted
cell microarrays reveals mating-pheromone
response genes. Genome Biol 7, R6.
55. Kato, K., Umezawa, K., Funeriu, D., Miyake,
M., Miyake, J., Nagamune, T. (2003) Immo-
bilized culture of nonadherent cells on an
oleyl poly (ethylene glycol) ether-modified
surface. Biotechniques 35, 1014–1018.
56. Kato, K., Umezawa, K., Miyake, M.,
Miyake, J., Nagamune, T. (2004) Transfec-
tion microarray of nonadherent cells on an
oleyl poly (ethylene glycol) ether-modified
glass slide. Biotechniques 37, 444–448.
57. Yoshikawa, T., Uchimura, E., Kishi, M.,
Funeriu, D., Miyake, M., Miyake, J. (2004)
Transfection microarray of human mes-
enchymal stem cells and on-chip siRNA
gene knockdown. J Control Release 96,
227–232.
58. Chang, F., Lee, C., Chen, M., Kuo, C., Chi-
ang, U., Hang, C., Roffler, S. (2004) Sur-
fection: a new platform for transfected cell
arrays. Nucleic Acids Res 32, e33.
59. Kato, K., Umezawa, K., Funeriu, D. P.,
Miyake, M., Miyake, J., Nagamune, T.
(2003) Immobilized culture of nonadher-
ent cells on an oleyl poly (ethylene gly-
col) ether-modified surface. Biotechniques 35,
1014–1021.
60. Kato, K., Umezawa, K., Miyake, M.,
Miyake, J., Nagamune, T. (2004) Transfec-
tion microarray of nonadherent cells on an
aleyl poly (ethylene glycol) ether-modified
glass slide. Biotechniques 37, 444–452.
61. Delehanty, J., Shaffer, K., Lin, B. (2004) A
comparison of microscope slide substrates for
use in transfected cell microarrays. Biosens
Bioelectron 20, 773–779.
62. Yamauchi, F., Kato, K., Iwata, H. (2004)
Micropatterned, self-assembled monolayers
for fabrication of transfected cell microarrays.
Biochim Biophys Acta 1672, 138–147.
63. How, S., Yingyongnarongkul, B., Fara, M.,
Díaz-Mochón, J., Mittoo, S., Bradley, M.
(2004) Polyplexes and lipoplexes for mam-
malian gene delivery: from traditional to
microarray screening. Comb Chem High
Throughput Screen 7, 423–430.
64. Isalan, M., Santori, M., Gonzalez, C., Ser-
rano, L. (2005) Localized transfection on
arrays of magnetic beads coated with PCR
products. Nat Methods 2, 113–118.
65. Yamauchi, F., Kato, K., Iwata, H. (2004)
Spatially and temporally controlled gene

12 Palmer
transfer by electroporation into adherent cells
on plasmid DNA-loaded electrodes. Nucleic
Acids Res 32, e187.
66. Fujimoto, H., Kato, K., Iwata, H. (2008)
Electroporation microarray for parallel trans-
fer of small interfering RNA into mam-
malian cells. Anal Bioanal Chem 392,
1309–1316.
67. Fujimoto, H., Kato, K., Iwata, H. (2009)
Prolonged durability of electroporation
microarrays as a result of addition of sac-
charides to nucleic acids. Anal Bioanal Chem
393, 607–614.
68. Hook, A., Thissen, H., Voelcker, N. (2009)
Advanced substrate fabrication for cell
microarrays. Biomacromolecules 10, 573–79.
69. Tourniaire, G., Diaz-Mochon, J., Bradley,
M. (2009) Fingerprinting polymer microar-
rays. Comb Chem High Throughput Screen 12,
690–696.
70. Carpenter, A., Jones, T., Lamprecht, M.,
Clarke, C., Kang, I., Friman, O., Guertin,
D., Chang, J., Lindquist, R., Moffat, J., et al.
(2006) CellProfiler: image analysis software
for identifying and quantifying cell pheno-
types. Genome Biol 7, R100.

Chapter 2
Cell-Based Co-transfection Microarrays
for Use with HEK293T Cells on a Poly
D-Lysine-Coated Polystyrene Microplate
Meenal Soni and Fang Lai
Abstract
Analysis of the human genome sequence has identified thousands of putative genes with unknown
function; therefore, a new tool allowing for rapid identification of gene functions is needed. Reverse trans-
fection microarray technology, which turns a DNA microarray into a cell-based microarray, has emerged
for simultaneously studying the function of many genes. Since the initial demonstration in 2001, many
variations have surfaced, making the technology more versatile for a broad range of applications. We
have developed a protocol to make ready-to-transfect DNA microarrays in a 96-well microplate for co-
transfection of two plasmids into HEK293T cells. This cell-based microarray in a microplate may be used
for screening hundreds of analytes against multiple protein targets in parallel, providing a powerful tool
for functional genomics and drug discovery.
Key words: Reverse transfection, surface-mediated transfection, co-transfection, cell microarray,
microplate, GFP, LacZ.
1. Introduction
Reverse transfection microarray technology first developed by
Ziauddin and Sabatini is a powerful tool for bridging genomics
with proteomics (1). The technology involves three basic steps
to turn a DNA microarray into a cell-based microarray. First, a
DNA microarray is fabricated, in which each microspot contains
a plasmid DNA capable of expressing a gene of interest. Sec-
ond, the DNA microarray is treated with transfection reagents.
Third, adherent cells are grown on the treated DNA microarray.
13

14 Soni and Lai
Due to surface-mediated transfection enabled by the presence of
transfection reagents, the cells on top of a microspot take up
the plasmid DNA and express the protein encoded by it, pro-
ducing a localized patch of transfected cells, a cell microspot.
This cell-based microarray with the number of cell microspots
corresponding to the number of DNA microspots can be used
to simultaneously study the function of dozens or hundreds of
genes. Recently, the technology has been extended for turning a
microarray of siRNA, virus, or even chemical compounds into a
cell-based microarray for many cellular and biological applications
(2–4).
Over the years, many modifications have been made. To cir-
cumvent the need for extensive post-transfection processing of the
cell-based microarray to detect protein activity, we have devel-
oped a reporter system using green fluorescent protein (GFP)
for direct readout (5). In this system, two plasmids, one for a
target protein and the other for GFP which can be turned on
only when the target protein is active, are printed within a single
microspot and can be co-transfected. Since the presence of GFP,
which is readily visualized by an imaging system, is the indica-
tor of the activity of the target protein, the cell-based microar-
ray assay is substantially simplified through elimination of fixing
and permealizing cells, as well as immunostaining with multiple
antibodies.
Although γ-aminopropylsilane (GAPS)-coated glass (Corn-
ing Incorporated, Lowell, MA) and poly-D-lysine (PDL)-coated
glass or polystyrene (PS) surfaces are suitable for reverse trans-
fection, efforts have been made to create a ready-to-transfect
surface so that the second step, treatment with transfection
reagents, may be eliminated. In 2000, before the publication
of reverse transfection, Zheng et al. reported that immobi-
lizing a plasmid DNA on polyethyleimine (PEI) attached to
a polymer film made of poly(epsilon-CBZ-L-lysine) (PCBZL)
mixed with poly(D,L-lactic-co-glycolic) or poly(L-lactic acid)
could enable surface-mediated transfection (6). In 2008, two
reports described the use of PEI-plasmid complexes immobilized
on self-assembled monolayers (SAMs) of ethylene glycol (EG)
and carboxylic acid-terminated alkanethiols or on small intesti-
nal sub-mucosa (SIS) for improved transfection efficiency (7, 8).
Similarly, calcium-phosphate (Ca-P)–DNA co-precipitates on or
encapsulated in fast-degrading polymer was also found to be ade-
quate for transfection of HEK293, HeLa, and NIH 3T3 cells
(9). Most recently, Oyane et al. reported that including a cell
adhesion molecule such as laminin or fibronectin in a DNA-
apatite composite layer enhanced transfection efficiency (10).
Moreover, fibrin-based hydrogel embedded with lipofectamine–
plasmid lipoplexes was shown to be useful for transfection of
cells on top of the gel (2D) and within the gel (3D) (11).

Co-transfection Microarrays 15
While potentially useful, the feasibility of applying aforemen-
tioned methods to making cell-based microarrays has not yet been
demonstrated.
Using a PDL-coated PS microplate, we have developed
a method to print plasmid mixed with transfection reagents
(effectene) and gelatin into a DNA microarray for reverse trans-
fection (12). This ready-to-transfect DNA microarray could be
stored at 4◦C for up to 1 year without significant loss of transfec-
tion efficiency. While our paper was still in press, another group
reported a similar method but on poly (vinyl alcohol) (PVA) sur-
face pre-patterned with sodium hypochlorite (NaOCl) (13).
A growing list of adherent cells with different tissue or species
origin such as A549, cos7, and Drosophila cells has been suc-
cessfully used for reverse transfection. Human embryonic kid-
ney 293T (HEK293T), a cell line derived from transforming
HEK293 cells with SV40 large T gene, is one of the most widely
used cell lines. The fast-growing HEK293T cells, with a doubling
time of 16–20 h, are relatively easy to transfect with 40–80% of
transfection efficiency.
The transfection efficiency is affected by multiple factors,
including cell type, the size, purity, and amount of plasmid
DNA, transfection reagents, as well as transfection formats (sur-
face mediated vs. solution based). The last two factors have been
systematically examined (14, 15). On a particular surface with
a given cell type, optimizing transfection conditions are often
necessary to achieve high transfection efficiency. In this chapter,
using a two-plasmid model (one for GFP and one for LacZ),
we have described a detailed protocol for making a ready-to-
transfect DNA microarray in a 96-well microplate and optimal co-
transfection of HEK293T cells for creating a cell-based microar-
ray for two-color assays.
2. Materials
2.1. Microarray
Fabrication
1. phMGFP, plasmid containing the gene for green fluores-
cent protein (GFP) (Promega, Madison, WI). Store at
–20◦C.
2. pcDNA3.1/V5-His/lacZ, plasmid containing the gene for
LacZ, and its vector phRL-SV40 (Invitrogen Co., Carls-
bad, CA). Store at –20◦C.
3. Gelatin, 12% (w/v) in deionized (DI) water. Store at 4◦C.
Prepare working solution by mixing 10 μl of 12% gelatin
with 90 μl of DI water to make final concentration of 1.2%,
and store at 4◦C up to 1 month.

16 Soni and Lai
4. Poly-D-lysine (PDL)-coated microplates (Corning Incor-
porated, Lowell, MA). Store at 4◦C.
5. 384-well plate reservoir (Corning Incorporated, Lowell,
MA).
6. Effectene transfection reagent kit, including EC buffer,
enhancer, and effectene (Qiagen, Valencia, CA). Store at
4◦C.
7. 1.5 M Sucrose in DI water (Invitrogen Co., Carlsbad, CA).
Store at 4◦C.
8. Chipmaker Micro Spotting Pin CMP10B (Arrayit Cor-
poration, former Telechem International, Inc., Sunnyvale,
CA).
2.2. HEK293T Cell
Culture
1. Human embryonic kidney cell line HEK293T (Gen-
Hunter, Nashvil, TN).
2. Fetal calf serum (FCS). Store at –20◦C.
3. Pen Strep: 10,000 units/ml penicillin, streptomycin
10,000 μg/ml. Store at –20◦C.
4. Dulbecco’s modified eagle medium (DMEM). Store at
4◦C.
5. Complete medium: DMEM 500 ml, FCS 10% (v/v),
Pen Strep 1% (v/v) (final concentration of penicillin 100
units/ml and streptomycin 100 μg/ml). Store at 4◦C for
up to 6 months.
6. Trypsin–EDTA: 0.025% (w/v) trypsin and 0.01% (w/v)
EDTA (ethylenediaminetetraacetic acid in a phosphate
buffer salt solution with 5 mM glucose) (Invitrogen Co.,
Carlsbad, CA). Store at 4◦C.
7. Phosphate buffered saline (PBS). Store at 4◦C.
8. Dimethylsulfate (DMSO).
9. Tissue-culture-treated (TCT) flasks, T-75, and T-150.
10. 15- and 50-ml centrifuge tubes.
2.3. Cell Microarray
Assay
1. 0.2% Triton X-100: prepare a working solution, 0.2 ml tri-
ton X-100, 99.8 ml PBS.
2. Ten percent goat serum (Invitrogen Co., Carlsbad, CA):
prepare a working (blocking) solution, 1 ml goat serum,
9 ml PBS.
3. Primary antibody, anti-Lac Z mouse IgG (Santa Cruz
Biotechnology, Santa Cruz, CA).
4. Secondary antibody, Cy3-labeled goat anti-mouse IgG
(Jackson ImmunoResearch Laboratories, West Grove, PA).
5. Ninety-six-well microplate aluminum sealing tape (Corn-
ing Incorporated, Lowell, MA).

