Directed Enzyme Evolution Screening and Selection Methods 1st Edition Frances H. Arnold

Visit https://ebookultra.com to download the full version and
explore more ebooks
Directed Enzyme Evolution Screening and
Selection Methods 1st Edition Frances H. Arnold
_____ Click the link below to download _____
https://ebookultra.com/download/directed-enzyme-
evolution-screening-and-selection-methods-1st-edition-
frances-h-arnold/
Explore and download more ebooks at ebookultra.com

Here are some suggested products you might be interested in.
Click the link to download
Directed Evolution Library Creation Methods and Protocols
1st Edition Frances H. Arnold
https://ebookultra.com/download/directed-evolution-library-creation-
methods-and-protocols-1st-edition-frances-h-arnold/
Enzyme Assays High throughput Screening Genetic Selection
and Fingerprinting 1st Edition Jean-Louis Reymond (Editor)
https://ebookultra.com/download/enzyme-assays-high-throughput-
screening-genetic-selection-and-fingerprinting-1st-edition-jean-louis-
reymond-editor/
Enzyme Engineering Methods and Protocols 1st Edition Linda
Foit
https://ebookultra.com/download/enzyme-engineering-methods-and-
protocols-1st-edition-linda-foit/
Enzyme Technologies Metagenomics Evolution Biocatalysis
and Biosynthesis 1st Edition Wu-Kuang Yeh
https://ebookultra.com/download/enzyme-technologies-metagenomics-
evolution-biocatalysis-and-biosynthesis-1st-edition-wu-kuang-yeh/

Enzyme Kinetics Principles and Methods 2nd Edition Hans
Bisswanger
https://ebookultra.com/download/enzyme-kinetics-principles-and-
methods-2nd-edition-hans-bisswanger/
Enzyme Kinetics Principles and Methods 3rd Edition Hans
Bisswanger
https://ebookultra.com/download/enzyme-kinetics-principles-and-
methods-3rd-edition-hans-bisswanger/
Evolution Through Genetic Exchange 1st Edition Michael L.
Arnold
https://ebookultra.com/download/evolution-through-genetic-
exchange-1st-edition-michael-l-arnold/
Kinase Screening and Profiling Methods and Protocols 1st
Edition Hicham Zegzouti
https://ebookultra.com/download/kinase-screening-and-profiling-
methods-and-protocols-1st-edition-hicham-zegzouti/
Divine Action and Natural Selection Science Faith and
Evolution 1st Edition Joseph Seckbach
https://ebookultra.com/download/divine-action-and-natural-selection-
science-faith-and-evolution-1st-edition-joseph-seckbach/

Directed Enzyme Evolution Screening and Selection
Methods 1st Edition Frances H. Arnold Digital Instant
Download
Author(s): Frances H. Arnold, George Georgiou
ISBN(s): 9781588292865, 158829286X
Edition: 1
File Details: PDF, 4.91 MB
Year: 2003
Language: english

Methods in Molecular BiologyTM
Methods in Molecular BiologyTM
Edited by
Frances H. Arnold
George Georgiou
Directed Enzyme
Evolution
VOLUME 230
Screening and Selection
Methods
Edited by
Frances H. Arnold
George Georgiou
Directed Enzyme
Evolution
Screening and Selection
Methods

Genetic Complementation 3
3
From: Methods in Molecular Biology, vol. 230: Directed Enzyme Evolution: Screening and Selection Methods
Edited by: F. H. Arnold and G. Georgiou © Humana Press Inc., Totowa, NJ
1
Genetic Complementation Protocols
Jessica L. Sneeden and Lawrence A. Loeb
1. Introduction
Genetic selection provides a powerful tool for the study of cellular processes.
It is particularly useful in analyzing protein sequence constraints when used in
conjunction with directed molecular evolution. Our lab has used this approach
to analyze the function of enzymes involved in DNA metabolism, to study the
mutability of protein domains, and to generate mutant proteins possessing prop-
erties different from those selected by natural evolution (1–4). To illustrate the
concept, this chapter discusses genetic complementation of an E. coli strain
defective in expression of the small subunit of ribonucleotide reductase (NrdB).
Wild-type NrdB, in trans, is used to complement the hydroxyurea hypersensi-
tivity of the defective strain. Cloning of the wild-type gene, expression, and
complementation methods are discussed. The principles used for complemen-
tation with ribonucleotide reductase should be applicable to other enzymes for
which a complementation system can be established.
Genetic complementation in bacteria is a powerful method with which to
examine the biological function of a gene product. The concept is illustrated in
Fig. 1. Briefly, a bacterial strain lacking or deficient in gene A is compared to
a wild-type strain. Sometimes conditions can be found under which survival
rates are similar or indistinguishable (permissive conditions). However, under
conditions which restrict growth of strains failing to express gene A, only
strains expressing gene A (in cis or trans) continue to multiply at rates similar
to those under permissive conditions. This approach has been used for decades
in a variety of systems, to obtain useful genetic information about protein func-
tion, inactivating mutations, and protein-protein relationships. With the advent
of new molecular techniques and genome sequencing efforts, it is possible to
disable or inactivate a specific gene and complement the inactivating mutation
in trans, to obtain information about its physiological role.

4 Sneeden and Loeb
In addition to its use in obtaining information about wild-type gene func-
tion, it is also possible to use complementation systems to select for mutant
proteins with properties not selected in nature. One example is the conversion
of a DNA polymerase into an enzyme capable of polymerizing ribonucleotides
(1); another is the development of mutant enzymes highly resistant to antican-
cer agents that can be useful in the application of cancer gene therapy (2–4).
The key advantage of positive genetic selection is that one can grow cells
under restrictive conditions that select for only those gene products that com-
pensate for the deficiency. One can analyze large combinatorial libraries con-
sisting of as many as 107 mutant genes for their ability to display a desired
phenotype. The major limitation to the number of mutants that can be studied
is the transformation efficiency of E. coli (106–108). This is sharply contrasted
with screening methods, which rely on individual, not population, mutant
analysis. Even with the advent of automated screening technologies, the
throughput of this type of selection is much lower than that obtained by posi-
tive genetic selection. A critical feature of genetic selection is the window of
selection, or the phenotypic difference between the wild-type strain vs the strain
carrying the deficiency. When complementing the deficiency in trans, a differ-
ence of >103 is preferable, but a lower differential may be acceptable.
Prokaryotic selection systems offer a number of advantages over selection in
eukaryotes. Transformation efficiencies, hence the ability to screen larger num-
Fig 1. Schematic drawing of bacterial genetic complementation, where comple-
mentation is measured in a colony-forming assay.

bers of mutants, are much higher in prokaryotes; prokaryotic genomes are less
complex, yet it is frequently possible to complement deficiencies using mamma-
lian gene products; and the cell division times of prokaryotes are much shorter
than for eukaryotes. Nevertheless, we have screened large libraries using genetic
complementation of yeast (5), and it should be feasible to use mammalian cells
in culture for analysis of libraries containing 104–105 mutant genes.
This chapter will focus on the cloning and expression of Escherichia coli
NrdB to illustrate complementation methods. NrdB encodes the E. coli small
subunit of ribonucleotide reductase. It catalyzes the removal of the 2'-hydroxyl
of ribonucleoside diphosphates, generating deoxyribonucleoside diphosphate
precursors for use in DNA synthesis. This gene has been extensively studied
(6–9) and its sequence is known (10). NrdB is cloned from E. coli genomic
DNA, and placed into a suitable expression vector. It is then transformed into a
strain of E. coli, KK446 (7), which is deficient in NrdB; complementation is
measured by the ability of NrdB in trans to complement the hydroxyurea
hypersensitivity of KK446.
2. Materials
1. Plasmids TOPO-TA (Invitrogen) and pBR322.
2. E. coli genomic DNA, from strain carrying wild-type NrdB.
3. Primers flanking the gene of interest.
4. PCR components: Taq polymerase; dNTPs; Taq buffer, 1X concentration: 10 mM
Tris-HCl, pH 9.0 at 25°C, 50 mM KCl, 0.1% Triton X-100.
5. E. coli strain with appropriate gene defect, here KK446 (6) which encodes a wild-
type NrdB that is presumably defective in wild-type expression levels. Obtained from
E. coli Genetic Stock Center at Yale (see Website: http://cgsc.biology.yale.edu/).
6. Restriction enzymes and buffers.
7. Agarose gel electrophoresis equipment.
8. Luria-Bertani (LB) medium.
9. Hydroxyurea.
3. Methods
The methods described outline construction of the plasmid containing the
gene of interest (NrdB) and procedures to establish and test for complementa-
tion in E. coli.
3.1. Cloning of NrdB
The methods described in Subheading 3.1. outline the cloning and expres-
sion of NrdB, which can be generalized for use in cloning a variety of genes.
The methods include 1) the design of PCR primers and PCR amplification of
the gene, 2) cloning into Topo-TA vector, 3) verification by restriction map-
ping and sequence analysis, and 4) subcloning into pBR322 vector.

