Chapter17 120120073228-phpapp02
Download as PPTX, PDF2 likes955 views
1) DNA is transcribed into messenger RNA (mRNA) which is then translated into proteins. 2) During transcription, RNA polymerase makes a complementary copy of the DNA strand into a single-stranded mRNA molecule. 3) Eukaryotic genes contain non-coding intron sequences that are removed from the pre-mRNA through splicing, yielding the mature mRNA for translation into protein.
Chapter17 120120073228-phpapp02
- 1. From Gene to Protein How Genes Work AP Biology 2007-2008
- 2. What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA proteins cells bodies AP Biology
- 3. The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein trait DNA gets all the glory, replication but proteins do all the work! AP Biology
- 4. Metabolism taught us about genes Inheritance of metabolic diseases suggested that genes coded for enzymes each disease (phenotype) is caused by non-functional gene product lack of an enzyme Am I just the sum of my proteins? Tay sachs PKU (phenylketonuria) albinism metabolic pathway disease disease disease disease A AP Biology enzyme 1 B enzyme 2 C enzyme 3 D enzyme 4 E
- 5. 1941 | 1958 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum "for their discovery that genes act by AP Biology regulating definite chemical events"
- 6. Beadle & Tatum X rays or ultraviolet light Wild-type Neurospora create mutations Minimal asexual spores Growth on medium complete medium positive control spores Select one of the spores Test on minimal Grow on medium to confirm complete medium presence of mutation negative control Minimal media supplemented only with… experimentals Pyridoxine Choline Nucleic Arginine Riboflavin Minimal amino acid p-Amino Inositol acid Folic Niacin control supplements benzoic acid AP Biology acid Thiamine
- 7. a a From gene to protein a a nucleus cytoplasm a a a a a a a transcription translation a a DNA mRNA protein a a a a a a a a a ribosome trait AP Biology
- 8. Transcription from DNA nucleic acid language to RNA nucleic acid language AP Biology 2007-2008
- 9. RNA ribose sugar N-bases uracil instead of thymine U : A C : G single stranded lots of RNAs mRNA, tRNA, rRNA, siRNA… transcription DNA AP Biology RNA
- 10. Transcription Making mRNA transcribed DNA strand = template strand untranscribed DNA strand = coding strand same sequence as RNA synthesis of complementary RNA strand transcription bubble enzyme coding strand RNA polymerase A G A G C A T C G T A A 3 A 5 G T C T C T T C A T C A G T DNA G T A 3 A C T G C A U C G U T G 5 C unwinding 3 G T A G C A rewinding mRNA RNA polymerase template strand AP Biology 5 build RNA 53
- 11. RNA polymerases 3 RNA polymerase enzymes RNA polymerase 1 only transcribes rRNA genes makes ribosomes RNA polymerase 2 transcribes genes into mRNA RNA polymerase 3 only transcribes tRNA genes each has a specific promoter sequence it recognizes AP Biology
- 12. Which gene is read? Promoter region binding site before beginning of gene TATA box binding site binding site for RNA polymerase & transcription factors Enhancer region binding site far upstream of gene turns transcription AP Biology on HIGH
- 13. Transcription Factors Initiation complex transcription factors bind to promoter region suite of proteins which bind to DNA hormones? turn on or off transcription trigger the binding of RNA polymerase to DNA AP Biology
- 14. Matching bases of DNA & RNA A Match RNA bases to DNA C U G bases on one of the DNA G A strands U G C U U C G A A C U A AG C U 5' RNA A 3' A C C polymerase G T G G T A C A G C T A G T C A T CG T A C CG T AP Biology
- 15. Eukaryotic genes have junk! Eukaryotic genes are not continuous exons = the real gene introns expressed / coding DNA come out! introns = the junk inbetween sequence intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence AP Biology
- 16. mRNA splicing Post-transcriptional processing eukaryotic mRNA needs work after transcription primary transcript = pre-mRNA mRNA splicing edit out introns make mature mRNA transcript intron = noncoding (inbetween) sequence ~10,000 base eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript ~1,000 base AP Biology mature mRNA spliced mRNA transcript
- 17. 1977 | 1993 Discovery of exons/introns Richard Roberts Philip Sharp adenovirus CSHL MIT common cold beta-thalassemia AP Biology
- 18. Splicing must be accurate No room for mistakes! a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U AP Biology Met|Arg|Val|Arg|STOP|
- 19. Whoa! I think we just broke RNA splicing enzymes a biological “rule”! snRNPs snRNPs small nuclear RNA snRNA proteins exon intron exon Spliceosome 5' 3' several snRNPs recognize splice spliceosome site sequence 5' 3' cut & paste gene lariat No, not smurfs! 5' 3' “snurps” exon exon mature mRNA excised AP Biology 5' 3' intron
- 20. Alternative splicing Alternative mRNAs produced from same gene when is an intron not an intron… different segments treated as exons Starting to get hard to define a gene! AP Biology
- 21. More post-transcriptional processing Need to protect mRNA on its trip from nucleus to cytoplasm enzymes in cytoplasm attack mRNA protect the ends of the molecule add 5 GTP cap add poly-A tail longer tail, mRNA lasts longer: produces more protein 3' A mRNA P P 5' G P AP Biology
- 22. a a From gene to protein a a nucleus cytoplasm a a a a a a a transcription translation a a DNA mRNA protein a a a a a a a a a ribosome trait AP Biology
- 23. Translation from nucleic acid language to amino acid language AP Biology 2007-2008
- 24. How does mRNA code for proteins? DNA TACGCACATTTACGTACGCGG 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? protein Met ArgVal AsnAla Cys Ala 20 How can you code for 20 amino acids AP Biology with only 4 nucleotide bases (A,U,G,C)?