3. Methods
3.1. Transformation
and Bacterial Culture
If starting with a plasmid preparation, it is necessary to make
a bacterial clone for replicating the plasmid via transformation.
Many companies sell Escherichia coli competent cells accompanied
with a detailed protocol for transformation. We have used the
E. coli HB101 competent cells from Invitrogen (Carlsbad, CA)
for cloning purpose.
3.2. Plasmid
Amplification
and Purification
A plasmid is amplified in a 200-ml bacterial culture. It is isolated
and purified with an alkaline method using a QIAGEN Plasmid
Plus Maxi kit according to the manufacturer’s protocol (QIAGEN
Inc., Valencia, CA).
3.3. Microarray
Sample Preparation
1. Add 1 μl each of the phMGFP (250 ng/μl) and
the pcDNA3.1/V5-His/lacZ (250 ng/μl) plasmid DNAs
(250 ng each) to 9.5 μl EC buffer to a final volume of
11.5 μl (see Note 1).
2. Add 2 μl of enhancer, 1.2 μl of 1.5 M sucrose, and 2 μl of
effectene to a total volume of 16.7 μl. The DNA concentra-
tion is ∼30 ng/μl (see Note 2).
3. Incubate the above mix at room temperature for 15 min
to allow the formation of DNA and transfection reagent
complexes.
4. Add 12 μl of 1.2% gelatin to make a final DNA concentra-
tion of ∼18 ng/μl with each plasmid at 9 ng/μl.
5. Load all 28.7 μl of the sample (mixture of plasmid DNA,
transfection reagents, and gelatin) in a well of a 384-
well microplate until use. Although it is desirable to use
the sample for printing right away, it may be kept at
room temperature for up to 2 h without any noticeable
effect.
3.4. Microarray
Fabrication
1. Prior to sample preparation, turn on the PixSys 5,500
printer (Cartesian Technologies, Irvine, CA), set relative
humidity (RH) to 70%, and let it warm up for 1 h.
2. Prior to printing, turn on warm DI water (45–50◦C) cir-
culator and vacuum pump. Warm water helps to clean the
quill pin thoroughly, but is optional.
3. Place the 384-well microplate carrying the sample onto the
source plate holder.
4. Pre-warm a 96-well PDL-coated microplate for 10 min to
room temperature, and place it onto a sample plate holder.
5. Place a clean 3×4-inch glass slide onto a slide holder.

18 Soni and Lai
6. Place a CMP10B pin onto the pinhead. With the CMP10B
pin, the diameter of a microspot is ∼365 μm. With a
600 μm center-to-center spot distance, a microarray con-
taining up to 36 microspots (6×6) may be printed in each
well. If printing three replicate microspots per sample, then
up to 12 samples can fit into one well.
7. Print microarrays at the bottom of individual wells of the
96-well PDL-coated microplate using the following pro-
gram:
a. Move the pin to water bath, rinse it, and vacuum dry it
for 1 s each; repeat the pin wash cycle four times.
b. Move the pin to source plate, dip it into the sample for
3 s to ensure that the quill (slit) is fully filled (0.6 μl).
c. Move the pin to the glass slide and blot 20 dots to
remove excess sample outside of the pin.
d. Move the pin to a well of the 96-well PDL-coated
microplate and print three replicate microspots at the
bottom; move it to next well to print three microspots;
and so forth until the first four columns of 32 wells are
printed (with a total of 96 microspots).
e. Repeat Steps “a” through “d” twice until the entire plate
is printed with a total of 288 microspots per sample.
f. Repeat Steps “a” through “e” to print second sample
until all the samples are printed. Up to 12 samples may
be printed in one 96-well PDL-coated microplate.
8. Dry the printed microarray plate in a desicator for 1 h at
room temperature. The humidity in the desicator should
be <20%.
9. Cover the dried microplate with a lid, wrap with a piece
of parafilm, and store in a desicator at 4◦C till use. The
printed microarrays are stable for up to 1 year under this
storage condition.
3.5. HEK293T Cell
Preparation
1. Pre-warm complete medium (DMEM with 10% FCS and
1% Pen Strep) in a 37◦C water bath for 15–30 min. The
pre-warmed complete medium is used in all subsequent
steps.
2. Take out a frozen vial of HEK293T cells from a liquid
nitrogen tank (typically contains 2–4×106 cells), while
holding it, immediately place the vial in 37◦C water, and
gently swirl it until the liquid inside of the vial is completely
thawed.
3. Take the vial out from water and spray it thoroughly with
70% ethanol to sterilize the surface, and place it in a laminar
flow hood. All of the following steps are done in the hood.
4. Carefully open the vial and transfer all the cells inside to a
T-75 flask filled with 20 ml of complete medium.

5. Place the T-75 flask into a CO2 (5%) incubator set at 37◦C
with 95% humidity to let cells attach and grow overnight.
6. Take the T-75 flask out from the CO2 incubator, gently
aspirate off the used medium to completely remove DMSO
contained in the frozen vial, and add 20 ml of fresh com-
plete medium.
7. Put the T-75 flask into the CO2 (5%) incubator set at 37◦C
with 95% humidity, and continue to grow cells until the
cells reach 80–90% confluency (∼5–11×104 cells/cm2)
by visual inspection under a microscope. It typically takes
1–2 days to yield ∼4–8×106 cells per flask depending on
the number of viable cells at beginning. It is important to
avoid letting cells reach 100% confluency as many cells start
to die or become unhealthy.
8. Aspirate off the medium and gently wash the cells with 5 ml
of PBS to remove trypsin inhibitors that may come from
serum in the medium.
9. Aspirate off the PBS and trypsinize the cells with 1 ml of
trypsin–EDTA for 2–3 min at room temperature. The cells
can be readily detached from the surface by gently tapping
the flask. Do not shake the flask vigorously and make sure
that cells do not sit in trypsin–EDTA for >10 min.
10. Add 5 ml of complete medium to the flask to stop
trypsinization, break cell clumps by gently pipetting up and
down several times without making bubbles, and transfer
all the cells to a 15-ml centrifuge tube.
11. Centrifuge at ∼1,000×g for 3 min to pellet cells
(3,000 rpm in Baxter Scientific Centrifuge Model 2742
Biofuge 17, Heraeus Sepatech, Germany). Gently pour off
supernatant to remove trypsin–EDTA, and resuspend the
cells in 6 ml of complete medium.
12. The resulting cells may be (i) used for reverse transfection
if <4–8×106 cells are needed, (ii) further propagated for
a large scale reverse transfection, (iii) split (1:10 or 1:20)
for maintenance up to 10 passages, and (iv) propagated for
making more frozen vials.
13. To directly use the cells for reverse transfection, proceed to
Step 18 for cell count.
14. To propagate cells for a large scale reverse transfection, add
1 ml of the cells (∼7–13×105 cells) into each of five T-75
flasks filled with 20 ml of complete medium (see Note 3).
15. Culture cells in a CO2 (5%) incubator set at 37◦C with 95%
humidity overnight to let cells attach and grow.
16. Change the medium the next day, and then every other day
until the cells reach 80–90% confluency by visual inspection
under a microscope.

20 Soni and Lai
17. Harvest cells by repeating Steps 8–11 and transfer the
resulting 6 ml of cells from each T-75 flask to a 50-ml cen-
trifuge tube (pool all the cells from multiple flasks into one
centrifuge tube).
18. Take 50 μl of the cell suspension for cell count using a
Beckman-Coulter Cell Counter (Fullerton, CA) following
manufacturer’s instructions (see Note 4). The cells are now
ready for reverse transfection (proceed to Section 3.6).
19. For cell passage, add 1 ml of the cells from Step 11 into a
T-75 flask filled with 20 ml complete medium and repeat
Step 15–16 until cells reach 80–90% confluency. To keep
HEK293T cells healthy, which is critical for efficient reverse
transfection, it is recommended to use the cells within 10
passages.
20. For making a large quantity of frozen vials of cell stock at
passage #1, add 5 ml of the cells from Step 11 into a T-
150 flask filled with 40 ml of complete medium, and repeat
Step 15–16 until cells reach 80–90%. Trypsinize the cells
with 6 ml Trypsin–EDTA for 3–5 min, add 30 ml of com-
plete medium, and count cells. Pellet cells and re-suspend
the cells in freezing medium (85% DMEM, 10% CFS, 5%
DMSO) at 2–4×106 cells/ml (as described in Step 8–11).
Aliquot the cells at 1 ml per vial, store them at –80◦C
overnight, and then transfer them to the vapor phase of
a liquid nitrogen tank for long-term storage.
3.6. Reverse
Transfection
1. Centrifuge the cells from Step 17 (in Section 3.5) at
∼1,000×g for 5 min, and aspirate off the medium.
2. Re-suspend the cells gently in an appropriate volume of
complete medium to make final concentration of 7×105
cells/ml based on the total cell number obtained from Step
18 (in Section 3.5).
3. Use an automatic pipettor to add 100 μl of the cells into
each well of a 96-well printed microarray plate (7×104
cells/well). Make sure that there are no air bubbles trapped
in the bottom of individual wells, specifically between
the cells and the surface. If there is a bubble, remove it
immediately by pipetting out the cells and gently adding
them back into the well. Having no barriers for cells to
attach to the surface is crucial for the success of reverse
tranfection.
4. Incubate the plate in a CO2 (5%) incubator set at
37◦C with 95% humidity overnight. With exogenous GFP
expression, patches of transfected cells are first detected
after 16–24 h. To ensure maximum transgene expression,
cell microarrays are usually assayed after 48 h.

Assay
1. Remove media with a pipette carefully and gently to
avoid dislodging cells as transfected HEK293T cells usu-
ally become less adherent and easily detached. To prevent
cells from drying, it is recommended to work with no more
than eight wells at a time when doing the assay manually.
2. Wash each well with 100 μl of PBS twice.
3. Add 100 μl of 4% (v/v) formaldehyde in PBS carefully and
slowly down the wall.
4. Incubate for 10 min at room temperature; wash once with
100 μl PBS.
5. Add 100 μl of 0.2% Triton X-100 very carefully down the
wall.
6. Incubate for 5 min at room temperature. This is a perme-
abilizing agent and therefore a difficult step since there is a
high chance that cells may be washed off.
7. Add 100 μl of blocking solution (10% goat serum in PBS)
to each well and incubate for 15 min at room temperature.
8. Dilute primary antibody, anti-LacZ mouse IgG, in PBS
(usually between 1:20 and 1:500), and add 100 μl of the
diluted primary antibody in each well.
9. Incubate for 1 h at room temperature for detecting an
exogenous protein. The time needed for detecting endoge-
nous proteins may be longer (up to 2 h).
10. Remove the primary antibody and carefully wash three
times with 100 μl of PBS.
11. Dilute fluorescently labeled secondary antibody, Cy3-
labeled goat anti-mouse IgG, in PBS (usually 1:500), and
add 100 μl of the diluted secondary antibody in each well.
12. Incubate for 1 h in the dark.
13. Remove the secondary antibody and carefully wash three
times with 100 μl of PBS.
14. Cells can be stored with foil covering over the microplate
at 4◦C until ready to image.
Imaging and Data
Analysis
1. Carefully flip the microplate on a piece of paper towel to
drain all the liquid in the wells, and seal the wells with a
piece of microplate sealing tape.
2. Scan the microplate for GFP signals with a 488-nm laser
and a 532-nm filter (488 nmex/535 nmem) at a PMT gain
of 190, and LacZ signals (labeled with Cy3) with a 532-nm
laser and a 590-nm filter (532 nmex/590 nmem) at PMT
gain of 210 in a Tecan LS400 fluorescent scanner (Research
Triangle Park, NC).

22 Soni and Lai
3. The images may be analyzed with Array Pro Analyzer (pro-
vided by Tecan). Individual cell microspots are circled, and
relative fluorescent units (RFU) within a circle are mea-
sured (see Note 5). The data output is exported to Excel,
further calculated for average signal intensity of three repli-
cate spots and standard deviation, and graphed (see Note
6).
4. Notes
1. Affected by purity and size, the optimal DNA amount for
high transfection efficiency varies from plasmid to plasmid,
and sometimes even from prep to prep. For a given plas-
mid DNA prep, it is highly recommended to test a range
of quantities first to determine the optimal amount. We
typically tested the range of 100–1,000 ng, translating to
3.5–35 ng/μl after mixing with transfection reagents to
a total volume of 28.7 μl. With a given phMEGF plas-
mid DNA prep, the effect of DNA amount is shown as an
example in Fig. 2.1. The highest transfection efficiency is
achieved with 250 ng (8.7 ng/μl). For co-transfection, simi-
lar tests are done by varying amounts of the two plasmids in a
two-way titration (e.g., 100, 250, 500, and 750 ng) to deter-
mine the optimal amount and ratio of the two plasmids. For
the combination of phMGFP plasmid and pcDNA3.1/V5-
His/lacZ plasmid, we have found that a 1:1 ratio (250 ng
each) works the best (12).
2. Effectene is a nonliposomal lipid reagent and has been
routinely used for solution-based transfection. In an effort
to optimize surface-mediated transfection in a ready-to-
transfect format, i.e., printing DNA together with transfec-
tion reagents, varying amounts of enhancer (4–8 μl) and
effectene (2–4 μl) in the final DNA-transfection reagent mix
have been tested. The difference seems negligible at least
for the phMGFP plasmid and HEK293T cells as shown in
Fig. 2.2. Lipofectamine 2000 from Invitrogen has also been
shown to work (data not shown).
3. The way to propagate cells for reverse transfection can
be very flexible in terms of the number and the size of
flasks or Petri dishes and the ratio of cells to medium
(1:20–5:20) used; all depend on the timing and the scale
for the next reverse transfection experiment. One may use
the following information as guidelines. When HEK293T
cells are cultured in complete medium, approximately
4–8×106 cells (7–13×105 cells/ml in a total volume of
6 ml) may be harvested from a 80–90% confluent T-75

0
5000
10000
15000
20000
25000
30000
35000
40000
100ng 250ng 500ng 1000ng
Total Amount of DNA
Mean
S
ignal
Intens
ity
(R
F
U)
a b
c d
Fig. 2.1. Effect of DNA amounts on reverse tranfection efficiency. Top is the image of a HEK293T cell microarray express-
ing GFP excited at 488 nm and captured at 535 nm with a Tecan scanner. HEK293T cells were transfected with different
amounts of phMGFP plasmid DNA, 100 ng (a), 250 ng (b), 500 ng, (c) or 1,000 ng (d) each mixed with transfection
reagents and printed in triplicate spots. At the bottom is the histogram showing the average relative fluorescent units
(RFU) of three cell microspots resulting from the reverse transfection with the amount of DNA indicated at the bottom.
a b
c d
Fig. 2.2. Optimization of transfection reagents. Shown is the image, excited at 488 nm
and captured at 535 nm with a Tecan scanner, of a HEK293T cell microarray express-
ing GFP generated by mixing 250 ng of phMGFP plasmid DNA with various amounts
of enhancer and effectene. The combinations tested were (a) 4 μl enhancer + 2 μl
effectene, (b) 4 μl enhancer + 4 μl effectene, (c) 8 μl enhancer + 2 μl effectene, and
(d) 8 μl enhancer + 4 μl effectene.