6 Sneeden and Loeb
3.1.1. PCR of NrdB
Since the sequence of NrdB is known, it is possible to design primers for
PCR amplification of the gene directly from E. coli genomic DNA (see Note 1).
Ideally, the primers should flank the gene directly upstream and downstream of
the coding sequence. Cloning vectors often contain a multiple cloning site
(MCS) that is located within the coding frame of LacZ, allowing for blue/
white screening. Therefore, design of primers should include a stop codon, fol-
lowed by a Shine-Dalgarno sequence for ribosomal entry approx 8 nucleotides
upstream of the initiator methionine (see Fig. 2). Because subcloning is often
necessary, it is useful to include in the primer unique restriction sites on both
ends of the gene, flanking the 5' stop codon and Shine-Dalgarno sequence
upstream of the coding region (Fig. 2A).
PCR is carried out by standard molecular techniques. Briefly, add 10–50 ng
E. coli genomic DNA, 10 mM Tris-HCl, pH 9.0 at 25°C, 50 mM KCl, 0.1%
Triton X-100, 250 µM (total) dNTP mix (dGTP, dCTP, dATP, dTTP), 1 mM
MgCl2, 20 pmoles each primer, and 2.5 U Taq DNA polymerase in a total
volume of 50 µL H2O (see Note 2). Amplification is for 30 cycles of PCR. The
length of the product should be determined by electrophoresis on an agarose
gel. Ideally the product should contain a single band of the desired length
(Fig. 2B) (see Note 3).
3.1.2. Cloning into TOPO-TA Vector (see Note 4)
After the desired product has been verified by agarose gel analysis, it is
cloned into the TOPO-TA vector. The TOPO vectors have been developed by
Invitrogen to contain covalently attached topoisomerases on each end of a lin-
earized vector (Fig. 2C). This obviates the need for ligation cloning and gives
a reasonably high insertion rate (Invitrogen).
1. Mix 5 µL of unpurified PCR product (see Note 5) with 1 µL TOPO vector and
1 µL of 1X salt buffer (provided by Invitrogen).
2. Incubate 5 min at room temperature.
3. Transform into XL-1 (or your favorite strain) using standard methods (11).
4. Plate onto LB agar containing appropriate antibiotic selection.
5. Select single colonies and grow overnight in LB medium.
6. Isolate plasmid DNA by standard methods (11).
7. Check for incorporation of product of desired length by restriction analysis (11).
8. Verify construct by sequence analysis (11).
At this step, it is desirable to verify expression of NrdB in the TOPO vector,
which is capable of expression under the lac promoter. However, expression of
NrdB in a high-copy vector is toxic, as may be other genes. In the case of
NrdB, it can be subcloned into a medium-copy vector (pBR322) to alleviate
this problem (see Note 6).

3.1.3. Subcloning into pBR322
Digest TOPO plasmid containing NrdB using restriction enzymes that cleave
at flanking EcoRI sites. Clone into pBR322 using standard molecular biologi-
cal methods (11).
Fig 2. Schematic representation of (A) primer design for PCR cloning of genes
from genomic DNA, (B) PCR product obtained added to Topo-TA vector, and (C)
Topo-TA vector with NrdB, after transformation.

8 Sneeden and Loeb
3.2. Expression and Complementation
3.2.1. Expression of NrdB
When verifying expression of a protein where an antibody is available,
Western blots are preferable (11). Since no commercial antibody is available
for E. coli NrdB, verification of expression can be confirmed via complemen-
tation of an E. coli strain that is deficient in NrdB expression and displays
hypersensitivity to hydroxyurea (see Note 7). A similar functional comple-
mentation may be required for verification of other genes.
3.2.2. Complementation
Complemenation of sensitivity of E. coli strain KK446 to hydroxyurea is
accomplished by expression of NrdB. This strain was described in 1976 by
Fuchs and Karlstrom and the defect mapped to 48 min, the region encoding
NrdB, the small subunit of ribonucleotide reductase (7). Hydroxyurea is a radi-
cal scavenger that removes the stable tyrosyl radical on the small subunit of
ribonculeotide reductase, inactivating the enzyme. The defect was not further
characterized, but was complemented by the authors with wild-type NrdB (7).
The ability of NrdB to complement hydroxyurea hypersensitivity of KK446
can be tested as follows:
1. Transform plasmids containing NrdB into KK446 cells via electroporation (10).
2. As a control, separately transform plasmid only into KK446 cells.
3. Isolate plasmids based on carbenicillin resistance, and verify the construct by
restriction digestion analysis.
4. Inoculate KK446 only, KK446 bearing plasmid only, KK446 bearing plasmid
encoding NrdB, and XL-1 blue cells (or other strain with wild-type NrdB expres-
sion) into LB medium and grow overnight at 37°C.
5. Dilute each culture 1:100 into fresh LB medium and grow to 0.6 OD.
6. Plate onto 0, 0.25, 0.5, and 1.0 mg/mL hydroxyurea-containing LB plates and
grow overnight at 37°C.
7. Count colonies and determine differences in sensitivity to hydroxyurea.
Complementation is scored as a function of the colony-forming efficiency
of plasmids with and without NrdB, as compared to KK446 without plasmid
and XL-1 blue cells without plasmid (see Note 8). It is often not possible to
obtain an isogenic strain which differs only by the one gene defect. Estimates
using different cell strains may be used in this case.
4. Notes
1. This protocol is limited to cloning of genes with known sequence. It is important
to note that often multiple sequences of a given gene exist in sequence databases
and they are not always identical. Check different submitted sequences against
each other, to avoid mistakes in primer design.

2. This procedure uses Taq DNA polymerase which creates an 3' overhanging
adenine. It is also feasible to use polymerases which do not possess this func-
tion, and then to blunt-end clone the PCR product into a vector. However, this
will decrease transformation efficiency.
3. NrdB is approx 1200 bp, which is relatively easy to PCR clone. For genes longer
than 2.5 kb, optimization of PCR may be necessary to obtain a single gene prod-
uct. It may also be necessary to gel purify the band of interest in the event that a
single band is not obtained.
4. This method uses the TOPO-TA expression vector from Invitrogen, although
other TA vectors exist.
5. Unpurified PCR product gives a higher transformation rate than purified product,
likely because of the favorable salt concentration in the PCR mix. If the desired
product has been gel purified, a higher transformation rate can be obtained by
adding the product to a 50 µL tube containing the standard PCR reaction mix.
6. Although NrdB has been extensively studied, it is not reported to be toxic at high
expression levels. It is important to remember when establishing a complementa-
tion system that stability of the construct must be verified. When working with a
potentially toxic gene, high expression levels should be avoided. In addition, the
lac promoter is widely used in common expression vectors, but is leaky and cannot
be fully suppressed. For our purposes, expression in a medium-copy vector under
the lac promoter was sufficient to alleviate toxicity. It may be necessary in some
cases to express in low-copy vector under a more tightly controllable promoter.
7. It is important to note that expression verified by complementation of a pheno-
type, even in a strain where the gene defect is known, while compelling evidence,
is not absolute proof of expression of an active protein. Western blots are pre-
ferred where an antibody is available.
8. A critical feature of complementation, especially when used to select for mutant
proteins, is the difference in phenotype between cells with and without the com-
plementing gene. In general at least 1000-fold difference is preferable, although
results may be obtained with somewhat smaller phenotypic differences.
References
1. Patel, P. H. and Loeb, L. A. (2000) Multiple amino acid substitutions allow DNA
polymerases to synthesize RNA. J. Biol. Chem. 275, 40,266–40,272.
2. Encell, L. P. and Loeb, L. A. (1999) Redesigning the substrate specificity of
human O(6)-alkylguanine-DNA alkyltransferase. Mutants with enhanced repair
O(4)-methylthymine. Biochemistry 38, 12,097–12,103.
3. Encell, L. P., Landis, D. M., and Loeb, L. A. (1999) Improving enzymes for can-
cer gene therapy. Nat. Biotechnol. 17, 143–147.
4. Landis D. M., Heindel C. C., and Loeb, L. A. (2001) Creation and characteriza-
tion of 5-fluorodeoxyuridine-resistant Arg50 loop mutants of human thymidylate
synthase. Cancer Res. 61, 666–672.
5. Glick, E., Vigna, K. L., and Loeb, L. A. (2001) Mutations in human DNA poly-
merase eta motif II alter bypass of DNA lesions. EMBO J. 20, 7303–7312.

10 Sneeden and Loeb
6. Reichard, P., Baldesten, A., and Rutberg, L. (1961) Formation of deoxycytidine
phosphates from cytidine phosphates in extracts from Escherichia coli. J. Biol.
Chem. 236, 1150–1157.
7. Fuchs, J. A. and Karlstrom, H. O. (1976) Mapping of nrdA and nrdB in Escheri-
chia coli K-12. J. Bacteriol. 128, 810–814.
8. Fontecave, M. (1998) Ribonucleotide Reductases and Radical Reactions. Cell.
Mol. Life Sci. 54, 684–695.
9. Jordan, A. and Reichard, P. (1998) Ribonucleotide Reductases. Annu. Rev.
Biochem. 67, 71–98.
10. Carlson, J., Fuchs, J. A., and Messing, J. (1984) Primary structure of the Escheri-
chia coli ribonucleoside diphosphate reductase operon. Proc. Natl. Acad. Sci. USA
81, 4294–4297.
11. Sambrook, J. and Russell, D. W. (2001) Molecular Cloning: A Laboratory
Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

DNA Polymerase Complementation in E. coli 11
11
2
Use of Pol I-Deficient E. coli for Functional
Complementation of DNA Polymerase
Manel Camps and Lawrence A. Loeb
1. Introduction
The E. coli JS200 strain carries a temperature-sensitive allele of DNA
polymerase I that renders this strain conditional lethal. Growth under restric-
tive conditions is restored by small amounts of DNA polymerase activity.
Even mutants with greatly reduced (1–10% of wild-type) catalytic activity or
distantly-related polymerases of bacterial, eukaryotic, or viral origin effec-
tively complement JS200 cells. The versatility of this complementation sys-
tem makes it advantageous for selection of active polymerase mutants, for
screening of polymerase inhibitors, or for screening of mutants with altered
properties. Here we describe complementation of JS200 cells with the wild-
type E. coli DNA polymerase I to illustrate such functional polymerase
complementation.
Polymerases catalyze the template-directed incorporation of nucleotides
or deoxynucleotides into a growing primer terminus. DNA polymerases and
reverse transcriptases share a common structure and mechanism of catalysis
in spite of low sequence conservation (1). As central players in replication,
repair, and recombination, DNA polymerases have been intensely studied
since the early days of molecular biology. Errors in nucleotide incorporation
have been recognized as significant sources of mutations, contributing to the
generation of genetic diversity, of which HIV reverse transcriptase is a dra-
matic example. Polymerase errors may also contribute to the genetic insta-
bility that characterizes certain disorders, such as cancer and trinucleotide
expansion diseases. Finally, polymerases are finding an ever-growing num-
ber of applications in sequencing, amplification, mutagenesis, and cDNA
library construction.