- 25. mRNA codes for proteins in triplets DNA TACGCACATTTACGTACGCGG codon AUGCGUGUAAAUGCAUGCGCC mRNA ? protein AP Biology Met ArgVal AsnAla Cys Ala
- 26. 1960 | 1968 Cracking the code Nirenberg & Khorana Crick determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorana (17) determined mRNA–amino acid match added fabricated mRNA to test tube of ribosomes, tRNA & amino acids created artificial UUUUU… mRNA found that UUU coded for phenylalanine AP Biology
- 27. Marshall Nirenberg 1960 | 1968 Har Khorana AP Biology
- 28. The code Code for ALL life! strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? Start codon AUG methionine Stop codons AP Biology UGA, UAA, UAG
- 29. How are the codons matched to amino acids? 3 5 DNA TACGCACATTTACGTACGCGG 5 3 AUGCGUGUAAAUGCAUGCGCC mRNA 3 5 codon UAC tRNA GCA Met CAU anti-codon amino Arg acid Val AP Biology
- 30. a a From gene to protein a a nucleus cytoplasm a a a a a a a transcription translation a a DNA mRNA protein a a a a a a a a a ribosome trait AP Biology
- 31. Transfer RNA structure “Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end AP Biology
- 32. Loading tRNA Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA bond requires energy ATP AMP bond is unstable so it can release amino acid at ribosome easily Trp C=O Trp C=O Trp OH H2O OH O O activating enzyme tRNATrp AC C anticodon UGG mRNA tryptophan attached AP Biology to tRNATrp tRNATrp binds to UGG condon of mRNA
- 33. Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits large small E P A AP Biology
- 34. Ribosomes A site (aminoacyl-tRNA site) holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain Met E site (exit site) empty tRNA leaves ribosome 5' U A C A U G from exit site 3' E P A AP Biology
- 35. Building a polypeptide Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon 3 2 1 Leu Val release Ser factor Met Met Met Met Leu Leu Leu Ala Trp tRNA U AC UAC GAC U A C GA C AA U A C G A C AA U 5' C UGAA U 5' A U G C U GA A U 5' A U G C UG U 5' AU G C U G 3' mRNA A U G 3' 3' 3' A CC U GG U A A E P A 3' AP Biology
- 36. Destinations: Protein targeting secretion nucleus Signal peptide mitochondria chloroplasts address label cell membrane cytoplasm start of a secretory pathway etc… AP Biology
- 37. RNA polymerase DNA Can you tell amino acids the story? exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNA poly-A tail synthetase large ribosomal subunit 3' polypeptide 5' tRNA small ribosomal subunit E P A AP Biology ribosome
- 38. The Transcriptional unit (gene?) enhancer translation translation 1000+b start exons stop 20-30b 3' TAC transcriptional unit (gene) ACT 5' RNA TATA polymerase DNA DNA UTR UTR introns promoter transcription transcription start stop 5' 3' pre-mRNA 5' 3' AP Biology GTP mature mRNA AAAAAAAA
- 39. Bacterial chromosome Protein Transcription Synthesis in mRNA Prokaryotes Psssst… no nucleus! Cell membrane Cell wall AP Biology 2007-2008
- 40. Prokaryote vs. Eukaryote genes Prokaryotes Eukaryotes DNA in cytoplasm DNA in nucleus circular linear chromosome chromosomes naked DNA DNA wound on histone proteins no introns introns vs. exons introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence AP Biology
- 41. Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed AP Biology
- 42. Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein no RNA processing AP Biology
- 43. Mutations AP Biology 2007-2008
- 44. Mutations Point mutations single base change base-pair substitution silent mutation no amino acid change redundancy in code missense change amino acid nonsense change to stop codon When do mutations affect the next AP Biology generation?
- 45. Point mutation leads to Sickle cell anemia What kind of mutation? Missense! AP Biology
- 46. Sickle cell anemia Primarily Africans recessive inheritance pattern strikes 1 out of 400 African Americans hydrophilic hydrophobic AP Biology amino acid amino acid
- 47. Mutations Frameshift shift in the reading frame changes everything “downstream” insertions adding base(s) deletions losing base(s) Where would this mutation cause the most change: beginning or end of gene? AP Biology
- 48. Cystic fibrosis Primarily whites of European descent strikes 1 in 2500 births 1 in 25 whites is a carrier (Aa) normal allele codes for a membrane protein that transports Cl- across cell membrane defective or absent channels limit transport of Cl- (& H2O) across cell membrane thicker & stickier mucus coats around cells mucus build-up in the pancreas, lungs, digestive tract & causes bacterial infections without treatment children die before 5; with treatment can live past their late 20s AP Biology
- 49. Chloride channel transports chloride through Effect on Lungs protein channel out of cell normal lungs airway Osmotic effects: H2O follows Cl- Cl- Cl- channel H 2O cells lining lungs cystic fibrosis Cl- H 2O bacteria & mucus build up thickened mucus hard to secrete AP Biology mucus secreting glands
- 50. Deletion leads to Cystic fibrosis delta F508 loss of one amino acid AP Biology
- 51. What’s the value of mutations? AP Biology 2007-2008