24 Soni and Lai
flask (5–11×104 cells/cm2). If splitting at 1:20 (1 ml cells
in 20 ml medium) ratio in a T-75 flask (7–13×105 cells,
∼9–17×103 cells/cm2), it takes 4–5 days to reach 80–90%
confluency.
4. We have used a cell counter to count cells for convenience
and minimizing human error. The downside of this method
is that there is no information regarding the percent of
viable cells, an important indicator of the cell quality for
reverse transfection. The problem may be circumvented by
not using overly confluent cells (>90%). Conventional hema-
cytometer can also be used for cell count. Using trypan blue
staining for viable cell count is desirable but not necessary.
5. Any microarray imaging system equipped with proper lasers
and filters can be used for imaging cell-based microarray.
Since the resolution of a microarray imaging system is typ-
ically at 5–10 microns per pixel, one can collect only aver-
age signal from multiple transfected cells within a microspot,
demanding high transfection efficiency for sufficient signals.
Moreover, the shape of individual cell microspots is often
irregular, and signals within a microspot are blotchy; there-
fore, defining a microspot area can be tricky and often leads
to big spot to spot variations.
6. We have also used the Discovery-1 automatic fluorescence
microscope (Molecular Devices Co., Sunnyvale, CA) at 2×
or 10× images and Zeiss Axiovert 135 microscope (Carl
Zeiss, Thornwood, NY) at 2.5× or 20× objectives for imag-
ing cell-based microarrays. Both imaging systems offer single
cell resolution. Coupled with MetaMorph software, fluores-
cent signals from individual transfected cells can be measured
and quantified, which is especially helpful for calculating co-
transfection efficiency.
Acknowledgments
We would like to thank Brian L. Webb for his pivotal role in devel-
oping the technology and Janie Causer for her excellent support
in printing DNA microarrays.
References
1. Ziauddin, J., Sabatini, D. M. (2001)
Microarrays of cells expressing defined
cDNAs. Nature 411, 107–110.
2. Wheeler, D. B., Bailey, S. N., Guertin, D. A.,
Carpenter, A. E., Higgins, C. O., Sabatini,
D. M. (2004) RNAi living-cell microarrays
for loss-of-function screens in drosophila
melanogaster cells. Nat Methods 1,
127–132.
3. Bailey, S. N., Ali, S. M., Carpenter, A. E.,
Higgins, C. O., Sabatini, D. M. (2006)
Microarrys of lentiviruses for gene function

screens in immortalized and primary cells.
Nat Methods 3, 117–122.
4. Bailey, S. N., Sabatini, D. M., Stckwell,
B. R. (2004) Microarrays of small molecules
embedded in biodegradable polymers for use
in mammalian cell-based screens. Proc Natl
Acad Sci USA 101, 16144–16149.
5. Webb, B. L., Díaz, B., Marttin, G. S., Lai, F.
(2003) A report system for transfection cell
arrays. J Biomol Screen 8, 620–623.
6. Zheng, J., Manuel, W. S., Hornsby, P. J.
(2000) Transfection of cells mediated
by biodegradable polymer materials with
surface-bound polyethyleneimine. Biotechnol
Prog 16, 254–257.
7. Pannier, A. K., Wieland, J. A., Shea, L. D.
(2008) Surface polyethylene glycol enhances
substrate-mediated gene delivery by non-
specifically immobilized complexes. Acta Bio-
mater 4, 26–39.
8. Tseng, S. J., Chuang, C. J., Tang, S. C.
(2008) Electrostatic immobilization of DNA
polyplexes on small intestinal submucosa for
tissue substrate-mediated transfection. Acta
Biomater 4, 799–807.
9. Zhang, Q., Zhao, D., Zhang, X. Z.,
Cheng, S. X., Zhuo, R. X. (2009) Cal-
cium phosphate/DNA co-precipitates encap-
sulated fast-degrading polymer lims for
substrate-mediated gene delivery. J Biomed
Mater Res B Appl Biomater, 91B, 172–180.
10. Oyane, A., Murayama, M., Yamazaki, A.,
Sogo, Y., Ito, A., Tsurushima, H. (2010)
Fibronectin-DNA-apatite composite layer for
highly efficient and area-specific gene trans-
fer. Biomed Mater Res A, 92A, 1038–1047.
11. Lei, P., Padmashali, R. M., Andreadis, S. T.
(2009) Cell-controlled and spatially arrayed
gene delivery from fibrin hydrogel. Biomate-
rials 30, 3790–3799.
12. Walczak, W., Pipalia, N. H., Soni, M.,
Faruqi, A. F., Ralph, H., Maxfield, F. R.,
Webb, B. L. (2006) Parallel analysis of v-src
mutant protein using reverse transfection cell
arrays. Comb Chem High Throughput Screen
9, 711–718.
13. Peterbauer, T., Heitz, J., Olbrich, M.,
Hering, S. (2006) Simple and versatile meth-
ods for transfection of arrays of live mam-
malian cells. Lab Chip 6, 857–863.
14. Kneuer, C., Ehrhardt, C., Bakowsky, H.,
Kumar, M. N., Oberle, V., Lehr, C. M.,
Hoekstra, D., Bakowsky, U. (2006) The
influence of physicochemical parameters on
the efficacy of non-viral DNA transfection
complexes: a comparative study. J Nanosci
Nanotechnol 6, 2776–2782.
15. Bengali, Z., Rea, J. C., Gibly, R. F., Shea,
L. D. (2009) Efficacy of immobilized poly-
plexes and lipoplexes for substrate-mediated
gene delivery. Biotechnol Bioeng 102,
1679–1691.

Chapter 3
Large-Scale Cell-Based Microarrays and Their Use
with HEK293T Cells and Downstream Apoptotic Assays
Ella Palmer and Tom C. Freeman
Abstract
Cell-based microarrays are a powerful technology platform for performing high-throughput screens of
gene function. The approach entails printing expression vectors containing either genes or shRNAs onto
a glass microscope slide or 384-well microtitre plate to form an array. These vectors are then packaged
in lipid-based transfection reagent, cells grown over the top of the array are transfected and the arrays
can then be examined for alterations in cellular function as manifested in localised changes to the cells
biochemistry or morphology. We have used this technology for two purposes: to study the sub-cellular
localisation of proteins and to perform a large-scale screen for genes that when over-expressed lead to
apoptotic cell death. Here we have provided detailed protocols for the large-scale screen and discuss some
of the issues associated with this technology.
Key words: Reverse transfection, cell-based arrays, high-throughput screens, MGC collection.
1. Introduction
Cell-based microarray technology was first described by Ziauddin
and Sabatini in 2001 (1) for use in performing high-throughput
over-expression studies. The technique as originally published
entailed printing full-length ORFs of genes inserted into an
expression vector onto a glass microscope slide to form a microar-
ray. The arrays were then treated with transfection reagent and
cells grown over the top of the array until confluent. Cells grow-
ing in the vicinity of the spots of packaged genes were shown
to be transfected and the encoded protein over-expressed. Arrays
27

28 Palmer and Freeman
can then be examined for alterations in cellular function, as mani-
fested in localised changes to the cells’ biochemistry or morphol-
ogy. If the expression vector contains a ‘tag’, then the sub-cellular
localisation of the protein can also be analysed (1, 2). Due to
the techniques’ potential for high-throughput analyses and econ-
omy of reagents, a number of groups have since developed the
basic ideas behind cell-based microarrays for a variety of appli-
cations. These applications include the discovery of new mem-
bers of signalling pathways (3) to identify G protein coupled
receptor (GPCR) targets (4) and to screen single-chain antibody
fragments (5) for promoter analyses (6) and for RNAi screens
(7, 8).
Whilst in principle cell-based microarrays provide a power-
ful platform for performing high-throughput transfection screens,
few studies had shown the use of large-scale arrays and analyses
tended to focus on the over-expression of a relatively small num-
ber of genes. One factor that had limited the use of the technol-
ogy was the availability of suitable clone sets that contain tagged
full-length ORFs in mammalian expression vectors, as described
in the original paper (1). Such clone collections are now available
from commercial sources, but for most their use is prohibited by
their expense and restrictions on their use. In a previous study (2),
we explored the use of GFP-tagged genes in Gateway expression
vectors in the fabrication of cell-based arrays. Whilst this work
demonstrated the utility of using tagged clones in visualising the
sub-cellular localisation of the transfected protein, it also high-
lighted certain limitations with this approach. For example, apart
from the considerable expense and time involved in sub-cloning
genes into the Gateway cloning system, there is the possibility
of introducing errors into the ORF during the initial PCR of the
cDNA insert. We also demonstrated that tagging a gene can cause
the protein to mislocalise and therefore disrupt the function of the
native protein.
For the protocol presented here, we therefore elected to use
untagged human cDNA clones from the mammalian gene col-
lection (MGC) (9) for the construction of a cell-based microar-
ray capable of screening a large number of genes, thus avoiding
the problems that a large tag can cause to the folding of the
protein. This protocol describes a truly high-throughput screen-
ing method utilising some of the MGCs non-redundant set of
over 17,000 sequence verified, full-length ORF human clones.
We constructed a cell-based microarray containing plasmid DNA
from 1,959 of these clones in the expression vector pCMV-
SPORT6, with each clone printed in quadruplicate. Seven Gate-
way GFP-tagged genes were printed as transfection controls, and
an empty GFP vector (pEGFP-C1) was also printed to act as a
transfection control and to provide a positional address for the
untagged MGC clones (10). See Fig. 3.1 for an overview of the
procedure.

Large-Scale Cell-Based Microarrays 29
Fig. 3.1. Overview of the design and use of the large-scale cell-based microarray for over-expression studies. (a) Rep-
resentative agarose gel image of plasmids prepared from 2,976 MGC (IRAT) clones. (b) Array was designed such that
each clone was printed in quadruplicate (grey and white squares) surrounded by columns of GFP vector (white columns).
The position of GFP-tagged positive control genes is shown by small white boxes. (c) 1,959 plasmids in 0.3% gelatin
were printed onto a glass slide to form an array with 9,888 features. The image is of an array scanned directly after
printing (Agilent microarray scanner). (d) An array cultured with HEK293T cells and scanned with a fluorescent imager
(GE Healthcare, Typhoon) to show lines of GFP-positive cells. (e) Arrays were subjected to a functional assay to detect
changes in the cell after over-expression of proteins. The image is of TUNEL positive cells; scale bar = 10 μm.
2. Materials
2.1. Preparation of
IRAT Working Plates
and Millipore 96-Well
Miniprep
1. IRAT stock plates: 1–21 and 36–45 (Geneservice,
Cambridge).
2. Flat-bottomed 96-well plate (Corning).
3. MultiScreen96 PLASMID plate kit (Millipore).
4. Plastic sealing plate (Elkay, Basingstoke, UK).
5. 2× TY medium: 16 g tryptone, 10 g yeast extract, 5 g
sodium chloride, H2O to 1 l. Adjust pH to 7.0. Autoclave.
Store at 25◦C.
6. Glycerol/ampicillin medium: 250 ml 100 μg/ml ampi-
cillin (50 mg/ml), 4 ml glycerol (8%), 496 ml 2× TY
medium. Use immediately.
7. 50 μg/ml Ampicillin medium: 500 μl 100 μg/ml
ampicillin, 1 l 2× TY medium (see Section 2.1). Use
immediately.