12 Camps and Loeb
E. coli DNA polymerase I is encoded by the polA gene. It has two relatively
independent functional units: a polymerase (with a 3'5' exonuclease proof-
reading domain), and a separate 5'3' exonuclease subunit. In vitro, the coor-
dinated action of these two subunits results in efficient nick translation. In vivo,
pol I is involved in lagging-strand synthesis during chromosomal replication
and in DNA excision repair. Pol I mediates the processing of Okazaki frag-
ments by extending from the 3' end of the RNA primer and by excising the
RNA primer from the 5' end of the downstream fragment. Removal of all resi-
dues of the RNA primer is essential for joining of Okazaki fragments (2). Simi-
larly, the coordinated action of polymerase and 5'3' exonuclease activities on
an RNA primer initiates ColE1 plasmid replication (3). On the DNA repair
front, pol I catalyzes fill-in reactions in base and nucleotide excision repair. In
the latter, pol I also contributes to releasing the oligonucleotide fragment and
UvrC protein from the postincision complex (4,5). Pol I expression is constitu-
tive, with an estimated 400 molecules/cell. It seems, however, that only a frac-
tion of these molecules are engaged in lagging strand synthesis catalysis under
normal circumstances, which would leave a substantial cellular complement
available for DNA excision repair.
Pol I is not essential for growth in minimal medium, although pol I-deleted
strains show slower growth rates. In rich medium, pol I is essential, presum-
ably because cells are unable to complete lagging-strand synthesis before the
next round of replication (6). Expression of either of the polymerase I subunits
restores growth in rich media (6), implying that other enzymes are able to sub-
stitute for pol I in lagging-strand synthesis. In agreement with pol I’s partial
redundancy in vivo, pol A shows epistasis with a number of genes involved in
DNA repair and recombination, including rnhA (7), polC (8,9), uvrD (10), recA
(11–13), and recB (11).
PolA12 encodes a misfolding form of pol I that is a defective in the coordi-
nation between the polymerase and 5'-exonuclease activities (14). PolA12 also
exhibits reduced temperature stability, and in vivo, its polymerase and 5'-exo-
nuclease activities decrease 4-fold at 42°C (14). In combination with recA- and
recB-inactivating mutations, polA12 is lethal in rich medium (11). Surprisingly,
RecA-mediated constitutive expression of the SOS response also renders
polA12 cell growth sensitive to high temperature (13). The polA12 recA718
temperature-sensitive strain (JS200 strain) probably falls into this category (9).
RecA718 is a sensitized allele of recA (15) that is likely activated as a result of
slow Okazaki fragment joining under conditions that are restrictive for polA12.
The combination of a 5'3' exonuclease- inactivating mutation and constitu-
tive SOS expression is viable under restrictive conditions (13), however, and
expression of polymerase activity alone (without 5'3' exonuclease) relieves
polA12 recA718 conditional lethality (9). These two observations point to poly-

merase as the rate-limiting activity in pol I-deficient, SOS-induced cell condi-
tional lethality. Complementing polymerase activity can be provided even by
distantly-related polymerases of bacterial, eukaryotic, or viral origin, although
polymerase overexpression may be required for complementation in some
cases (9,17). Examples of complementing polymerases include E. coli pol III
α subunit (9), Thermus aquaticus (Taq) polymerase (16), rat pol β (17), and
HIV and MLV reverse transcriptases (18). JS200 complementation by some of
these polymerases occurs even after partial inactivation by mutagenesis (19–
22) (the threshold being 10% of wild-type activity for Taq and pol I, based on
colony formation). With its great versatility, the polA12 recA718 complemen-
tation system in E. coli has been used for selection of active mutants of Thermus
aquaticus (Taq), and E. coli pol I (19,21,22), pol β (20), and HIV reverse tran-
scriptase (23). These mutants were further screened for altered properties. A
TrpE65 ochre mutation was used as a secondary screen for pol β mutators (24).
Finally, expression of low-fidelity pol I mutants in this system achieved in
vivo mutagenesis with some specificity for a ColE1 plasmid (25).
In the following chapter we present a protocol for functional complementa-
tion of polA12 recA718 cells by E. coli DNA polymerase I. This protocol can
be easily adapted for complementation by other DNA polymerases, for muta-
tor screening and for in vivo mutagenesis.
2. Materials
1. JS200 (recA718 polA12 (ts) uvrA155 trpE65 lon-11 sulA) competent cells see
Notes 1–3).
2. pHSG576 empty vector control (see Note 4) and pECpol I construct containing
the E. coli pol I gene (or another polymerase) under the tac promoter (see Note 5)
in water solution (from mini, midi, or maxiprep).
3. LB (Luria-Bertani) medium.
4. Tetracycline solution: 12.5 mg/mL stock in 50% ethanol, light-sensitive, keep
at –20°C.
5. Chloramphenicol solution: 30 mg/mL stock in 100% ethanol, keep at –20°C.
6. Isopropyl-β-D-1-thiogalactopyranoside (IPTG) solution: 100 mM stock in water,
sterile-filtered, keep at –20°C.
7. 15-mL plastic, 1.5-mL eppendorf tubes, and racks to hold them.
8. Biorad Gene pulser ™ electroporator and 0.2-cm electroporation cuvets.
9. Sterile toothpicks.
10. LB tetracycline (12 µg/mL) and LB tetracycline (12 µg/mL) chloramphenicol
(30 µg/mL) plates.
11. Petri dish turntable, 10 µL inoculation loop, and ethanol for flaming.
12. Bunsen burner.
13. 30 and 37°C incubators.
14. 30°C shakers.

14 Camps and Loeb
3. Methods
1. Combine 40 µL (5 × 109 cells) competent cells with 1 µL of pHSG576 or pECpolI
construct in electroporation cuvets.
2. Electroporate the cells (at 400 Ω, 2.20 V, and 2.5 µFD).
3. Resuspend in 1 mL LB (see Note 6) immediately after electroporation and trans-
fer to a 15-mL plastic tube.
4. Place in a shaker at 30°C for 1 h (see Note 7).
5. Plate a 1:0 and a 1:103 dilution of cells (to ensure single colony formation) on LB
tetracycline chloramphenicol plates (see Note 6).
6. Incubate at 30°C for 24 h (see Note 7).
7. Pick at least two single colonies from each electroporation into 5 mL LB with
tetracycline (12 µg/mL) and chloramphenicol (30 µg/mL) (see Note 8).
8. Grow overnight in a 30°C incubator (without shaking). The next morning vortex
briefly and shake at 30°C until the culture reaches mid-exponential phase (1– 2 h)
(see Note 7).
9. Test for temperature sensitivity in rich medium: Inoculate a spiral of increasing
dilution in two LB agar plates with tetracycline and chloramphenicol (see Note 8).
One of the plates needs to be pre-warmed at 37°C and the other plate pre-warmed
at 30°C (see Note 9). This is done placing the loop of the inoculation rod (~ 2 ×
106 cells) in the center of a plate and moving the loop toward the periphery as the
plate spins. Incubate 1 plate at 37°C (see Note 10) and the duplicate plate at 30°C
for 24–30 h (see Notes 11 and 12). Some growth in the center of the plate (where
there is a high cell density) is expected, but there should be no growth in low cell
density areas (see Fig. 1, Note 13).
4. Notes
1. JS200 cells were originally designated SC18-12 (9) and are tetracycline-resistant.
2. The uvrA155 genotype means JS200 cells are deficient in nucleotide excision
repair. This might contribute to the relative deficiency in polymerase (compared
to 5'3' exonuclease) activity in these cells, as 5'3' exonuclease activity has a
prominent role in nucleotide excision repair (26).
3. Competent cells can be prepared as follows: single JS200 colonies growing on
LB plates with appropriate antibiotic selection (in this case, 12.5 µg/mL tetracy-
cline) are picked into a flask containing 50 mL of LB plus antibiotic and grown at
30°C overnight without shaking (see Notes 6 and 7). The next morning, cells are
shaken for 1 h at 30°C. All 50 mL of bacterial culture are transferred to a flask
containing 450 mL LB with antibiotic, and left in the 30°C shaker for 3–4 h (to an
OD600 of 0.5–1). Cells are chilled on ice for 20 min, pelleted in a Sorval® RC 5B
plus centrifuge (10 min at 6000 rpm 4°C), and washed twice in 10% glycerol.
The last spin is performed in bottles with conical bottom for easy removal of the
supernatant in a Sorval® RC 3B centrifuge (10 min at 4000 rpm 4°C). The pellet
is resuspended in ~2 mL 10% glycerol, stored in 120 µL aliquots, and quick-
frozen in dry ice.