8. 1 M Glucose: 18 g glucose, 100 ml H2O. Filter (0.2 mm).
Store at 25◦C.
9. 10 M NaOH: 4 g NaOH, 100 ml H2O. Store at 25◦C.
10. 0.25 M Na2EDTA: 9.3 g Na2EDTA, 70 ml H2O. Adjust
to pH 8 with 10 M NaOH and add H2O to 100 ml. Store
at 25◦C.
11. 1 M Tris–HCl: 12.1 g Tris base, 80 ml H2O. Adjust to
pH 8 with HCl and add H2O to 100 ml. Store at 25◦C.
12. GTE: 30 ml 1 M glucose (30 mM), 120 ml 0.25 M
Na2EDTA (30 mM), 15 ml 1 M. Tris–HCl pH 8 (15 mM)
and 829 ml H2O. Store at 25◦C.
13. 10 mg/ml RNase: 10 mg RNase (Sigma), 10 ml H2O.
Aliquot 1 ml into tubes. Store at –20◦C.
14. GTE/RNase: (70 ml for four 96-well plates), 69.6 ml GTE
and 400 ml 10 mg/ml Rnase. Use immediately.
15. NaOH/SDS: (70 ml for four 96-well plates), 28 ml 0.5 M
NaOH (0.2 M), 3.5 ml 20%. SDS (1%) (Sigma), 35 ml
H2O. Use immediately.
16. 5 M KoAc: 98.1 g KoAc, 200 ml H2O. Store at 25◦C.
17. KoAc/acetic acid: (70 ml for four 96-well plates) 50.4 ml
KoAc, 9.8 ml glacial acetic acid, 9.8 ml H2O. Use
immediately.
2.2. PCR to Check
ORF Sizes from IRAT
Working Plate Clones
and Agarose Gel
Electrophoresis
1. P6: 5 ATTTAGGTGACACTATAG 3, T7: 5 TAATAC-
GACTCACTATAGGG 3.
2. Qiaquick PCR purification kit (Qiagen).
3. 10× TBE: 100 g Tris, 55 g boric acid, 9.3 g EDTA to 1 l
of H2O. Store at 25◦C.
4. 1× TBE: 10 ml 10× TBE, 90 ml H2O. Store at 25◦C.
5. Ethidium bromide (Sigma).
6. DNA Hyper ladder IV (Bioline, London, UK).
7. 6× Orange G loading buffer: 0.25 g Orange G, 30 g glyc-
erol, 1× TBE to 100 ml. Store at 25◦C.
2.3. DNA
Quantification
and Re-arraying IRAT
Plates
1. Picogreen dsDNA Quantitation Kit (Molecular probes).
2. Black flat-bottomed black plate (Corning).
3. 1× TE buffer: (for one 96-well plate) 6 ml 20× TE buffer,
54 ml H2O. Store at 25◦C.
4. 2 μg/ml Stock DNA: 2 μl 100 μg/ml DNA, 50 μl 1× TE
buffer. Store at 25◦C.
5. 2,000 ng/ml Standard curve DNA: 30 μl 2 μg/ml stock
DNA, 1,470 μl 1× TE buffer.

6. 200 ng/ml Standard curve DNA: 100 μl 2,000 ng/ml
stock DNA, 900 μl 1× TE buffer.
7. 20 ng/ml Standard curve DNA: 10 μl 2,000 ng/ml stock
DNA, 990 μl 1× TE buffer.
8. 2 ng/ml Standard curve DNA: 1 μl 2,000 ng/ml stock
DNA, 999 μl 1× TE buffer.
9. Internal control stock (ICS): 20 μl 50 μg/ml human fetal
liver genomic DNA (Biochain, Hayward, California, USA),
480 μl 1× TE buffer.
10. 400 ng/ml Internal control: 200 μl 2 μg/ml ICS, 800 μl
1× TE buffer.
11. 40 ng/ml Internal control: 20 μl 2 μg/ml ICS, 980 μl 1×
TE buffer.
12. Picogreen: (for one 96-well plate): 27.5 μl picogreen,
5,472.5 μl 1× TE buffer. Cover with silver foil, use
immediately. Store all standard curve and ICS solutions
at –20◦C.
13. Cytofluor 4,000 and Cytofluor software (Applied Biosys-
tems, Warrington, UK)
14. Cytocalc (Applied Biosystems).
15. Heated vacuum centrifuge (Eppendorf).
2.4. Control Plasmid
Preparation
1. pEGFP-C1 vector (Clontech).
2. Plasmid midi prep kit (Qiagen).
3. pENTR/D-TOPO kit (Invitrogen).
4. pcDNA-DEST47 vector (Invitrogen).
5. LR Clonase enzyme kit (Invitrogen).
6. Primers for control genes/clones:
CXADR F 5’ CACCATGGCGCTCCTGCTGTGC R 5’
TACTATAGACCCATCCTTGCT 3’
MARKL1 F 5’ CACCATGGCAGCTCTGCGCCAG R 5’
GAGCTCGAGGTCGTTGGA 3’
IL17BR F 5’ CACCATGTCGCTCGTGCTGCTA R 5’
CAAGGAGCAGCAGCCATC 3’
TNFRSF10B F 5’ CACCATGGAACAACGGGGACAG R 5’
GGACATGGCAGAGTCTGCA 3’
CDK9 F 5’ CACCATGGCGAAGCAGTACGAC R 5’
GAAGACGCGCTCAAACTCC 3’
TGIF F 5’ CACCATGAAAGGCAAGAAAGGT R 5’
AGCTGTAAGTTTTGCCTGAAG 3’
NFIB F 5’ CACCATGATGTATTCTCCCATC R 5’
GCCCAGGTACCAGGACTG 3’
M13 F 5’ GTAAAACGACGGCCAG 3’
T7 F 5’ TAATACGACTCACTATAGGG 3’

2.5. Cell Passage
and Freezing and
Thawing Cells
1. Culture medium: 50 ml FCS, 100 U/ml penicillin,
100 mg/ml streptomycin, 500 ml DMEM with 0.11 g/l
NA PYR with pyroxidine (Invitrogen). Store at 4◦C.
2. Freezing medium: 1.5 ml DMSO, 8.5 ml FCS. Mix and
place on ice for 10 min before use.
2.6. Printing
Cell-Based
Microarrays, Cell
Addition to the
Arrays and
Transfection
1. Polylysine slides (Sigma).
2. 0.3% Gelatin solution: 0.15 g gelatin, 50 ml H2O. Dis-
solve in a 60◦C water bath for 15 min, cool to 37◦C, filter
(0.45 mm). Store at 4◦C.
3. Biorobotics MicroGrid II Microarrayer (Biorobotics) with a
48-pin head (Quill pins 2,500; Biorobotics)
4. Effectene transfection reagent kit (Qiagen).
5. 10×10 cm square dish (Falcon).
6. DNA microarrayer scanner (Agilent Technologies).
7. Tiff splitter A5.1.1.1 (Agilent Technologies).
8. Image Analysis A.5.1.1 (Agilent Technologies).
2.7. Fluorescent
Assays, Cell
Visualisation and
Counting Positive
Cell Fluorescence
1. 1% and 3.8% paraformaldehyde: 38% paraformaldehyde
diluted with PBS (Sigma).
2. Apoptag Apoptosis Detection System kit protocol
(Flowgen).
3. Cleaved caspase-3 (Asp175) antibody with fluorescein con-
jugate (Cell Signalling Technology).
4. DAPI mounting medium (Vector).
5. Glass slide coverslip (Agilent).
6. Typhoon scanner (Amersham Biosciences).
7. Eclipse E800 microscope (Nikon) with a confocal attach-
ment (BioRad).
3. Methods
3.1. Preparation of
IRAT Working Plates
and Millipore 96-Well
Miniprep
1. IRAT stock plates stored at –70◦C were thawed. 250 μl
glycerol/ampicillin medium was added to each well of
fresh flat-bottomed 96-well plates, and 1 μl of the stock
plates was pipetted in. The plates were wrapped in cling
film, incubated at 37◦C overnight and stored at –20◦C. See
Note 1.
2. IRAT plates were purified in quadruplicate as the kit.
3. Briefly, fill four 2 ml deep well blocks per IRAT plate with
1 ml of 50 μg/ml ampicillin medium.

4. Pipette 10 μl of the working plate clone into the deep well
block and incubate for 26 h at 37◦C at 320 rpm.
5. Cover the blocks with a plastic sealing plate and centrifuge
for 5 min at 15,000×g.
6. Pour off the supernatant and turn the block over on tis-
sue for 5 min. Add 175 μl of GTE/RNAse and vortex the
block.
7. Add 175 μl NaOH/SDS and 175 ml of KoAc/acetic to
the deep well block and vortex.
8. Place the PLASMID MANUPSD50 plate into the bottom
of the vacuum manifold.
9. Remove 200 ml of lysate from the bottom of the deep
well block, leaving the cell debris behind and add to a HV
MAHVN4550 lysate clearing plate.
10. Place the HV plate on top of the vacuum manifold and
apply vacuum until all the solution has filtered through to
the PLASMID plate.
11. Discard the HV plate. Place a waste collection plate at the
bottom of the vacuum manifold in place of the PLASMID
plate and place the PLASMID plate on top of the vacuum
manifold. Apply vacuum until all the solution has filtered
through.
12. Add 200 ml of H2O to the PLASMID plate and apply vac-
uum until all the H2O has filtered through. Add 50 ml of
H2O and leave the PLASMID plate at room temperature
for 30 min.
13. Transfer the plasmid dissolved in H2O from the PLASMID
plate to a clean flat-bottomed 96-well plate, combine the
four plates containing purified plasmid for each IRAT plate
and store at –20◦C.
3.2. PCR to Check
ORF Sizes from IRAT
Working Plate Clones
and Agarose Gel
Electrophoresis
1. Add 2.5 μl 10× buffer, 0.75 μl 10 mM dNTPs, 0.5 μl
50 mM MgSO4, 0.3 μl Taq DNA polymerase, 0.75 μl
100 ng/μl SP6, 0.75 ml, 100 ng/μl T7, 2 μl Plasmid
DNA and 17.45 μl of H2O.
2. Set up a PCR reaction at 94◦C for 2 min, then 30 cycles of
94◦C for 1 min, 60◦C for 2 min 72◦C for 7 min and then
72◦C for 10 min. See Note 2.
3. PCR products were purified as described in the Qiaquick
PCR purification kit. The size of the PCR products was
confirmed with agarose gel electrophoresis.
4. 1 g of agarose was added to 100 ml 1× TBE, heated in the
microwave until clear and then cooled to 37◦C.
5. 25 μl of 2 μg/ml ethidium bromide per 100 ml was added,
mixed, poured into gel plates and left to set for 1 h.

6. Mix 1 μl of PCR product, 1 μl of 6× Orange G loading
buffer and 8 μl of water.
7. Mix 5 μl of DNA Hyper ladder IV, 1 μl of 6× Orange G
loading buffer and 4 μl of water.
8. Load samples onto the gel and elecrophorese for 1 h at 100
volts.
3.3. DNA
Quantification
and Re-arraying IRAT
Plates
1. Add 499 μl 1× TE buffer to a 96-deep-well block and add
1 μl of purified plasmid DNA to the 1× TE buffer and mix.
2. Add 50 μl 1× TE, 50 μl of the standard curve dilu-
tions, 50 μl of the internal control dilutions (duplicate) and
50 μl (single) of the diluted plasmid DNA to a 96-well flat-
bottomed black plate.
3. Add 50 μl of the picogreen dilution to the sample, standard
curve dilutions and internal control dilutions in the 96-well
flat-bottomed black plate, mix and incubate at room tem-
perature for 5 min.
4. The Cytofluor 4,000 and Cytofluor software were used to
measure the fluorescence. The manual mode, three reads per
well, excitation 485/20, excitation 530/25 and a gain of 70
were selected.
5. Data were analysed with Cytocalc. The blank 1× TE samples
were subtracted from the standard curve and samples and
graphs were drawn with a deviation of 1 to check that the
standard curve was a straight line and there were no outliers.
6. Cytocalc displays the sample concentrations in ng/ml; these
readings were divided by 1,000 as the samples were diluted
1,000 fold, i.e. ng/ml was changed to ng/μl.
7. Adjust the concentrations to the 200 ng/ml internal
control, e.g. if the 200 ng/ml control has a value of
135.5 ng/ml, then this is 67.8% of 200 ng/ml; therefore,
the plasmid-DNA readings are divided by 67.8 and multi-
plied by 100.
8. IRAT plasmids with concentrations over 2 μg were sorted
and plated into fresh 96-well flat-bottomed plates. The DNA
was dried via a heated vacuum centrifuge, H2O was added
back as follows and the plates stored at –20◦C. 2–4.9 μg
10 μl H2O, 5–9.9 μg 20 μl H2O, 10–14.9 μg 30 μl H2O,
15–19.9 μg 40 μl H2O, 20–24.9 μg 50 μl H2O, 25–
29.9 μg 60 μl H2O, 30–34.9 μg 70 μl H2O, 35–39.9 μg
80 μl H2O, 40 μg and over 90 μl H2O. See Note 3.
3.4. Control Plasmids Any fluorescent control plasmids can be used; control plasmids are
particularly crucial with this assay as the IRAT pCMV-SPORT6
expression vectors cannot be visualised. We used pEGFP-C1, a

C-terminal-tagged GFP with a promoter for expression. pEGFP-
C1 vector was transformed in DH5alpha cells following a stan-
dard protocol and a plasmid midi prep undertaken.
We also used CXADR 1, MARKL1 1, TGIF 1, CDK9 2,
NFIB 2, IL17BR 1 and TNFRSF10B genes in the C-terminal
GFP expression vector pcDNA-DEST47 (11). These were cloned
according to manufacturer’s instructions. Primer design is crucial
to the success of Gateway cloning and briefly the following pro-
cedure is undertaken.
1. Design the forward primers with a CACC overhang in
front of the ATG start site to facilitate insertion of the gene
into the entry vector pENTR/D-TOPO and keep 18 bp
after the start site.
2. Design the reverse primers with 18 bp before the stop
codon and remove the stop codon to ensure C-terminal
fusion expression of GFP.
3. Check the reverse to ensure that there is no CACC at
the 3 end; otherwise the correct orientation will not be
maintained.
4. Calculate the melting temperature (Tm) of the primers. A
matching Tm of 55–60◦C for the primer pairs is ideal, but if
the Tm is not within this range, it can be adjusted by adding
or removing bases where possible.
5. Check the primers for complementarity.
6. Prepare PCR reaction: 2.5 μl 10× amplification buffer,
0.75 ml 10 mM dNTPs 0.5 μl 50 mM MgSO4, 0.5 μl,
100 ng/ml (F/R primers), 0.3 μl Pfx polymerase 16.95 μl
H2O.
7. Undertake PCR at 94◦C 2 min, then 30 cycles of 94◦C for
1 min, 60◦C for 2 min, 72◦C for 7 min and 72◦C 10 min.
See Note 2.
8. Purify the PCR products using Qiaquick PCR purifica-
tion kit.
9. Confirm DNA concentrations and undertake agarose gel
electrophoresis as in Section 3.2.
10. Transfer PCR products into pENTR/D-TOPO vectors as
outlined in the kit.
11. Make a glycerol stock – add 850 μl of the overnight-LB
culture to 150 μl of glycerol, transfer to a 1.5-ml tube and
store at –70◦C.
12. PCR or sequence to confirm entry of PCR products into
pENTR/D-TOPO using the M13 forward primer and the
reverse ORF-specific primer. PCR: 2 μl 10× buffer, 0.5 μl
10 mM dNTP, 1 μl plasmid DNA, 0.2 μl Taq polymerase,
1 μl 100 ng/μl F and R primer and 14.3 μl H2O.