4. pHSG576 is a low-copy plasmid encoding chloramphenicol resistance (27). This
plasmid carries the pol I-independent pSC100 origin of replication (28). Provid-
ing the test polymerase in a pol I-independent vector is of relevance, as mainte-
nance of a ColE1 plasmid in JS200 cells under restrictive conditions would
compete for residual or redundant pol I activity and effectively increase the
threshold for functional complementation. On the other hand, increasing the
threshold for complementation might be desirable in some cases (for example to
minimize the likelihood of reversion [see Note 6]).
5. pECpol I construction: the entire open reading frame of the pol I gene (polA) of
E. coli DH5α was amplified with primers 5'-ATATATATAAGCTTATGGTT
CAGATCCCCCAAAATCCACTTATC-3' (initiating methionine in bold) and
5'-ATATATAATGAATTCTTAGTGCGCCTGATCCCAGTTTTCGCCACT
(stop codon in bold) and cloned into the HindIII EcoRI sites of the pHSG576
polylinker using HindIII EcoRI adapters (italics). This places the pol I gene
under transcriptional control of the tac promoter.
6. Nutrient Broth has been used instead in the work reported in the literature (17–
19,21). In our hands, growth in LB appears to be similar in the rates of loss of
temperature-sensitivity or in the strength of the conditional lethal phenotype.
7. Pol I-deficient strains in combination with alterations in RecA, RecB or UvrD
are easily overgrown by suppressors or revertants under non-permissive condi-
tions (10). This problem is less severe for polA12 recA718 double mutants (9),
but revertants/suppressors still occur at a detectable frequency (about 1 in 500
after overnight culture). To avoid overgrowth by these revertants, we maintain
conditions as permissible as possible, growing the cultures at 30°C, and keeping
the cell density to less than OD600 = 1. The temperature sensitivity of these cells
should be checked periodically (see step 9 in Subheading 3.). Most of the cells
that lose temperature sensitivity appear to be suppressors rather than simple
revertants and often exhibit a milder but not wild-type phenotype (Tsai, C.-H.,
personal communication and our own observations). In the polA12 uvrE502 back-
ground one apparent revertant was found to be an intragenic suppressor (10).
8. Overexpression of the polymerase can be induced at this point by adding 1 mM
IPTG to the medium. IPTG induction of transcription was required for comple-
mentation in the case of pol III α subunit and pol β (9,17).
9. Pre-warming of the plates is critical. The temperature-sensitive phenotype of
JS200 cells (see Fig. 1) and that of other polA12 recA, polA12 recB, or polA12
uvrD derivatives is only apparent in isolated cells. These cells lose viability
quickly (2–4 h) after switching to the restrictive temperature, at least in liquid
culture (11,13). In consequence, for tests or selections that depend on conditional
lethality it is essential that the plates achieve the restrictive temperature before
the JS200 cells plated on them reach the local cell density that allows survival.
10. Initially 42°C was chosen as the restrictive temperature for functional comple-
mentation in JS200 cells (9,17,20,29). We have since switched to 37°C
(16,19,22,23,25), as we still see strong conditional lethality at this temperature
(see ref. 18 for a comparison).

16 Camps and Loeb
11. In cases of partial functional complementation plates can be incubated for longer
periods of time, up to 48 h, to detect growth at 37°C (17–19).
12. The plates should be placed upside-down in the incubator to prevent excessive
evaporation from the agar.
13. Alternatively, the temperature-sensitivity assay can de done in a quantitative man-
ner by plating approx 103 cells (in duplicate or triplicate) instead of inoculating
them. Briefly, add 100 µL of a dilution containing 104 cells/mL to 4 LB agar plates
with tetracycline and chloramphenicol, 2 of them pre-warmed to 30°C, and the
other 2 pre-warmed to 37°C. Spin the plate on the turntable while evenly spreading
the bacterial dilution with a glass rod (previously flamed in ethanol). Place the
duplicate plates in the 30°C and 37°C incubators, and incubate for 24–30 h. No
more than 2 or 3 cells should grow at 37°C for every 1000 cells that grow at 30°C.
Acknowledgments
Support for this manuscript was from NIH (CA78885). We would like to
acknowledge the members of the Loeb lab for support and helpful discussions.
Special thanks to Drs. Premal Patel and Akeo Shinkai for generously sharing
their expertise in the system and to Ern Loh for sharing graphic material.
References
1. Patel, P. H. and Loeb, L. A. (2001) Getting a grip on how DNA polymerases
function. Nat. Struct. Biol. 8, 656–659.
Fig. 1. Spiral assay for temperature sensitivity. PolA12 rec718 cells were plated
and grown as described in Subheading 3., step 9. On the left, growth at 30°C, on the
right growth at 37°C (Modified from Ern Loh, unpublished).

2. Funnell, B. E., Baker, T. A., and Kornberg, A. (1986) Complete enzymatic repli-
cation of plasmids containing the origin of the Escherichia coli chromosome. J.
Biol. Chem. 261, 5616–5624.
3. Itoh, T. and Tomizawa, J. (1979) Initiation of replication of plasmid ColE1 DNA
by RNA polymerase, ribonuclease H, and DNA polymerase I. Cold Spring Harb.
Symp. Quant. Biol. 43, 409–417.
4. Husain, I., Van Houten, B., Thomas, D. C., Abdel-Monem, M., and Sancar, A.
(1985) Effect of DNA polymerase I and DNA helicase II on the turnover rate of
UvrABC excision nuclease. Proc. Natl. Acad. Sci. USA 82, 6774–6778.
5. Caron, P. R., Kushner, S. R., and Grossman, L. (1985) Involvement of helicase II
(uvrD gene product) and DNA polymerase I in excision mediated by the uvrABC
protein complex. Proc. Natl. Acad. Sci. USA 82, 4925–4929.
6. Joyce, C. M. and Grindley, N. D. (1984) Method for determining whether a gene
of Escherichia coli is essential: application to the polA gene. J. Bacteriol. 158,
636–643.
7. Cao, Y. and Kogoma, T. (1993) Requirement for the polymerization and 5'3'
exonuclease activities of DNA polymerase I in initiation of DNA replication at
oriK sites in the absence of RecA in Escherichia coli rnhA mutants. J. Bacteriol.
175, 7254–7259.
8. Banerjee, S., Kim, H. Y., and Iyer, V. N. (1996) Use of a DNA polymerase III
bypass mutant of Escherichia coli, pcbA1, to isolate potentially useful mutations
of a complex plasmid replicon. Plasmid 35, 58–61.
9. Witkin, E. M. and Roegner-Maniscalco, V. (1992) Overproduction of DnaE pro-
tein (alpha subunit of DNA polymerase III) restores viability in a conditionally
inviable Escherichia coli strain deficient in DNA polymerase I. J. Bacteriol. 174,
4166–4168.
10. Smirnov, G. B. and Saenko, A. S. (1974) Genetic analysis of a temperature-resis-
tant revertant of the conditional lethal Escherichia coli double mutant polA12
uvrE502. J. Bacteriol. 119, 1–8.
11. Monk, M. and Kinross, J. (1972) Conditional lethality of recA and recB deriva-
tives of a strain of Escherichia coli K-12 with a temperature-sensitive deoxyribo-
nucleic acid polymerase I. J. Bacteriol. 109, 971–978.
12. Gross, J. D., Grunstein, J., and Witkin, E. M. (1971) Inviability of recA-deriva-
tives of the DNA polymerase mutant of De Lucia and Cairns. J. Mol. Biol. 58,
631–634.
13. Fijalkowska, I., Jonczyk, P., and Ciesla, Z. (1989) Conditional lethality of the
recA441 and recA730 mutants of Escherichia coli deficient in DNA polymerase I.
Mutat. Res. 217, 117–122.
14. Uyemura, D. and Lehman, I. R. (1976) Biochemical characterization of mutant
forms of DNA polymerase I from Escherichia coli. I. The polA12 mutation. J.
Biol. Chem. 251, 4078–4084.
15. McCall, J. O., Witkin, E. M., Kogoma, T., and Roegner-Maniscalco, V. (1987)
Constitutive expression of the SOS response in recA718 mutants of Escherichia
coli requires amplification of RecA718 protein. J. Bacteriol. 169, 728–734.

18 Camps and Loeb
16. Patel, P. H. and Loeb, L. A. (2000) Multiple amino acid substitutions allow DNA
polymerases to synthesize RNA. J. Biol. Chem. 275, 40,266–40,272.
17. Sweasy, J. B. and Loeb, L. A. (1992) Mammalian DNA polymerase beta can sub-
stitute for DNA polymerase I during DNA replication in Escherichia coli. J. Biol.
Chem. 267, 1407–1410.
18. Kim, B. and Loeb, L. A. (1995) Human immunodeficiency virus reverse tran-
scriptase substitutes for DNA polymerase I in Escherichia coli. Proc. Natl. Acad.
Sci. USA 92, 684–688.
19. Suzuki, M., Baskin, D., Hood, L., and Loeb, L. A. (1996) Random mutagenesis of
Thermus aquaticus DNA polymerase I: concordance of immutable sites in vivo
with the crystal structure. Proc. Natl. Acad. Sci. USA 93, 9670–9675.
20. Sweasy, J. B. and Loeb, L. A. (1993) Detection and characterization of mamma-
lian DNA polymerase beta mutants by functional complementation in Escheri-
chia coli. Proc. Natl. Acad. Sci. USA 90, 4626–4630.
21. Patel, P. H. and Loeb, L. A. (2000) DNA polymerase active site is highly mutable:
evolutionary consequences. Proc. Natl. Acad. Sci. USA 97, 5095–5100.
22. Shinkai, A., Patel, P. H., and Loeb, L. A. (2001) The conserved active site motif A
of Escherichia coli DNA polymerase I is highly mutable. J. Biol. Chem. 276,
18,836–18,842.
23. Kim, B., Hathaway, T. R., and Loeb, L. A. (1996) Human immunodeficiency
virus reverse transcriptase. Functional mutants obtained by random mutagen-
esis coupled with genetic selection in Escherichia coli. J. Biol. Chem. 271,
4872–4878.
24. Washington, S. L., Yoon, M. S., Chagovetz, A. M., et al. (1997) A genetic system
to identify DNA polymerase beta mutator mutants. Proc. Natl. Acad. Sci. USA 94,
1321–1326.
25. Shinkai, A. and Loeb, L. A. (2001) In vivo mutagenesis by Escherichia coli DNA
polymerase I. Ile(709) in motif A functions in base selection. J. Biol. Chem. 276,
46,759–46,764.
26. Cooper, P. (1977) Excision-repair in mutants of Escherichia coli deficient in DNA
polymerase I and/or its associated 5' leads to 3' exonuclease. Mol. Gen. Genet.
150, 1–12.
27. Takeshita, S., Sato, M., Toba, M., Masahashi, W., and Hashimoto-Gotoh, T.
(1987) High-copy-number and low-copy-number plasmid vectors for lacZ alpha-
complementation and chloramphenicol- or kanamycin-resistance selection. Gene
61, 63–74.
28. Cabello, F., Timmis, K., and Cohen, S. N. (1976) Replication control in a com-
posite plasmid constructed by in vitro linkage of two distinct replicons. Nature
259, 285–290.
29. Sweasy, J. B., Chen, M., and Loeb, L. A. (1995) DNA polymerase beta can sub-
stitute for DNA polymerase I in the initiation of plasmid DNA replication. J.
Bacteriol. 177, 2923–2925.

Complementation of Eukaryotic DNA Polymerase 19
19
3
Selection of Novel Eukaryotic
DNA Polymerases by Mutagenesis
and Genetic Complementation of Yeast
Ranga N. Venkatesan and Lawrence A. Loeb
1. Introduction
DNA-directed DNA polymerases have been broadly classified into seven
families based on their sequence homology (1). It is surprising to learn that
enzymes such as DNA polymerases, which carry out pivotal role during DNA
replication, repair, and recombination, are poorly conserved amongst different
families, but within a given family, all the members are highly conserved.
These observations have profound implications and suggest that DNA poly-
merases have been plastic during evolution, but can tolerate multiple muta-
tions (2). The mutability of DNA polymerases has been utilized extensively
in our studies and has shed light on structure-function relationships of each
domain. Any single amino acid residue or the entire domain can be randomly
mutagenized and the active mutants can be selected by genetic complementa-
tion. Here we describe the complementation of Saccharomyces cerevisiae Pol3
(Pol δ) by utilizing a common technique in yeast genetics known as “plasmid
shuffling,” where the wild-type copy of the Pol3 present in a Ura3 selective
marker plasmid is exchanged or genetically complemented for in vitro mutated
version(s) of Pol3 in the domain-of-interest. Since Pol3p is essential for viabil-
ity of yeast, only those mutants that genetically complement the loss of wild-
type Pol3p survive.
2. Materials
1. pYcplac 111 and pYcplac 33 (ATCC, Manassas, VA).
2. Saccharomyces cerevisiae genomic DNA (Invitrogen, Carlsbad, CA).
3. E. coli strains DH5α and XL1-blue (Invitrogen and Stratagene, La Jolla, CA).

20 Venkatesan and Loeb
4. Yeast strains (ATCC) (see Note 1).
5. Standard microbiological culture media (E. coli): Luria Bertani.
6. Standard microbiological culture media (S. cerevisiae): YPD.
7. S. cerevisiae selection medium: SC-amino acid drop out mixture.
8. Oligonucleotide primers.
9. Thermocycler.
10. Quik-change PCR mutagenesis kit (Stratagene).
11. Restriction enzymes, T4 DNA ligase.
12. Agarose gel electrophoresis apparatus.
13. DNA sequencing apparatus or available core facility.
14. Qiagen gel and plasmid purification kit (Qiagen, Valencia, CA).
13. Carbenicillin (Sigma, St. Louis, MO).
14. Canavanine (Sigma).
15. 5-Fluoro-orotic acid (5-FOA) (Qbiogene, Carlsbad, CA).
16. G418 (Invitrogen).
17. Frozen-EZ yeast transformation II kit (Zymo Research, Orange, CA).
3. Methods
The methodology presented here is applicable to the “essential” replicative
DNA polymerase α, δ, and ε, whose complete loss of function is lethal to the
viability of haploid yeast (see Note 2). Theoretically this methodology can
also be utilized to study “non-essential” DNA polymerases, if mutant allele of
the enzyme exhibits a selectable phenotype, for example, enhanced sensitivity
to UV radiation or temperature sensitivity to growth that can be rescued by
genetic complementation (3,4). Here we describe genetic complementation of
the DNA polymerase δ “knock out” strain with any (Pol3p) library of interest.
3.1. Amplification of Yeast Pol3 Targeting Module
Standard recombinant DNA techniques were followed throughout this chap-
ter (5). One of the most important parameters in this protocol is the choice of
appropriate haploid yeast strain. Technically any wild-type yeast strain can be
used and the minimum prerequisites are sensitivity to canavanine and auxotro-
phy for Leu2, Ura3, and/or Trp1, His3, Lys2 markers. We used YGL27-3D
(MATa, leu2 his3 trp1 lys2 ura3 CAN1, pol3::KanMX) engineered by Simon
and co workers (6) and Singh and co workers (7). The chromosomal copy of
the Pol3 was replaced with KanMX cassette that provided resistance to the
antibiotic G418 and the lethality was rescued by presence of wild-type Pol3 on
an episomal plasmid with the Ura3 selective marker (8,9).
3.1.1. Generation of Designer Polymerase “Knock Out” Strain
1. Transform the haploid yeast strain with the wild-type copy of the DNA poly-
merase gene-of-interest cloned into Ycplac33 vector that has Ura3 selection
marker (see Notes 3–7 for information on molecular cloning, purification and

propagation of the Ycplac 33 vectors). Select for the transformants on SC-Ura
plates by incubation at 30°C for 2–4 d (see Note 8). For routine yeast transforma-
tion, use the Frozen-EZ II kit (see Note 9).
2. Entire ORF of any yeast gene can be easily deleted by utilizing PCR-based gene-
disruption method (8). To delete the chromosomal copy of any DNA polymerase
gene-of-interest, design chimeric primers in following manner. For the forward and
reverse primers fuse 50 bases flanking the start and stop codon upstream of 20 bases
which anneals to the KanMX cassette. The Pol3 primers are shown as an example,
KanMX annealing sequence is in bold, start and stop codon are in bold italics.
Forward primer:
5'CTTGCTATTAAGCATTAATCTTTATACATATACGCACAGCA
ATGAGTGAACTGTTTAGCTTGCCTCGTCC 3'
Reverse primer:
5' GCCTTTCTTAATCCTAATATGATGTGCCACCCTATCGTTTTTTAC
CATTTGAATCGACAGCAGTATAGCG 3'
3. Amplify the KanMX cassette in the plasmid pFA6KanMX4 (obtained from Dr.
Philippsen, ref. 8) using the above primers. Start with the following conditions
before optimizing for the specific primers. Combine 10 ng of template, 200 µM
of dNTPs, 20–50 pmoles of primers, 2–3 mM MgCl2, 5 units of Taq DNA poly-
merase, 1X PCR buffer and sterile ddH2O to 50 µL total volume, and amplify
using the following conditions: initial denaturation at 94°C for 1 min, 94°C for
30 s, 60°C for 30 s, 72°C for 1.5 min, 30 cycles, final extension at 72°C for 7
min. Set up a negative control PCR reaction by including all the components
except the DNA template (see Note 10).
4. Resolve 10 µL of the PCR reactions on a 1% agarose gel to assess yield. Success-
ful amplification results in a sharp band that migrates at 1.5 kb as delineated by
size markers in adjacent lanes. Set up 5–15 PCR reactions (depending on your
yield), resolve the reactions on a quantitative 1% agarose gel, photo-document
the gel and excise the 1.5 kb band from the gel using a new razor blade. Trim as
much excess agarose from gel band as possible. Chop the excised agarose bands
into 5–6 mm sized pieces and transfer them into a 15-mL centrifuge tube. Gene-
targeting experiments require at least 1–2 µg of DNA (from a preferably high
concentration stock) and the PCR reactions can be scaled accordingly.
5. Purify the DNA using Qiagen gel extraction kit (see Note 6). Quantitate the DNA
yield using UV absorption spectrophotometer.
6. Transform the yeast strain from step 1 (Ura3 selected) with 1–2 µg of the PCR
product by scaling up the reaction 2–4-fold according to the Frozen-EZ II trans-
formation kit. The gene-targeted integrands can be selected by either of two ways:
a. After incubation of the yeast at 30°C (step 4 in the kit instructions), pellet
the yeast, suspend them in 5 mL of YPD and culture for 4 h (two genera-
tions) at 30°C. Re-pellet yeast cells, suspend them in 0.5 mL of sterile water
and plate them in 3–5 YPD+G418 plates (G418 200 µg/mL). Incubate at

30°C for 2–4 d, reconfirm G418 resistance by streaking 10–20 colonies on a
new YPD+G418 plate.
b. Alternatively after step 4, plate all the cells on 5–7 YPD plates, incubate at
30°C for 24 h and replica plate onto YPD+G418 plates. Incubate for 2–4 d at
30°C. Reconfirm G418 resistance as above.
7. Inoculate 4–6 independent colonies into 5 mL YPD+G418 medium (200 µg/mL)
and a single colony from wild-type strain into 5 mL YPD. Culture them over-
night at 30°C by shaking at 250 rpm. Isolate genomic DNA using standard yeast
molecular biology procedures.
8. Obtain the restriction map of ± 1 kb genomic DNA sequence flanking the gene-
of- interest at http://genome-www.stanford.edu/Saccharomyces. Compare the
restriction maps of the genomic DNA and the KanMX cassette and confirm the
locus specific integration by Southern blot analysis and PCR.
3.2. Genetic Complementation of the “Designer Strain”
with Library Allele of Interest
1. Transform the yeast strain generated according to Subheading 3.1.1. with the
mutant library allele, positive and a negative control plasmid (see Notes 11–13
for information on site-directed mutagenesis, if the Strategene’s Quik-Change
kit is used for library construction). Use the Frozen EZ II transformation kit.
Plate cells on SC-Leu, incubate at 30°C for 2–4 d.
2. Using a sharpie and a ruler, divide SC-Leu+5-FOA plate (5-FOA 1 g/L) into
eight sectors, streak 4–8 colonies from the SC-Leu plate and incubate at 30°C for
2–6 d (see Notes 14 and 15). Using a sterile tooth pick, re-streak a small patch of
5-FOA-resistant colonies from at least three different sectors of each mutant on
to a new SC-Leu+5-FOA plate and inoculate 5 mL SC-Leu media with the same
toothpick and culture for 1–2 d at 30°C.
3. Pellet 4 mL of the culture, resuspend the pellet in 0.5 mL of sterile 15% v/v
glycerol and store cells at –80°C. Next, use 0.5 mL of the cells for the plasmid
rescue and store rest of culture (0.25–0.5 mL) at 4°C for further experiments.
4. Confirm the complementation by DNA sequencing and/or restriction analysis for
the presence of the mutation in the plasmids isolated from yeast.
3.3. Selection of Novel Polymerases
The main objective behind our complementation experiment was to identify
and characterize Pol3 enzymes that retained wild-type catalytic activity but
were compromised in their fidelity. We used a forward mutation assay, specifi-
cally inactivation of CAN1 gene as the reporter to screen for the candidate
mutants. Wild-type CAN1 codes for arginine permease, which transports argi-
nine into the cell. Canavanine, an arginine analog, is cytotoxic to cells that
have functional CAN1, and inactivation of CAN1 by spontaneous mutagenesis
leads to canavanine resistance. Therefore rates of spontaneous mutation with
different mutant alleles (polymerase-of-interest) can be readily assessed. The