13. Undertake PCR at 94◦C for 15 min, 30 cycles of 94◦C for
1 min, 60◦C for 2 min, 72◦C for 7 min and then 72◦C
10 min.
14. Confirm PCR product sizes with agarose gel electrophore-
sis as given in Section 3.2.
15. The pENTR/d-topo and pcDNA-DEST47 vectors were
combined as the LR clonase enyzme kit (Invitrogen).
16. Undertake PCR to confirm that the genes have inserted
correctly as in Section 3.2, using the T7 forward primer
and the ORF-specific reverse primer.
17. Confirm PCR product sizes with agarose gel electrophore-
sis as in Section 3.2.
3.5. Cell Passage
and Freezing and
Thawing Cells
1. Grow and maintain human embryonic kidney (HEK293T)
cells in culture medium in a T75 flask at 37◦C and 5% CO2.
2. Once confluent, remove the culture medium and add 2 ml
of trypsin–EDTA, swirl over the surface of the cells and
remove.
3. Add 1 ml of trypsin–EDTA to the flask, tap to detach the
cells and leave for 2 min.
4. Add 9 ml of culture medium and mix the cells thoroughly
by pipetting up and down for 10 times and add 1 ml to two
fresh flasks containing 14 ml of culture medium.
5. After 20 passages, a fresh aliquot of cells was thawed out.
Freezing and thawing cells:
6. Follow steps 1–4, Section 3.5, but add to a 15-ml tube
and centrifuge at 13,000×g for 5 min.
7. Remove the supernatant, flick the pellet to mix and leave
on ice for 10–30 min.
8. Add 1 ml of freezing medium to the cells and transfer to a
freezing ampoule on ice.
9. Place the ampoules in a freezing container and leave at
–70◦C for 3 days, then store in liquid nitrogen until
required.
10. Defrost cells by hand and tip into 30 ml culture medium in
a T75 flask. See Note 4.
3.6. Printing
Cell-Based
Microarrays, Cell
Addition to the
Arrays and
Transfection
See Fig. 3.1 for array layout. Using the printing conditions below,
the spot size on the microarrys is 140 μm with a 30-μm gap
between each spot and a 170-μm gap between each sub-grid.
48 15×15 sub-grids can be printed. As IRAT plasmid clone
transfections cannot be visualised due to the lack of any tag
in the pCMV-SPORT6 vector, the array is designed with three
columns of pEGFP-C1 plasmid either side and in the middle of

each sub-grid to act as transfection controls. MARKL1, IL17BR,
CDK9, TNFRSF10B, NFIB, TGIF and CXADR in Gateway GFP
C-terminal destination vectors were also included on the array
as transfection controls because they had transfected well previ-
ously and showed distinct sub-cellular staining (11). A row in the
middle of each sub-grid was left empty and together with the
pEGFP-C1, aided orientation when observing the reverse trans-
fection array through a confocal microscope. After the controls
were taken into account, there was space for each IRAT plasmid
to be printed four times. We printed 1,959 plasmids and our array
had 9,888 features.
1. It is preferable to experiment with printing conditions using
Cy3 in 0.3% gelatin first. See Note 5.
2. 1 μg IRAT plasmids, pEGFP-C1 vector and CXADR,
MARKL1, IL17BR, TNFRSF10B, CDK9, TGIF and NFIB
in the pcDNA-DEST47 vector were made up to 30 μl
with 0.3% gelatin and transferred into 384-well plates. See
Note 6.
3. Print clones onto polylysine slides using a Biorobotics
MicroGrid II Microarrayer with a 48-pin head. Program the
microarrayer to print 16 single pre-spots, 12 spots with a 25-
ms dwell with two 7 s, 60◦C wash and dries between picking
up clones. It is preferable to print a large run, e.g. 100 arrays
over 5 days to prevent repeat thawing and freezing of the
re-array IRAT plates.
4. Determine if the DNA has printed correctly by scanning
arrays with Cy3 and Cy5 lasers on a DNA microarrayer scan-
ner, split the resultant.tif files using Tiff splitter A5.1.1.1
and view with the software program Image Analysis A.5.1.1.
Each spot was ∼140 μm in diameter. Arrays were stored
desiccated at 4◦C. See Note 7.
Cell addition:
5. Count Confluent HEK293T cells with a haemocytometer,
add 1×107 HEK293T cells to a T75 flask and make up to
15 ml with culture medium. Incubate at 37◦C, 5% CO2 for
24 h.
6. Before cell addition, vortex and incubate 16 μl enhancer and
150 μl EC buffer per slide at RT for 5 min.
7. Add 25 μl effectene and vortex. Pipette the transfection
reagent solution onto one end of the slide. Cut a plastic piece
of film; cut to the size of the slide and carefully place onto
the slide. Incubate at RT for 20 min. See Note 8.
8. Add 1×107 cells per array to a 50-ml tube, make up to 20 ml
with culture medium and invert to mix.
9. The arrays were placed in a square dish. Carefully pour the
HEK293T cells onto the array avoiding direct contact with

the printed areas and incubate the dish at 37◦C, 5% CO2
until the cells are confluent – about 40 h.
3.7. Fluorescent
Assays, Cell
Visualisation and
Counting Positive
Cell Fluorescence
We used two apoptotic assays, but any fluorescent assays can be
used on the arrays.
1. Fix the cells with 1% paraformaldehyde for 10 min for the
TUNEL assay or 3.8% paraformaldehyde for 20 min for the
CASP3 assay.
2. Follow the protocol for the TUNEL and CASP3 assays. See
Note 9.
Cell visualisation and counting positive cell fluorescence:
3. Apply a drop of mounting medium containing DAPI stain to
a glass slide coverslip and lower onto the cell-based microar-
ray. Primarily visualise fluorescence using a Typhoon scanner
(see Note 10) with a resolution of 50 μm to determine if
transfection has occurred.
4. This level of resolution is not high enough to analyse the
transfection events on the arrays; therefore, use an Eclipse
E800 microscope (Nikon) with a confocal attachment (Bio-
Rad). See Note 11 to analyse the arrays at ×10 magnifica-
tion. At this magnification, the GFP positive controls can be
used as a positional tool.
5. Positives were recorded as a quadruplicate clone patch with
one or more fluorescent cells. Each microarray was scored
twice and the genes were ranked in Excel according to the
number of positives. Slides were stored at 4◦C. See Note 12.
6. Positive genes from the assays were transfected in six-well
plates to check whether they were true positives.
3.8. Statistical
Analysis of
Transfection Assays
1. Calculate the distribution of probabilities based on constant
probability.
Divide the number of measurable array positions for each
plasmid by the probability distribution and calculate the
number of positives expected by chance and compare to the
actual number observed on the arrays.
2. Calculate the sensitivity of the arrays using the equation true
positive (TP)/(TP + false negative (FN)). Calculate the TP
as the number of positives in the six-well assay follow-up
experiments. Calculate FN as the number of known genes
on the array known to elicit the assay response but were not
found to be positive.
3. Use the equation TP/TP+false positive (FP) to calculate the
positive predictive value of the arrays. Calculate FP as the
number of genes found to be positive in half of more of

Other documents randomly have
different content

The Project Gutenberg eBook of Dissertatio
inauguralis physico-medica de respiratione

This ebook is for the use of anyone anywhere in the United States
and most other parts of the world at no cost and with almost no
restrictions whatsoever. You may copy it, give it away or re-use it
under the terms of the Project Gutenberg License included with this
ebook or online at www.gutenberg.org. If you are not located in the
United States, you will have to check the laws of the country where
you are located before using this eBook.
Title: Dissertatio inauguralis physico-medica de respiratione
Author: Daniel Bernoulli
Release date: January 3, 2013 [eBook #41763]
Most recently updated: October 23, 2024
Language: Latin
Credits: Produced by Mark C. Orton, Margo von Romberg and the
Online
Distributed Proofreading Team at http://www.pgdp.net
(This
book was produced from scanned images of public domain
material from the Google Print project.)
*** START OF THE PROJECT GUTENBERG EBOOK DISSERTATIO
INAUGURALIS PHYSICO-MEDICA DE RESPIRATIONE ***

Q. D. B. V.
DISSERTATIO INAUGURALIS
PHYSICO-MEDICA

DE
RESPIRATIONE,
Quam
CONSENSU AUCTORITATE
GRATIOSISSIMI MEDICORUM ORDINIS
In Universitate Patria
Pro Summis in Arte Medicâ
Honoribus Privilegiis Doctoralibus
ritè consequendis,
Ad diem 2. Septembr. M D CC XXI.
L. H. Q. S.
Publico Examini subjicit

JOH. FIL. BASIL.
Typis JOHANNIS LUDOVICI BRANDMÜLLERI.
VIRO
Experientissimo atque Excellentissimo

DANIELI NEBELIO,
Medicinæ Doctori, ejusdemque in Universitate
Heidelbergensi Professori famigeratissimo,
S. Elect. Palat. Medico Aulico meritissimo,
Suo Fautori in Re Medica Præceptori ad extremum vitæ
halitum devenerando,
Hasce Studiorum primitias ob varia in ipsius ædibus beneficia
insignis amoris testimonia accepta
sacras facit
AUCTOR.

PRÆFATIO.
uamquam timidè, fateor, hanc materiam de
Respiratione nodosam admodum difficilem
aggrediar, tamen illa, statim ac mentem subiit, arrisit,
geminâ se potissimum commendans prærogativâ;
prior harum est, quod non ita exhausta mihi nîl magis
quam compilatoris consuetudinem fugienti videretur,
quin nova addi possint, multaque insuper erronea ab
aliis tradita correctionem sui mereantur; altera, nec minus
ponderosa, est, quod materia hæc præ reliquis ita sit comparata, ut
fertilissimi pariter ac nobilissimi studii mathematici [quod semper
medico junxi, hoc sine illo nunquam subsistere posse ratus] usus
necessitas pro genuina ejus pertractatione ilico elucescat: quid
præstiterim, judicet B. Lector, quem proìn, ut tenues hasce pagellas
qualitercunque conscriptas attento animo perlegat, rogo.

CAPUT I.
§.1. Solent Dissertationem conscripturi multum esse soliciti
indefinitione, etymologia, aliisque hujusmodi generalioribus
præmittendis; his verò eò libentius supersedeo, quod nemini credam
latere, quid per Respirationem nulli non usitatam intellectum velim;
si verò quis multum hujusmodi præliminaribus delectetur, adeat
Auctores, quibus de Respiratione sermo est, ipsi protinus satisfiet;
reperiet etiam apud nonnullos organorum respirationi inservientium
descriptionem, quam theses has lecturo cognitam supponam.
Sepositis igitur omnibus ambagibus, ordo requirere videtur, ut statim
ostendamus modum, quo respiratio absolvitur; hæc verò duplici
agendi modo constat, nimirum inspiratione Quomodo fiat
inspiratio expiratione; Inspiramus aërem, quando elevatione costarum
descensu diaphragmatu cavitas pectoris ampliatur, atque sic aër
externus propter suum elaterem pulmones ingreditur eosdem
explicat; factâ hoc modo inspiratione musculi intercostales
expiratio? relaxantur, ac costæ descendunt, musculi abdominis simul
intestinorum interventu diaphragma sursum trudunt, unde aër ex
pulmonibus undiquaque compressis refluit, quem aëris è pulmonibus
egressum vocamus expirationem.
§.2. Innuimus quod cavitas pectoris elevatione costarum amplietur;
hanc costarum elevationem à musculis intercostalibus tam internis
quàm externis fieri censeo, nec credo, vel in vehementissima
inspiratione quicquam ad costarum elevationem conferre musculos
serratos majores basibus scapularum alligatos, uti quidam opinantur,
nam ductus fibrarum horum musculorum planè est parallelus cum
ipsis costis, adeò ut fibras illas potius ruptum iri, quàm costas
elevare necesse sit: quod autem elevatis costis pectus amplietur, id
nullo negotio ex primis Demonstratur elevatione costarum ampliari cavitatem