spontaneous mutation in the CAN1 locus acquired by the wild-type strain and
an isogenic strain with exonuclease-deficient DNA polymerase δ is shown in
Fig. 1 as an example of the canavanine patch assay (see Note 16).
3.3.1. Canavanine Patch Assay
1. Using a soft edge toothpick or inoculation loop, randomly pick 3–5 colonies of
equal size of each mutant, the wild-type and patch them on SC-Leu-
Arg+canavanine plates (canavanine 60 mg/L). Starting from the center, gradu-
ally move outward in a circular motion until the diameter of the patch is about
1.5–2 cm. Incubate the plate at 30°C for 2–3 d.
2. Count the number of canavanine-resistant colonies in the wild-type strain and
compare with the mutants.
4. Notes
Standard techniques in manipulating yeast (S. cerevisiae) have been assumed
in this chapter, and the reader with no previous experience working with yeast
is urged to refer to the commonly used molecular biology protocol book (14).
1. Any wild-type haploid strain can be used and minimum requirements are the
presence of Leu2, Ura3, and/or Trp1, His3 markers, which make them aux-
otrophic for leucine, uracil, tryptophan, and histidine biosynthesis, respectively.
Usually, well-characterized strains like W303, BY4741 are preferable as data
can be more meaningfully compared with the literature.
2. DNA polymerases α, δ, ε, and φ are essential for viability of haploid yeast and as
an alternative to Note 1, a yeast strain that harbors a temperature-sensitive muta-
tion in the DNA polymerase gene-of-interest can also be used. It is preferable to
use a strain whose viability is compromised at non-permissive temperatures. For
example, the yeast strain S111 pol1–17; trp1–289 tyr1 ura3–1 ura3–2 ade2–101
gal2 can1 pol1–17 has been used for mutagenesis and selection of novel DNA
polymerase α alleles by complementation and selection of the library at 37°C (4).
Fig. 1. Two single colonies of each strain were patched on SC-Leu-Arg+canavanine
plates. Number of resistant colonies can be approximately correlated with rate of spon-
taneous mutagenesis in that strain. Pol3-01 is a strong mutator polymerase that is defi-
cient in exonuclease proofreading.

3. Expression of DNA polymerase genes in all eukaryotes including S. cerevisiae is
cell-cycle regulated. The transcriptional elements that control the expression of
these genes during G1/S phase are usually present within approximately 700 bp
upstream of the start site. Therefore it is imperative to search the literature for
any information on the promoter region of the gene-of-interest, as this informa-
tion is required to design the PCR primers for cloning into the appropriate vec-
tors. The genetic complementation assay described in this chapter utilizes the
native promoter element of Pol3 as both Ycplac III and Ycplac 33 vector have no
yeast promoters upstream of their multiple cloning site (MCS). We recommend
utilization of the native promoter as pleiotropic effects due to constitutive
overexpression of DNA polymerases may cause aberrant growth defects. If the
information on the promoter region is not documented in the literature, genomic
DNA sequence starting from about 150–700 bp upstream of the start site can
be reasonably assumed to encompass all the cell-cycle specific elements. If the
expression vectors are constructed (and also complements the chromosomal
“knock out” strain) without clear knowledge of the promoter region, it is also
prudent to compare the growth rates, expression levels by Western blotting and
examine the mutant cells on the wild-type strain by microscope.
4. If the multiple cloning site of Ycplac III and Ycplac 33 vectors are incompatible
with the genomic DNA being cloned, consider cloning the DNA using either
“linkers” or “adapters” or devise an alternative strategy by referring to the sec-
tion titled “ Generating new cleavage sites” in the technical appendix of New
England BioLab’s product catalog. Other low-copy yeast vectors that carry Leu2
and Ura3 markers can also be considered.
5. We have found empirically in our lab that it is not necessary to use multiple spin
columns for purification of DNA embedded in the agarose gel matrix according to
the kit instructions. We have reliably purified up to 5 µg of DNA using one spin
column; this enables DNA from several lanes to be pooled and purified in two-to-
four columns. From the agarose gel, estimate the DNA yield (use quantitative DNA
size standards), excise the bands and pool them into 15-mL centrifuge tubes, weigh
the mass of the agarose and scale up the amount of buffer G (provided with the kit).
We routinely elute DNA in 10 mM Tris-HCl, pH 7.5 buffer heated to 65°C.
6. Qiagen gel extraction can also be conveniently used to purify DNA after restric-
tion digestion. Heat inactivate the restriction enzyme, weigh the mass of the liq-
uid, and proceed with the purification according to the instructions. If necessary,
several identical reactions can also be pooled together before purification.
7. Full-length Pol3 is unstable when propagated in E. coli and cultured at 37°C.
Hence the E. coli transformed with full-length Pol3 was cultured at 30°C (7). The
stability of the gene product of interest may have to be empirically determined.
8. The colonies that grow (transformants) on the SC-Ura plate can also be con-
firmed by restreaking them on a new SC-Ura plate. Inoculate 2–3 independent
colonies into 5 mL SC-Ura medium, culture overnight till saturation at 30°C.
Remove 0.5 mL of cells and confirm the presence of the plasmid by “plasmid
rescue” and make glycerol stock of rest of the cells for long term storage.

9. We have transformed yeast by two different procedures:
a. The LioAc/PEG is normally used for transformation when high efficiency
is required (15).
b. But for routine transformation and very small libraries, we use Frozen-EZ II
kit (Zymo research, Orange, CA). The instructions are easy to follow and
results are reliable.
10. If the amplification of the KanMX cassette is inefficient with the custom primers,
optimize the PCR cycling conditions by lowering the annealing temperature to
54°C and incrementally raising the temperature by 2°C. Alternatively, the entire
PCR cycling conditions can be divided into two stages. In the first stage, the
reactions can be cycled for 4–6 cycles at lower annealing temperature (55°C) and
for next 20–25 cycles the annealing temperature can be raised to 60°C.
11. The site-directed mutagenesis procedure described here is identical to the
Stratagene’s Quik-Change kit, but the entire procedure can be performed without
purchasing the kit. Only custom oligonucleotides, DPN I, and Turbo Pfu DNA
polymerase are required.
12. For site-directed mutagenesis the most critical parameter is the genotype of the
E. coli strain that is used for propagation of the DNA template (YcPlac 111-gene-
of-interest) used in the PCR reaction. Only Dam+ E. coli strains should be used.
13. We have had 90% success in identification of the mutant clone after site-
directed mutagenesis. If wild-type sequence is identified, try screening 3–5 colo-
nies instead of one.
14. In absence of any selection pressure, yeast cells randomly lose plasmids. There-
fore the loss of Ycplac33-Pol 3(wt) can be selected by growing yeast cells on 5-
FOA. It is usually easy to find cells that have lost the Ycplac33 plasmid among
4–8 colonies that are being streaked. It is also important to realize that 5-FOA
resistance does not always guarantee loss of the plasmid unless confirmed by
plasmid rescue. Yeast cells can also acquire mutations on the Ura3 marker gene
thus inactivating them and gaining resistance to 5-FOA.
15. Those mutants that failed to grow on the 5-FOA plate by 2–4 d were left at 30°C
for another week; we observed many discrete colonies for each of the mutants.
The survivors were treated as suppressors and were not characterized further.
16. The assay described is purely qualitative and more thorough quantitative analy-
sis of the mutation rates can be obtained from fluctuation assays (16,17).
Acknowledgments
Work supported in this manuscript was funded by grants from NIH
(CA78885) and by the Ellison Medical Foundation.
References
1. Burgers, P. M. J., Koonin, E. V., Bruford, E., et al. (2001) Eukaryotic DNA poly-
merases: proposal for a revised nomenclature. J. Biol. Chem. 276, 43,487–43,490.
2. Patel, P. H. and Loeb, L. A. (2000) DNA polymerase active site is highly mutable:
Evolutionary consequences. Proc. Natl. Acad. Sci. USA 97, 5095–5100.