pectoris. Geometriæ elementis demonstrari potest; Constat costarum
figuram accedere ad ellipsin, hasque costas sibi invicem
superimpositas constituere quasi cylindrum ellipticum; sit ergo
(fig.1.) FA spina dorsi, BA EF axes imæ summæ costæ, cum
spinâ dorsi angulos BAM EFO acutos facientes; concipiatur BA
EF elevatis costis pervenisse in situm CA DF atque in prolongatas
FD FE agantur perpendiculares AQ AT; Erit totus cylindrus
formatus à costis non elevatis ad totum cylindrum formatum à costis
elevatis, ut illius altitudo TA ad hujus altitudinem QA; Est verò
angulus QTA major angulo TQA, ille enim est major recto, hic minor
recto, ergo QA major, quam TA; unde sequitur, cylindrum formatum
à costis elevatis esse majorem cylindro formato à costis non elevatis
Q. E. D.
§.3. Diximus etiam in thesi primâ, diaphragma in inspiratione
descendere; interim non omnes Auctores conveniunt, utrum
diaphragma in inspiratione ascendat an descendat? utrum motus
ejus sit activus in inspiratione an in expiratione? item an septum illud
transversum finitâ expiratione planum vel concavum vel
Quæstiuncularum quarundam solutio. convexum sit? Omnes hæ
quæstiones facile resolventur, si attendatur, quod ultimus semper
morientium actus sit expiratio; atqui, in demortuis diaphragma est
pulmones versus convexum, ergo diaphragma peracta quavis
expiratione pulmones versus convexum erit; 2⁰. Cùm usus
diaphragmatis sit motu suo cavitatem pectoris modò ampliorem
modò minorem reddere, cavitas pectoris ampliari debeat in
inspiratione, iterum patet, quod diaphragma descendat durante
inspiratione ascendatque tempore expirationis; 3⁰. in actione
musculorum diaphragmatis, septum hoc descendit, atqui idem
descendit in inspiratione, ergo motus diaphragmatis est activus in
inspiratione.
§.4. Affirmavimus porrò in §.1. aërem in pulmones irruere propter
suum elaterem; Non puto, quemquam adhuc fore, qui hunc aëris in

pulmones ingressum absonæ illi Veterum fugæ vacui attribuat;
interim miror dari, qui illum per circulum Schvvammerdamij
absurditate fugæ vacui minimè cedentem explicare adhucdum
conantur: Putabat nimirum Circulus Schwammerdamij
refutatur. Schvvammerdamius costas in inspiratione elevatas aërem
propellere, propulsum pariter sibi proximum protrudere, usque dum
ille, qui immediatè ante os nares existit, itidem propulsus in
pulmones irruat, postea in expiratione iterum egressurus: quod huic
Viro imposuit, fuit experimentum illud, quo vidit canem vasi aquâ
repleto im̃issum inspiratione sua aquam sursum propellere, eodem
verò expirante aquam ad pristinam suam altitudinem subsidere; hæc
observans conclusit, sicut aqua aquam, ita aër aërem propellit, sed
malè hanc deduxit conclusionem; anxius ergo ubi esset aërem à
pectore propulsum collocaturus, ipsum pulmones subire ait, exemplo
ab aquâ desumto: nonne autem maxima statim inter aërem
aquam differentia occurrit? ille ope antliæ pneumaticæ in decies
minus spatium condensari potest, hæc omni condensationi ad
sensum resistit; Nonne ergo universus aër terram ambiens in
decies minus spatium condensabilis, saltem tantillum in nostro casu
condensari poterit, ut spatium relinquat pauco illi aëri à pectore
elevato propulso? ad hoc sanè aliud responderi nihil potest, nisi quod
dicatur, aërem condensationi resistere, non verò impediri, quò minus
in pulmones irruat; hæc responsio totám quæstionem eò reducit,
utra resistentia major sit, an pulmonum aërem, quo minus in ipsos
ingrediatur, cohibentium, an athmosphæræ insensibili condensationi
resistentis; posterior hæc infinite quasi parva est, ipsa quippe
atmosphæra incomparabiliter major quam quantitas illa perexigua
quâ costæ elevatæ fuerunt: quis verò contendet, pulmonum
resistentiam esse quoque infinitè parvam? consideret modò
fricationem aëris per minimos asperæ arteriæ ramusculos
transeuntis, attendat ad fibrarum pulmonalium tenacitatem, qua
extensioni resistunt. Potest etiam falsitas circuli Schvvammerdamij
sic demonstrari; possumus nimirum obturatis naribus partem aëris
ex lagenâ magnâ ori admotâ com̃odè haurire, quod verò fieri non
deberet juxta hypothesin Schvvammerdamij, siquidem aër externus
nullam habet communicationem cum aëre lagenæ incluso, ad quæ

respondet Schvvammerdamius, à pectore propelli aërem subtilem,
qui latera lagenæ penetrando pulmones ingrediatur: sed quid
impedit aërem illum subtilem ne per ipsam cutim pleuram intret in
cavitatem inter pulmones pleuram contentam hocque modo
pulmonum extensioni resistat? Corruit ergo circulus ille, qui
quamquam debili fundamento nixus, multos tamen in sui
admirationem rapuit.
§.5. Asseruimus tandem in §.1⁰. costas relaxatis musculis
Argumentum, quod musculi intercostales interni producant
inspirationem. ercostalibus descendere; Hunc costarum descensum
non produci à musculis intercostalibus internis, ob multas rationes
mihi persuasum habeo, quas inter referri etiam posset, quod musculi
intercostales tam interni quam externi accipiant nervulos suos à
nervis intercostalibus, adeo ut spiritus animales eodem tempore ad
ambos musculorum ordines sint fluxuri: Nec gravitas causa costarum
descensûs esse potest, quia inverso corpore cruribus nempe in altum
erectis exspiratio succedit; Neque musculi abdominis nisi in
vehementi expiratione costas deorsum trahere possunt, quoniam
diaphragma potius sursum trudunt, quàm costas deorsum trahunt;
causam ergo, quod costæ in expiratione descendant, esse credo,
Causa costarum descensus in expiratione. constrictionem fibrarum cutis
pectus ambientium, quæ in præcedenti inspiratione extendebantur,
nec non restitutionem ipsius sterni, demonstrabo enim sub finem
hujus dissertationis, sternum in quâlibet inspiratione extrorsum
incurvari, quod proin cessante actione musculorum intercostalium
resiliet, non secus ac lamina elastica tensa.
§.6. Quæritur nunc, quomodo prima in infante recens Quomodo prima
in infante recens nato respiratio fiat? Explicatio hujus phænomeni, quæ
refutatur. nato inspiratio fiat: Mirum sanè est, quod Fœtus in utero
materno non respirans, subito respirare incipiat in lucem editus;
oportet, ut adsit causa quâ spiritus animales subito ad musculos
intercostales determinentur, hanc quidam deducebant ex doloribus,

quos sentiunt infantes durante partu, à quibus spiritus animales
adeo in motum excitentur, ut quaquaversum proin etiam ad
musculos intercostales fluant; Miror autem, fautores hujus sententiæ
non cogitâsse de partu cæsareo, quo infantes ex utero materno sine
ullis doloribus eximuntur: Melius itaque prima illa Inspiratio
explicatur dicendo, quod sit cavitas inter pleuram pulmones
Infantum, quæ vel nullum Explicatio illius genuina. vel valde rarum
aërem continet, unde aër externus nullam vel exiguam in
pulmonibus resistentiam offendens, in eosdem vi sui elaterij,
eousque irruet, donec aër inter pulmones pleuram sit naturalis
consistentiæ, vel, si nullus aër ibi existat, pulmones ad pleuram
usque se explicabunt; hæc quidam Auctores passim jam agnoverunt,
sed maxima superest difficultas, quomodo fiat, ut costæ eleventur,
nam hanc costarum elevationem producere nequit aër in pulmones
irruens, uti multi crediderunt, siquidem aër in pulmonibus prorsus sit
in æquilibrio cum aëre externo; ergo aliam substituam sententiam:
postquam pulmones aliquousque ut vidimus, explicati fuerunt,
sanguis ex dextro cordis ventriculo ad pulmones magno impetu
latus, nervos pulmonum, (quorum quidem magna pars, quod bene
notandum, ab intercostalibus oriuntur) repente antea inconsuete
modo afficit atque irritat, quibus irritatis in consensum trahuntur
nervi ad musculos intercostales diaphragma tendentes, per quos
adeò spiritus animales ad prædictos musculos determinantur, pectus
sine mora ampliaturos, quo ipso prima oritur infantum inspiratio.
Indagatio quantitatis aëris inspirati per experimentum. §.7. Si cui jam volupe
fuerit indagare quantitatem aëris inspirati, id multis modis assequi
potest; sequenti præ aliis experimento facillime scopum suum
obtinebit; sumat tubum aliquem recurvum debitæ amplitudinis
(fig.2.) AGMQPSRB cujus orificio AB altero PQ multo angustiori
indatur canaliculus EF, si quæ adsint interstitia inter orificium AB
canaliculum EF, eadem cerâ probe obturentur, tandem immittatur per
orificium PQ aqua usque ad altitudinem CDON, quo facto aërem
inspiratione haustum, obturatis naribus ore admoto orificio E
exspiret impellatque in cavitatem ABDC, finitâ dein expiratione

digitum admoveat orificio E; videbit tunc aquam in parte vasis ABRG
descendisse ad UT ascendisse verò ab altera parte ad XZ; erit autem
aër in spatio ABUT contentus naturali nonnihil densior, qui proin ut
ad ordinariam consistentiam redigatur, evacuanda est pars aquæ ex
crure PQMS donec se aqua hinc inde ad æqualem altitudinem WYHI
composuerit, indicabitque spatium CDYW quantitatem aëris una
inspiratione assumti; possumus autem prædicta evacuatione aquæ
ex Tubo PQMS supersedere, si fiat, ut se habet altitudo 33. pedum
(quantæ nimirum est cylindrus aquæ æquiponderans aëri
atmosphærico) ad altitudinem eandem auctam excessu altitudinis XZ
super TU ita spatium ABUT ad quartum quid, quod denotabit
spatium ABYW, à quo proin auferendo spat. ABDC remanebit spat.
quæsitum per calculum. CDYW. Licet etiam calculo invenire
quantitatem aëris inspirati quærendo excessum (fig.1.) cylindri FDCA
supra cylindrum FEBA, qui sunt in ratione QA ad TA vel quod idem
est in ratione demissarum ad FA perpendicularium DN ad EO, sit
ergo capacitas cylindri FEBA = , EO = , DN = , excessus cylindri
FDCA supra cylindr. FEBA = erit , unde habetur
. Hæc est quantitas, qua pectus ampliatur elevatione
costarum, verum augetur etiam descensu complanatione
diaphragmatis; ponatur itaque diaphragma præ se ferre speciem
coni elliptici excavati, cujus basis = altitudo = ; erit
quantitas, quâ augetur pectus per descensum diaphragmatis = ,
adeo ut tota quantitas aëris inspirati sit = .
Error Cel. Borelli monstratur in suo tr. de motu animalium commissus. §.8. Ex
hisce Cel. Borellus mot. animal. part. 2. cap. 7. prop. 81. indagare
voluit excessum ipsius (fig.1.) DN supra EO, qui excessus denotabit,
quantum sternum in qualibet inspiratione protrudatur; posuit
nimirum capacitatem cylindri FEBA = 3375. digit. cubic. quantitatem
aëris inspirati (quam experimento inveniri posse demonstravimus in
præcedenti §.) = 15. dig. cubic. atque EO = 15. dig. unde invenit
quantitatem, quâ pectus in inspiratione protruditur, = digiti, sed
geminum, quod pace tanti viri dixerim, commisit errorem; primo

enim neglexit quantitatem, quâ pectus augetur per complanationem
diaphragmatis ac tacite supponit pectus unicè elevatione costarum
ampliari. Deinde cylindros FDCA FEBA considerat tanquam corpora
similia inde deducit, DN esse ad EO in subtriplicata ratione
ipsorum cylindrorum; unde sponte sequitur, quod DN = dig. seu
DN-EO = dig. Sed hi duo cylindri non sunt similes. Ut vero
erroneæ huic methodo aliam veram substituere possimus, oportet
experiri, quantum amplietur pectus descensu diaphragmatis; quod
reperiemus, si in demortuis observemus, Ostenditur quomodo elevationis
sterni quantitas inveniri possit. quantum aquæ contineat cavitas
diaphragmatis; Ponamus quantitatem illam esse 8. digit. cubic. erit
quantitas, quâ augetur pectus per elevationem costarum, = 7. digit.
cubic. (retinebimus enim suppositiones Borelli) adeoque capacitas
cylindri FDCA = 3782. dig. cub. est autem cyl. FEBA (3375) ad cyl.
FDCA (3382) ut EO (15) ad DN, quæ erit dig. à qua auferendo
EO remanet quantitas quâ sternum elevatur = dig. seu circiter
dig. adeo ut non mirum, quod protrusio sterni in inspiratione sit
fere insensibilis, utpote quæ minor est trigesimâ secundâ parte unius
digiti, major tamen quam quæ à Borello inventa; interim negligendo
quantitatem, quâ pectus complanatione diaphragmatis augetur, id
quod Cel. Borellus fecit, invenitur elevatio sterni = dig. quæ
quantitas iterum multo major est illa, quam Cl. Borellus dedit.