3. Glick, E., Vigna, K. L., and Loeb, L. A. (2001) Mutations in human DNA poly-
merase eta motif II alter bypass of DNA lesions. EMBO J. 20, 7303–7312.
4. Budd, M. E., Wittrup K. D., Bailey, J. E., and Campbell, J. L. (1989) DNA poly-
merase I is required for premeiotic DNA replication and sporulation but not for
X-ray repair in Saccharomyces cerevisiae. Mol. Cell. Biol. 9, 365–376.
5. Ausubel, F. M. (ed.) (1998) Current Protocols in Molecular Biology, John Wiley
Sons, New York, NY.
6. Simon, M., Goit, L., and Faye, G. (1991) The 3'-5' exonuclease activity in the
DNA polymerase δ subunit of Saccharomyces cerevisiae is required for accurate
replication. EMBO J. 10, 2165–2170.
7. Singh, M., Lawrence, N. A., Groldsby, R. E., et al., Cooperativity of DNA poly-
merase δ proofreading and MSH6-mediated mismatch repair in the maintenance
of genomic stability in Saccharomyces cerevisiae, Submitted.
8. Wach, A., Brachat, A., Pohlmann, R., and Philippsen, P. (1994) New heterolo-
gous modules for classical or PCR-based gene disruptions in Saccharomyces
cerevisiae. Yeast 10, 1793–1808.
9. Sikorski, R. S. and Boeke, J. D. (1991) In vitro mutagenesis and plasmid shuf-
fling: From cloned gene to mutant yeast. Meth. Enzymol. 194, 302–328.
10. Brautigam, C. A. and Steitz, T. A. (1998) Structural and functional insights pro-
vided by crystal structures of DNA polymerases and their substrate complexes.
Curr. Opin. Struct. Biol. 8, 54–63.
11. Steitz, T. A. (1999) DNA polymerases: structural diversity and common mecha-
nisms. J. Biol. Chem. 274, 17,395–17,398.
12. Patel, P. H. and Loeb, L, A. (2000) Multiple amino acid substitutions allow DNA
polymerase to synthesize RNA. J. Biol. Chem. 275, 40,266–40,272.
13. Shinkai, A., Patel, P. H., and Loeb, L, A. (2001) The conserved active site motif A
of Escherichia coli DNA polymerase 1 is highly mutable. J. Biol. Chem. 276,
18,836–18,842.
14. Burke, D., Dawson, D., and Stearns, T. (2000) Methods in Yeast Genetics: A
Cold Spring Harbor Laboratory Course Manual. Cold Spring Harbor Labratory
Press, Plainview, NY.
15. Geitz, R. D. and Schiestl, R. H. (1995) Transforming yeast with DNA. Meth. Mol.
Cell. Biol. 5, 255–269.
16. Lea, D. E. and Coulson, C. A. (1948) The distribution of the numbers of mutants
in bacterial populations. J. Genetics 49, 248–264.
17. Marasischky, G. T., Filosi, N., Kane, M. F., and Kolodner, R. (1996) Redundancy
of Saccharomyces cerevisiae MSH3 and MSH6 in MSH2-dependent mismatch
repair. Genes Dev. 10, 407–420.

Autogene Selections 27
27
4
Autogene Selections
Jijumon Chelliserrykattil and Andrew D. Ellington
1. Introduction
The evolution of proteins is more difficult than the evolution of nucleic
acids both in principle and in practice. While nucleic acid sequence space has
a dimensionality of 4n, where n is the size of the nucleic acid pool (i.e., G, C,
A, and T), protein sequence space has a dimensionality of 20n. Similarly, while
nucleic acids can frequently be directly selected for function from a random
sequence population, the corresponding methods for the directed evolution of
proteins are generally not as robust, in part because of the larger sequence
spaces that must be explored, and in part because protein selection requires a
translation step that in turn often requires cellular transformation, an inher-
ently inefficient procedure that limits library size. In addition, the require-
ment for expression of the protein library in a host places limits on the numbers
and types of selections that can be performed. Selecting individual colonies
on plates is not well-suited to truly high-throughput methods and generally
limits library sizes to on the order of 105. Moreover, the complexity of cellu-
lar metabolism provides an almost limitless source of potential artifacts to
confound the selection of a given phenotype. For example, attempts to evolve
an antibiotic resistance element can be thwarted by the evolution of chromo-
somal resistance elements or by the evolution of plasmid copy number or pro-
moter strength rather than protein efficiency (1,2). While there are frequently
work-arounds for many of the artifacts that might be encountered, they none-
theless ultimately limit the phenotypes that can be selected.
In an attempt to make protein selection more like nucleic acid selection, we
have explored methods that more closely couple information essential to sur-
vival and amplification. In a nucleic acid selection, the information in a selected
sequence can be immediately amplified (that is, the selected sequence itself is

28 Chelliserrykattil and Ellington
amplified). In a protein selection, the information in a selected sequence is fre-
quently amplified as part of a larger genetic unit, whether it be a phage or a cell.
The ability of a protein to amplify its own gene or sequence should poten-
tially provide a short-cut to more traditional protein selection methods. To this
end, we wondered if it might be possible to develop a directed evolution tech-
nique based on so-called ‘autogene’ technologies (3–5). For example, when
the RNA polymerase from bacteriophage T7 is cloned behind its own promoter
sequence, it will self-amplify, generating large amounts of protein. Variants of
a polymerase that ‘self-amplified’ more efficiently under any given set of con-
ditions (higher temperatures, in the presence of unnatural amino acids, with a
different promoter sequence) should accumulate. In polymerase autogene
selections, the desired mutants are enriched by in vivo enzyme activity rather
than host growth advantage or in vitro protein-substrate binding.
While we have embodied this method for RNA polymerases, similar autogene
selection schemes can be envisaged for transcription factors, ligases, and other
enzymes commonly involved in molecular biology manipulations. In addition,
the cellular barrier between individual autogenes and their products need not be
absolute: Ghadessy et al. (6) have described a similar scheme wherein Taq poly-
merase variants are embedded in water-in-oil emulsions, and upon thermal
cycling the cell disintegrates, yet the polymerases and their genes remain in
contact, allowing the critical self-amplification required of an autogene format.
1.1. The T7 RNA Polymerase Autogene
A T7 RNA polymerase autogene is a construct where the gene for T7 RNA
polymerase is cloned downstream of its own cognate promoter. Expression
systems based on T7 RNA polymerase are very useful because the enzyme is
both highly active (T7 RNA polymerase is five times more efficient than
E. coli RNA polymerase in elongating transcripts) and highly specific for its
own promoter. Hence, T7 RNA polymerase can be used to overexpress par-
ticular proteins without expressing host cell genes or interfering with host cell
polymerases, and a T7 RNA polymerase autogene can potentially be used as
part of a protein overexpression system. The first T7 RNA polymerase autogene
was created by Dubendorff et al. (7,8). This autogene was first cloned in a
derivative of plasmid pBR322 in E. coli. However, autogene expression is
potentially so powerful that either the polymerase construct or the target genes
may confer a selective disadvantage on cells and may fail to be maintained
over time (see Note 1). In order to keep basal T7 RNA polymerase activity
sufficiently low, two different strategies were used: first, transcription initia-
tion was blocked by cloning a lac operator in front of the polymerase gene, and
second, polymerase activity was inhibited by co-expressing phage T7
lysozyme, which binds to and inactivates the polymerase.

1.2. Autogene Selection
A combined in vitro / in vivo selection scheme was designed to promote the
self-amplification of novel polymerase variants (9) (see Fig. 1). For example,
when the polymerase was cloned adjacent to mutant T7 RNA polymerase pro-
moters, little T7 RNA polymerase expression was observed. Any polymerase
variant in the autogene pool that could recognize the mutant promoter should
presumably re-establish the feedback loop and concomitantly lead not only
to high protein expression levels, but also to high mRNA expression levels.
Fig. 1. Autogene selection scheme (see Subheading 3.3.). (A) An autogene library
containing the polymerase pool and promoter mutations as described in Subheading
3.2. is transformed into cells and induced with IPTG. Active autogenes overexpress T7
RNA polymerases and the mRNAs encoding the polymerases. The total mRNA is
extracted, and the gene for T7 RNA polymerase is reverse-transcribed and PCR-ampli-
fied. The gene fragments containing sequence variations (shown as *) are re-cloned and
re-transformed. Several rounds of selection and amplification lead to the accumulation
of polymerase variants with altered promoter specificities. (B) Screen for active vari-
ants (see Subheading 3.3.10.). The autogene library is initially plated on LB agar plates
without IPTG. Colonies are lifted via nitrocellulose filters to a new plate containing
IPTG and protein expression is induced. Colonies that have active autogenes cease to
grow due to high polymerase expression levels. These colonies can be identified on the
original plate, and subsequently picked and characterized by sequencing.

If a population of variants were to be transformed into cells, each cell should
act as a discrete test tube, fostering the accumulation of the mRNA represent-
ing a given polymerase variant. At the conclusion of the self-amplification
process, the variants could be thrown together, and polymerase mRNAs should
be roughly represented in the mixed population according to the enzymatic
success of the polymerases they encoded. In the case of a library cloned be-
hind a mutant promoter, mRNA extracted from the population of cells should
represent polymerase variants in rough proportion to their ability to utilize the
mutant promoter. Re-cloning the successful sequences should over-represent
successful polymerases relative to unsuccessful polymerases, and provide a
means to carry out iterative rounds of selection and amplification. Multiple
cycles of selection and amplification should ultimately lead to the accumula-
tion of those polymerase variants that were most successful at facilitating their
own expression.
1.3. Selections for Novel Promoter Specificities
As a proof of principle, we searched for polymerase variants that could uti-
lize a promoter variant in which there was a G to C change at position –11.
This mutation resembles the bacteriophage T3 promoter (10–12). A single
asparagine to aspartate substitution at position 748 in T7 RNA polymerase was
already known to facilitate the utilization of the T3-like promoter (13). A
library of polymerase variants was constructed in which amino acid residues
746, 747, and 748 were completely randomized as described in Subheading
3.2.2. This library was then cloned behind the T3-like promoter and three
rounds of selection and amplification (as described in Fig. 1) were carried out.
The progress of the selection was monitored in two ways. First, the autogene
constructs were under the control of the lac repressor, and induction of the
wild-type autogene by IPTG lead to cell death (see Subheadings 1. and
3.3.10.). Therefore, the fraction of colonies that were lost on replica plating to
IPTG was hypothesized to be roughly proportional to the accumulation of
active autogene variants. The proportion of IPTG-sensitive colonies was 20%
after one round of selection, 88% after two rounds, and 96% after three rounds.
Second, the number of PCR cycles that were required to amplify recovered
mRNA molecules was assumed to correlate with the amount of mRNA that
accumulated in bacteria during a given round of selection. It took 20 PCR
cycles for Round 1 RT-PCR DNA to be visualized on an agarose gel, 14 cycles
for Round 2, and 12 cycles for Round 3. The selection was therefore assumed
to be essentially complete following round three.
Active polymerase variants were identified, cloned, and sequenced following
each round of selection. It was found that the selection not only quickly re-estab-
lished the wild-type amino acids at positions 746 (arginine) and 747 (leucine),