CAPUT II.
§.1. Hisce pertractatis ordo postulat ut disquiramus quid de aëre
inspirato fiat statim ultroque se offert momentosa illa multum
jam agitata quæstio; an omnis aër inspiratus iterum exspiretur, an
vero pars quædam illius ad sanguinem transeat? posterioris cum sim
sententiæ dicam quid ad argumenta ab Adversariis proferri solita
responderi posse mihi videatur, subjuncturus Argument. quod nullus aër
ad sanguinem transeat, quod refutatur. dein rationes, quæ pro sententiâ
nostrâ militant: Objiciunt primò, nullas hucusque esse detectas vias,
per quas aër ad sanguinem transire possit; respondeo vias has ipsas
esse poros minimorum vasculorum pulmonalium; rem ita concipio:
pars aëris inspirati subtilissima pervenit ad ipsas pulmonis vesiculas
(seu potius receptacula non formata ab expansione extremitatum
asperæ arteriæ, sed ab aliis pulmonum membranis, vide elegantes
Helvetii observationes in pulmones humanos quæ extant dans les
memoires de l'Acad. Royal. des Sciençes de Paris, ann. 1718.) quæ
minimis vasculis sanguiferis cinguntur; subsequente dein expiratione
(quæ quidem multo citius absolvitur, quam inspiratio) aër ille non
omnis per angustum vesicularum orificium intra tam breve
expirationis momentum regredi potest, unde necessario pars ipsius
per poros vasculorum vesiculas ambientium propelletur; fateor
quidem hos poros esse admodum subtiles, sed aërem
subtilissimum tantum illos subire contendo, hinc est, quod quantitas
aëri expirati sit ad sensum æqualis aëri inspirato: videmus equidem,
quod aqua tepida canis viventis abdomini intra duplicaturam
peritonei per vulnus injecta resarcito vulnere tota sub vaporum
formâ vesicam per ejusdem poros subeat, ita ut à potiori aërem
aquâ subtiliorem vi expirationis impulsum poros vasculorum
pulmonalium haud difficulter pénetrare concludere possimus.

Alterum argumentum, quod refellitur? §.2. At vero, insistunt, sanguis per
eosdem poros transudans perpetuam nobis creabit hæmoptoën; Ego
respondeo, aërem esse subtiliorem, quam sanguis ille, adeo ut pori
quidem aërem illum subtilem, nec tamen sanguinem transmittant;
sed demus etiam aëris istius particulas non esse subtiliores particulis
sanguineis, poterit vel sola figura pororum efficere, ne sanguis per
ipsos transeat, sunt enim pori ampliores in superficie vasculi externâ,
quam in superficie internâ, adeò ut particula ingressura tanquam per
valvulam intro spectantem facile aperire queat latera pori, cum
eadem particula regressum tentans latera ejusdem pori
comprimendo sibi viam præcludat; Hanc certè ob causam sit, ut
vesica urinaria contineat liquores, qui per eandem inversam sensim
transudant.
Tertium argumentum refutatum. §.3. Objicitur porrò pulmonibus
cadaverum inflatis nullum aërem vascula sanguifera subire: regero
alios negare factum, contendentes è contrario aërem quam maximè
ad vascula illa penetrare; provocando ad experimentum eam in rem
à se institutum, quo aquam tepidam nigro colore tinctam tracheæ
injectam ad cordis ventriculum sinistrum penetrare ajunt; sed posito
etiam, nihil aëris ad sanguinem transire, id provenire potest ex eo,
quòd in demortuis fibræ sint constrictæ vasa statim post mortem
collabentia nullum admittant aërem; tandem etiam si attendatur ad
modum paragr. 1. cap. 2. traditum, quo aërem durante expiratione vi
quadam in vascula sanguifera propelli ostendi, patebit, vel ideo
nullum aërem in demortuis ad sanguinem transire, quoniam in illis
nulla adest expiratio summè necessaria ad aëris transitum per poros
vasculorum pulmonalium promovendum; Hæc sunt quamvis levia,
principalia tamen argumenta aëris cum sanguine mixtionem
negantium; supersunt fortè alia, haud dubiè non majoris momenti
quam præcedentia; sic v. gr. urgent, experimentum illud, quo
docetur minima quantitate aëris vasi sanguifero aperto inflatâ animal
enecari; Hîc excipio, magnam esse differentiam inter aërem
collectum in sanguine aërem æqualiter in eodem distributum; si
enim aër æqualiter per sanguinem dispersus animal necare posset,

nullum superesset vivum, siquidem omnium animalium sanguis aëre
imprægnatus existit; utpote qui in vacuo positus copiosas aëris
bullulas emittere cernitur. Videamus nunc annon majoris sint
momenti argumenta, quæ pro nostra stant sententia.
Argumentum 1. pro miscela aëris cum sanguine. §.4. Quicunque aëris cum
sanguine mixtionem negant, eò rediguntur, ut dicant respirationis
usum consistere in sanguinis attenuatione; sic Cel. Pitcarnius in suis
Elem. Med. Phys. Math. §.60. pag. 47. expressis verbis dicit, usum
respirationis consistere in sanguinis propulsu atque comminutione
tali, quæ requiritur, ut possit sanguis facilè subire pertransire vasa
pulmonalia Pitcarnio respondetur sic ad cor deferri; Huic ergo si
credimus, totus respirationis usus consistit in impediendâ sanguinis
stagnatione in pulmonibus; sed annoto hîc, quod dexter cordis
ventriculus propulsioni sanguinis per pulmones dicatus multo debilior
sit quam sinister; Quidni ergo Natura dextrum ventriculum æquè
fortem ac sinistrum formare potuisset, hoc quippe modo commodius
stagnationi sanguinis in pulmonibus occursura? Fateor respiratione
circulationem sanguinis per pulmones promoveri, sed hoc ipsum
Natura prævidens dextrum cordis ventriculum debiliorem fecit, ne
sanguis nimia celeritate per pulmones flueret, antequam aëre
sufficienter imprægnatus esset; Porrò, ut omni veritatis specie
opinionem hanc, si quæ ipsi supersit exuamus, lubet circulum quem
com̃ittunt ostendere, quærenti enim de usu respirationis respondent,
eâ sanguinis stagnationem in pulmonibus præcaveri, ast vicissim
sciscitanti de pulmonum usu nil aliud regerent, nisi illos esse
respirationis organum quod manifestum implicat circulum. Sed
dissentiunt alii à Pitcarnio in explicando sine attenuationis sanguinis,
quem Pitcarnius dicit esse, ut sanguinis transfluxus per pulmones
promoveatur, quod à vero abludere demonstravi; Illi verò alii dicere
sustinent, ideo attenuari sanguinem, ut deinceps per totum corpus
eò facilius fluere possit, horum utpote numero plurimorum
sententiam Monstratur sanguinem respiratione non attenuari. paulo
prolixius examinabo. 1. Dico sanguinem sufficienter attenuari in ipsis
arteriis figuram conicam habentibus, in quarum latera sanguis

magna vi cordis impulsus adeo infringitur, attenuatur atque
subdividitur ut facile minima vascula capillaria subire possit, adeo ut
sanguis non opus habeat aliâ attenuatione; 2. Videmus quod pisces
in aqua aëre suo privata ob defectum respirationis moriantur, interim
tamen aqua aëre destituta æque comminuere posset sanguinem
atque aqua aërem in se continens; 3. Nego aërem impetum facere in
pulmones, corpus enim impulsum in aliud corpus, quod impellenti
libere cedit, non facit impetum, haud secus ac arundines à flante
Borea agitatæ eludunt ejus violentiam, à qua robustissima quercus
dejicitur; Ita quoq; pulmones promtissime cedentes aëri irruenti
patet, nullum ab eo impetum in se recipere; constat porrò quòd vis
placidæ exspirationis (excipio violentam, quâ ingentes resistentiæ
superari possunt) tam parva sit, ut fortè illâ nec pondus duorum
granorum loco suo moveri posset; jam vero vis inspirationis circiter
decies minor est vi expirationis, siquidem expiratio multo citius
absolvitur quam inspiratio, unde tota vis, qua aër inspiratus in
pulmones impellitur, tam parva est, ut ea vix resistentiam quintæ
partis unius grani superare posset; jam quilibet judicet, an talis vis
apta sit, quæ sanguinem in pulmonibus comminuere possit; At hîc
respondent, hanc vim quamvis minimam toties tamen repetitam
posse quam maxime sanguinem attenuare; hæc vero vis non toties
repetitur ac forte sibi imaginantur; ponamus enim sanguinem in
pulmonibus contentum esse 18. unciarum, cor vero qualibet systole
propellere unciam unam sanguinis, item sex fieri pulsus unicâ interim
factâ respiratione, unde liquet sanguinem non nisi per tempus trium
respirationum in pulmonibus moram nectere; sed demus pulmones
non esse tam laxos agiles quin resistant aëri, adeoque omnem
inde impetum resilire in sanguinem, quod tamen experientiæ
adversatur; concedamus porro, vim inspirationis esse maximam,
quam tamen minimam esse reperimus, tum largiamur, si velint,
sanguinem per multas respirationes in pulmonibus commorari, quod
utique falsum esse ostendimus, his omnibus positis nondum video
aërem sanguinem esse attenuaturum, nam cum aër vascula
sanguifera undiquaque æqualiter comprimat, hæc compressio
condensabit potius sanguinem quam comminuet, non aliter ac
videmus nivem manibus undiquaque æqualiter compressam

condensari. Exulet ergo ab omnibus, qui rationem magis, quam
præjudicia sequi velint, inveterata illa opinio sanguinem ab aëre
comminui. Quamvis eam omnes, qui transitum aëris ad sanguinem
negant, amplectuntur licet rationi plane contrariam; non enim credo,
superesse qui putant sanguinem ab aëre refrigerari aut calefieri:
unde cum neutrum sit, restat ut dicamus aërem ad sanguinem
transire, ne quid à naturâ frustrà factum videatur.
Argumentum alterum pro mixtione aëris cum sanguine. §.5. Facit etiam pro
nobis sequens, quod à se factum mihi retulisse memini Virum Cel.
Experientiss. Nebelium Prof. Heidelb. experimentum; si laqueum
canis viventis collo circumjectum constringas ad imminentem usque
canis suffocationem, tum verò illum subito relaxes relaxatumque
teneas, usque dum canis semel inspiraverit, quo facto iterum
laqueum constringas ac hanc constrictionem relaxationem
alternatim repetas, donec tandem canis enecatus sit, quo facto
ejusdem aperti pulmones protinus inspiciens videbis vasa pulmonalia
aëre turgida, indicio iterum manifesto aërem ad sanguinem
Argument. 3. transire: Observatum præterea fuit, sanguinem in venis
pulmonalibus esse rutiliorem, spumosiorem fluidiorem, qui effectus
non nisi ab aëre, qui sese interea cum sanguine commiscuit,
provenire potuit, namque non ab impetu aëris, quem omnes hîc
allegant, hæ sanguinis mutationes oriri possunt, siquidem Argum.
4. supra demonstravimus impetum illum fere esse nullum. Haud
parum insuper nobis suffragatur experimentum Cel. Hombergii, qui
humum cubiculi oleo terebinthinæ interans atque in illo per
semihorulam commorans urinam suam odorem spirare sensit, odori
violarum prorsus similem haud dubie cum aëre inspirato ad
sanguinem in pulmonibus delatum, idem enim experimur, si oleum
terebinthinæ deglutimus. Experimentum autem omnium certissimum
erit, si vas illud vitreum (fig.2) jam supra descriptum iterum aqua
impleas ad altitudinem usque CDON admoto ore orificio E
obturatisque naribus aliquoties spiritum ducas reddasque alternatim,
postea alius quis bene observet altitudinem aquæ in Tubo ABRG;
quam si supra CDON observârit, invictum est pro transitu aëris ad

sanguinem argumentum; denotat enim minus aëris existere in parte
Tubi ABCD, quam ante institutum experimentum ipsi inerat, quod si
vero aquam nihil ascendisse deprehenderit, sane non ideo contra
nos faciet, siquidem paucus ille aër, quem ad sanguinem transire
contendimus, forsan non sensibilem mutationem altitudini aquæ
inducere valet; Interim si Tubus ABRG esset valde magnus atque
tantum tertia vel quarta ejus pars aquâ impleretur, ut multæ
inspirationes expirationes fieri possent, antequam aër spatio ABDC
inclusus ineptus evaderet ad vitæ sustentationem, (constat enim
animalia vasi clauso indita eundemque adeo aërem aliquandiu
respirantia enecari) denique si tubus PQMS esset gracilis, ut
mutatio aquæ situs eo sensibilior fieret, haberemus experimentum
quod tantum non demonstrativum solum hanc litem componere
valeret.

CAPUT III.
§.1. Demonstrato aërem cum sanguine permisceri, quæstio nunc
est, quid aër ille corpori utilitatis afferat; oportet sane, ut usus illius
sit summopere ad vitam conservandam necessarius, siquidem non
facilè reperimus animal, quod non suo modo respiret, organa
nostra respirationis ita sunt constituta, ut etiam repugnantes
respirare cogamur; Interim quam nobilis quamque necessarius est,
tam ignotus hactenus idem esse videtur; Nec ulla fere hucusque
lucem aspexit theoria Medica, quæ non particularem hâc in re tulerit
sententiam, quæque non omnium reliquorum sententiam optimo
utplurimum successu refutarit, indicio cujuslibet opinionem nemini
nisi Auctori suo satisfecisse, adeò unicuique sua placent! Meam
quoque afferam sententiam, omissâ aliarum refutatione, ob modo
dictam rationem parum necessariâ.
§.2. Quo vero eò melius tutius aëris usum investigemus,
prosequamur viam, quam aër sanguini in pulmonibus permistus
ulterius observat, videamus quid ubique de illo fiat. Aëris pars
subtilissima in minimas pulmonales venulas intrusa, in iisdem
sanguini intime miscetur; tria hanc miscelam aëris Aër sanguini intime
miscetur in vasculis pulmonalibus. cum sanguine promovent, 1.
vasculorum exilitas, 2. motus pectoris 3. motus ipsius sanguinis
tam intestinus quam progressivus, qui motus multum facit, ut aër
intimos globulorum sanguineorum poros subeat, exemplo ab aqua
desumto, quæ si ab omni aëre suo ope antliæ pneumaticæ prius
liberata, dein aëri exposita ex uno vase in alterum sæpius
transfundatur, tum denuo indatur recipienti, observabitur exantlato
inde aëre aquam rursus bullulas aëreas emittere, nec tamen aquam
statim post transfusionem majus occupare spatium, quam antea
occupaverat vel nunc iterum occupet aëre privata, unde colligo

aërem durante transfusione aquam subeùntem intimos ipsius poros
occupasse, nulla tamen facta ipsorum dilatatione: talis igitur sanguis
in intimis suis visceribus aërem fovens fertur ad sinistrum cordis
ventriculum, cujus validissima contractione miscela Condensatur in
sinistro cordis ventriculo. aëris cum sanguine non solum perficitur, sed
aër ille poris sanguinis incarceratus valide condensatur, adeo ut ejus
vis elastica multum augeatur; hinc in ultimas arteriolas magnâ vi
cordis propellitur, per quas cum difficulter transeant globuli
sanguinei, fit ut hi iterum valde comprimantur, ac proin aër in illis
contentus adhuc magis condensetur sanguinique involvatur.
Fertur cum sanguine ad fibras musculares. §.3. Sanguis aëre densissimo
refertus inter alias partes etiam fertur ad musculos præcipuè subit
fibras musculares, quas Borellus cylindrulos excavatos plurimis
nodulis, à fibrillis transversis ortis, distinctos observavit; intra hos
cylindrulos sanguis non subsultim per intervalla uti in arteriis, sed
lento, placido, continuo æquabili gradu procedit; adeo ut spiritus
animales per nervos (quorum semper aliquis ramulus in quamlibet
fibram muscularem hiat) in hos cylindrulos illapsi perpetuo
sanguinem offendant; particulæ igitur spirituum animalium instar
cunei seu pyramidis formatæ pro nutu animæ in cavum fibrarum
muscularium explosæ cuspidibus suis in poros globulorum
sanguineorum insinuatis diffringent ibidemque producit motum
musculorum. hosce globulos, quo facto aër incarceratus jam sui juris
factus impetum facit in latera fibrarum muscularium, quas proin
inflando, musculorum producit motum; primo autem facto impetu ob
subtilitatem suam statim avolat in auras, sicutì saccus ex rara
sindone factus inflatus primo quidem tumefit, sed statim denuo
concidit, hinc ut intumescentia musculi continuetur, necesse est, ut
semper novi spiritus novusq́ue sanguis suppeditentur, vid. mei
Parentis Diss. de Motu Muscul. ubi eodem modo motum musculorum
explicat, omissâ tamen solutione quæstionum, quæ extra institutum
Ipsius erant, unde aër ille veniat? quomodo cum sanguine
misceatur? quomodo novus semper suppeditetur? quomodo
condensetur? c.

§.4. Intelligis jam usum respirationis hactenus tam desideratum,
Usus respirationis. respiratio nempe suppeditat aërem subtilissimum,
qui sanguini intimè permistus, valide condensatus, ad fibras motrices
latus atque ope spirituum animalium sui juris factus, musculos
muscularesque membranas inflat, contrahit, movet, atque hinc
dependentem, circulationem humorum promovet, omnibusque
corporis partibus mobilibus motum impertit. Vides statim
necessitatem hujus usus, sine motu enim nullum animal ne per
tantillum quidem temporis vitam protrahere potest; quo ipso
respirationis necessitas tam facili negotio explicata haud parum
commendat opinionem nostram de respirationis usu, interim non
desunt alia insuper argumenta eandem confirmantia 1. quod valde
Qui multis rationibus probatur. probabile sit, musculos moveri mediante
aëre, quod aër hic commodissimè à respiratione deduci possit; 2.
quod ligatâ arteriâ ad musculum quendam tendente statim pereat
motus illius musculi, quod ipsum indicat sanguinis ad musculum
affluxum omnino necessarium esse ad eundem movendum; jam verò
non video, quomodo sanguis concurrat ad movendos musculos, nisi
mediante, quem secum vehit, aëre; 3. quod instinctu naturali fortius
frequentius respiremus saltantes, currentes similive alio vehementi
corporis motu nos defatigantes, quam facimus tranquilli blando
somno detenti; 4. quod animalia torpida lento gradu incedentia
minus respirent; quam animalia alacriora vivaciora; 5. haud parum
in rem nostram facit observatio illa quod sanguis venosus insultus
epilepticos passorum sit multò nigrior minus spumosus utpote
motibus epilepticis aëre exhaustus; 6. quod aër rarefactus
inspiratus insignem debilitatem nobis inducat, quod phænomenon
deinceps in 4⁰. cap. explicabo.
§.5. Interim non ignoro, me supponere aliquid, cujus existentia à
multis hodie in dubium vocatur, spiritus scilicet animales, quibus
mediantibus una cum sanguine aëre condensato referto, motum
musculorum absolvi innuimus. Argumenta Argumenta contra existentiam
spirituum animalium, horum præcipua hæc sunt; 1. Spiritus nequidem
oculo armato videri posse; 2. Nervos nimis esse compactos, quam ut

quicquam transmittere possint; 3. Quod nos entia præter
necessitatem multiplicemus, siquidem anima æque facile movere
possit nervos his mediantibus musculos ac movet spiritus, ad quæ
respondetur. cum utrumque sit ens corporeum: Ast levia certe
argumenta! priora duo nil aliud probant, quam exilitatem
subtilitatem spirituum, quam nemo negavit; tertium nimis probat,
nam eodem modo nervos ipsos musculos superfluos esse
ostenderem, siquidem anima pro nutu suo facere posset, ut v. gr.
brachium moveatur; sed concesso etiam, animam nervos movere
posse, ostendant mihi quomodo motus nervorum sive tremulus sive
crispatus sive quicunque alius musculos movere valeat, nisi
mediantibus spiritibus; dicant, quomodo fieri possit, ut nervuli laxi
possint producere motum musculorum, quorum quidam, si Borello
credimus, plusquam 100000. librarum resistentiam superant; Hoc si
mechanice explicare poterunt, victas Argumenta pro spiritibus
animalibus. dabo manus, at certè non poterunt; Spirituum existentiam
probant contra 1. cessatio motus post ligationẽ vel dissectionem
nervi; 2. Fabrica cerebri musculorum; 3. Symptomata vertiginem,
paralysin, apoplexiam comitantia; 4. necessitas affluxûs sanguinis
arteriosi pro musculis movendis; 5. Motus diaphragmatis in
animalibus recens enecatis post nervi phrenici contrectationem
versus diaphragma, quâ contrectatione non nervum sed fluidum
quoddam in illis contentum movemus, quod dein unà cum sanguine
mixtum diaphragmati motum impertit. 6. Continuatio motûs
frustulorum vermium dissectorum, Quomodo frusta vermium dissectorum
motum continuent? quæ optime derivari posse videtur à spiritibus
animalibus, qui sive proprio elatere, sive à materiâ subtili, sive à
radiis solaribus per nervos moti ipsa fragmenta insectorum movere
valent; hinc commode deducitur ratio, cur frusta illa vermium radiis
solaribus exposita diutius moveantur, quam in loco obscuro posita:
Stabilitis itaque spiritibus animalibus, non video quid amplius
desiderari possit, pro confirmatione sententiæ nostræ de usu
primario respirationis; usus autem respirationis secundarij jam diu
constant, quibus proin describendis non immoror.

CAPUT IV.
§.1. In hoc capite variorum phænomenorum, quæstionum atq;
problematum nostræ materiæ affinium partim ab aliis jam
propositorum, partim à me modo excogitatorum explicationem atque
solutionem exhibiturus ordiar à problemate Harvejano, Problematis
Harvejani solutio. quî scil. fiat ut fœtus secundinis exutus semel hausto
aëre ne per momentum quidem absque respiratione vivere possit?
quomodo fœtus secundinis exutus statim aërem haurire cogatur, jam
supra vidimus cap.5.§.6. hâc verò primâ inspiratione vascula
pulmonalia antea intorta extenduntur, adeo ut sanguis aliàs per
tubulum illum arteriosum inter arteriam pulmonalem aortam
descendentem situm atque arteriæ pulmonali obliquè insertum fluere
consuetus jam mutet cursum recto tramite per arterias pulmonales
feratur, unde tubus arteriosus à sanguine præterfluente humectatus
statim consolidatur; ramuli verò pulmonalis arteriæ intorti nullum
transmittunt sanguinem nisi inspiratione extendantur, hinc inhibitâ
inspiratione sanguis, cum nec per tubum arteriosum nec per vasa
pulmonalia transfluere queat, necessario sui stagnatione in
pulmonibus mortem inferet: sed quæstio magis ardua videtur, cur
post factam inspirationem cohibitâ Cur suppressâ exspiratione mors
subsequatur. expiratione mors quamvis non ita subita subsequatur?
Hæc quæstio eo magis ancipites tenuit solutionem sui aggressuros,
quod pulmonibus aëre repletis circulatio sanguinis non impediri
debere videatur; illud tamen non malè hoc modo explicari potest,
dicendo, quod musculi inspirationi dicati, cum alternatim agant, non
sint perpetuo post coërcitam expirationem in suâ actione
perseveraturi: quibus ergo relaxatis descendunt costæ, ascendit
diaphragma pulmonesque hac ratione valde compressi comprimunt
aërem contentum, hic premit vascula sanguifera, adeo ut nullum
transmittere queant cruorem, hinc iterum stagnatio sanguinis in
pulmonibus, quam presso pede ipsa subsequitur mors; Tali igitur

morte interemti non ideo moriuntur, quod sanguis ipsorum nullo aëre
imprægnatus musculis movendis sit impar, seu non moriuntur ob
usum aëris primariũ sublatum, nam procul dubio, si sanguis
circulationem suam per pulmones non obstante usu respirationis
intercepto continuare posset, homines absque respiratione per
plures horas vitam protrahere possent, tum demum morituri, quando
sanguis ipsorum Urinatores quomodo per integras horas sub aqua vivere
possint. aëre suo privatus musculos movere nequit. Hinc sine dubio
omne urinatorum artificium in eo consistit, ut vel aquâ submersi
sanguinis circulationem illæsam integram conservent, non quidem
per pulmones, sed per ipsas vias, quas sanguis in fœtu observat;
facile enim conceptu est foraminis ovalis ductûs arteriosi
coalescentiam tam levem esse, ut sanguis per pulmones fluere
nequiens, sicque impetum in foramen illud tubum arteriosum
faciens facilè per utraque victo obstaculo penetret: Hoc modo etiam
fœtus secundinis adhuc involutus extra uterú per plures horas vivere
poterit; Non dubito autem, quin urinatores aquam modo egressi per
universum corpus insignem debilitatem percipiant ob magnam aëris
jacturam; magnum tamen levamen sentiant, si celeri, magna
frequenti respiratione utantur, aërem consumtum hoc modo
resarturi.
§.2. Hæc omnia egregie conveniunt cum sententiâ nostrâ circa usum
respirationis; En hîc alia insuper quæstio à præmemorato Explicatio
phænomeni alicujus à Borello recensiti. Borello in suo eleganti tractatu de
Mot. animal. part.2. cap.6. prop.123. proposita, ubi refert quod in
vertice montis Ætnæ, ubi aër cum propter calorem tum propter
altitudinem montis valde rarus est, ex minimo motu etiam
robustissimi maximam lassitudinem consequuti fuerint, cujus vero
sublevationem persenserint quiescendo simulque frequenter
anhelando: hujus phænomeni explicatio ex superius allatis de usu
respirationis nullo negotio eruitur, quod idem tamen, quomodo ex
alia hypothesi deduci possit non video; vidimus supra motum
musculorum fieri mediante aëre ope spirituum ex sanguine
erumpente; sunt autem vires aëris, ut densitates, ergo si aër montis

Welcome to our website – the perfect destination for book lovers and
knowledge seekers. We believe that every book holds a new world,
offering opportunities for learning, discovery, and personal growth.
That’s why we are dedicated to bringing you a diverse collection of
books, ranging from classic literature and specialized publications to
self-development guides and children's books.
More than just a book-buying platform, we strive to be a bridge
connecting you with timeless cultural and intellectual values. With an
elegant, user-friendly interface and a smart search system, you can
quickly find the books that best suit your interests. Additionally,
our special promotions and home delivery services help you save time
and fully enjoy the joy of reading.
Join us on a journey of knowledge exploration, passion nurturing, and
personal growth every day!
ebookbell.com

Cellbased Microarrays Methods And Protocols 1st Edition Ella Palmer Auth

More Related Content

Similar to Cellbased Microarrays Methods And Protocols 1st Edition Ella Palmer Auth (20)

More from cierranoorei21 (7)

Recently uploaded (20)

Cellbased Microarrays Methods And Protocols 1st Edition Ella Palmer Auth