but also converged on the known N748D change, indicating that the autogene
selection method is working as expected. Moreover, the convergence on the
expected sequence indicated that the screening methods described above did in
fact accurately reflect the extent of selection.
A second selection was also carried out to examine a wider range of pro-
moter and polymerase combinations. For this experiment, a promoter library
was constructed in which positions –8 through –11 in the promoter were com-
pletely randomized; each of these nucleotides had previously been shown to
be extremely important for the specificity of interactions with T7 RNA poly-
merase (13–16). The promoter library was combined with the gene library in
order to create approx 51,200 (44 × 203) combinations of promoters and poly-
merases. The joint promoter:polymerase library was transformed into E. coli
and variants were again selected as described in Subheading 3.3. To begin
each new round, the polymerase variants were re-cloned behind the promoter
library. However, after each round of selection only the polymerase mRNA
could be recovered by reverse transcriptase-PCR (RT-PCR) for the next
round, since the corresponding promoters were not part of the transcript. This
is meant that at each round a given polymerase variant had to randomly
re-find one or more promoters that it could productively utilize. However,
this was not an overly daunting task, since there were only ca. 256 promot-
ers. At the conclusion of the selection, successful combinations of promoters
and polymerase variants were identified by screening for colonies that could
not grow on isopropyl-β-D-thiogalactopyranoside (IPTG). This selection
identified polymerase variants that could utilize a variety of T7 promoters; a
summary of the selected polymerase variants and the promoters that they can
utilize in vivo is shown in Table 1.
2. Materials
2.1. Kits and Reagents
1. Restriction endonucleases (New England Biolabs, Beverly, MA).
2. Topo TA cloning kit (Life Technologies, Carlsbad, CA).
3. T4 polynucleotide kinase (New England Biolabs).
4. QIAquick gel purification kit (Qiagen, Valencia, CA).
5. DNA mini, midi, and maxi prep kits (Qiagen).
6. QIAquick PCR purification kit (Qiagen).
7. T4 DNA ligase (Life Technologies).
8. Taq DNA polymerase (Promega, Madison, WI).
9. DNase I (Promega).
10. Shrimp alkaline phosphatase (USB, Cleveland, OH).
11. MasterPure RNA purification kit (Epicenter Technologies, Madison, WI).
12. AMV reverse transcriptase and 5X RTase buffer (USB).

2.2. Cell Lines
1. DH5∆lac was a kind gift from Dr. Brian Sauer (Stowers Institute of Medical
Research, Kansas City, MO).
2. INVαF' was purchased from Life Technologies.
3. NovaBlue and HMS174 were purchased from Novagen (Madison, WI).
2.3. Plasmids
1. pET28a+ and pLysS were purchased from Novagen.
2. pAR1219 was a kind gift of Dr. David Hoffman, University of Texas at Austin;
this plasmid was originally developed by Studier (8).
3. Methods
The methods described below outline the construction of the wild-type T7
RNA polymerase autogene, the generation of autogene libraries, and selec-
tions using the autogene libraries.
3.1. Construction of the Wild-Type T7 Autogene Construct
(pET/T7/T7)
The T7 autogene was made by cloning the T7 RNA polymerase gene into the
plasmid pET28a. The T7 lac promoter in the plasmid pET28a contains a 25
Table 1
Summary of Selection for Polymerases
with Altered Promoter Specificities
Positions in the polymerase gene* Promoter Sequence
Polymerases 748 756 758 (–11 to –8)
Round 3
R3 – 9 Asn Arg Cys GACT
R3 – 32 Asn Arg Cys GACG
R3 – 26 Asn Arg Cys TGTA
R3 – 17 Ala Met Ser GGTA
R3 – 5 Phe Gly Ile GCTA
R3 – 29 Thr Lys Gln GACT
Round 4
R4 – 14 Asn Arg Cys GACT
R4 – 16 Asn Arg Cys GTTA
R4 – 17 Asn Arg Cys GTCA
ppC6 Asn Arg Cys GATA
R4 – 11 Asn Arg Ser GACT
*Wild-type Asn Arg Gln GACT

base pair lac operator sequence immediately downstream from the 17 base-pair
T7 RNA polymerase promoter. It also carries the natural promoter and coding
sequence for the lac repressor (lacI). Binding of the lac repressor, to the lac
operator effectively blocks transcription by T7 RNA polymerase. Addition of
IPTG derepresses the T7 RNA polymerase promoter and induces the expres-
sion of the T7 RNA polymerase gene. The plasmid pET28a also contains the T7
terminator and a ribosomal binding site for translation of the cloned gene.
The steps in the construction of the wild-type T7 autogene are listed below:
1. Using plasmid pAR1219, (originally made by Studier [8]) as a template, a 2.7 kb
fragment containing the T7 RNA polymerase gene was amplified using the prim-
ers ae32.1 and ae29.1. These primers were designed to have EcoRI and BsmBI
restriction sites and had the following sequences:
ae32.1:
GGG CGT CTC GCA TGA ACA CGA TTA ACA TCG CT
(BsmBI site is underlined)
ae29.1:
GGG AAT TCT TAC GCG AAC GCG AAG TCC GA
(EcoRI site is underlined)
2. The PCR product was first directly cloned into the vector pCR2.1 (Topo TA clon-
ing kit, Life Technologies) using the protocol suggested in the kit (see Note 2).
3. The resulting plasmid was then digested with BsmBI and EcoRI and the T7 RNA
polymerase gene was cloned into the expression plasmid pET28a+ after digest-
ing the latter with NcoI and EcoRI (Novagen). BsmBI cleaves downstream of its
restriction site in primer ae32.1 and generates a sticky end compatible with NcoI.
4. The wild-type autogene thus obtained (pET/T7p/T7) was transformed into strain
HMS174 pLysS (Novagen), the same cell line Studier et al. initially used to ex-
press the autogene (8). This strain contains plasmid pLysS which encodes T7
lysozyme, the natural inhibitor of T7 RNA polymerase. The plasmid pLysS also
confers resistance to chloramphenicol and is compatible with pET28a.
3.2. Construction of Autogene Libraries
Autogene libraries were constructed by first generating vectors containing
promoter mutations, and then ligating randomized T7 RNA polymerase genes
into these vectors. The libraries were then transformed into DH5∆lac pLysS
cells for selection (see Note 3).
3.2.1. Libraries with Promoter Mutations (pET/T7p*/T7)
The promoter point mutation G(–11)C and the lac operator region were
introduced adjacent to the T7 RNA polymerase promoter using the oligonucle-
otides ae66.1 and ae66.2. Annealing these oligonucleotides generated sticky
ends that were suitable for ligation into the pET/T7/T7 autogene construct
cleaved with BglII and XbaI.

ae66.1:
GAT CTC GAT CCC GCG AAA TTA ATA CCA CTC ACT ATA GGG
GAA TTG TGA GCG GAT AAC AAT TCC CCT (BglII site underlined)
ae66.2:
CTA GAG GGG AAT TGT TAT CCG CTC ACA ATT CCC CTA TAG
TGA GTG GTA TTA ATT TCG CGG GAT CGA (XbaI site underlined)
Similarly, oligonucleotides gcP1.66 and gcP2.66 were used to randomize
positions –8 to –11 in the T7 RNA polymerase promoter.
gcP1.66:
GAT CTC GAT CCC GCG AAA TTA ATA CNN NNC ACT ATA GGG
GAA TTG TGA GCG GAT AAC AAT TCC CCT (BglII site underlined; N
indicates an equimolar mix of the four bases)
gcP2.66:
CTA GAG GGG AAT TGT TAT CCG CTC ACA ATT CCC CTA TAG
TGN NNN GTA TTA ATT TCG CGG GAT CGA (XbaI site underlined; N
indicates an equimolar mix of the four bases)
Oligonucleotides were synthesized in our lab on an ABI 394 DNA synthe-
sizer (PE Biosystems Foster City, CA). For annealing, the oligonucleotides
were mixed together, heated at 94°C for 1 min and allowed to cool to room
temperature over 10 min. The annealed, double-stranded DNAs were phospho-
rylated with T4 DNA polynucleotide kinase prior to ligation (see Subheading
3.2.1.1.). Throughout the cloning procedures, oligonucleotides were visual-
ized on a 4% agarose gel.
3.2.1.1. PHOSPHORYLATION OF OLIGONUCLEOTIDES
1. Mix 1 µL 100 µM double-stranded DNA, 1 µL 10X T4 DNA kinase buffer (New
England Biolabs) and 5 Units T4 DNA polynucleotide kinase (New England
Biolabs). Add water to 10 µL.
2. Incubate at 37°C for 1 h.
3. Inactivate the T4 DNA polynucleotide kinase by incubating at 65°C for 15 min.
3.2.1.2. CLONING TO CREATE THE LIBRARY WITH PROMOTER MUTATIONS
(PET/T7P*/T7)
1. Cleave pET/T7/T7 autogene construct with BglII and XbaI, and recover the right
size vector DNA fragment using the QIAquick gel extraction kit.
2. Quantitate the concentration of the vector and the phosphorylated oligonucle-
otide insert. For ligation, a vector to insert molar ratio of 1:3 was used (30 fmol
vector ends to 90 fmol insert end).
3. Set up ligation reactions in 20 µL volumes with 5X T4 DNA ligase buffer, and 1
unit of T4 DNA ligase. Perform ligations at 19°C for 6 h.
4. Deactivate the ligase by incubating the ligation mix at 70°C for 10 min.
5. Transform the ligated DNA into the electrocompetent cells prepared as described in
the Subheading 3.3.1. to form the library with promoter mutations (pET/T7p*/T7).

3.2.2. Libraries with Random Regions
in the Polymerase Gene (pET/T7p*/T7*)
In the selection for T3-like promoter specificity, T7 RNA polymerase was
randomized at amino acid positions 746–748. Two pairs of primers (gcT7a.6 and
gcT7lib1; gcT7a.9 and gc3’pET) and the wild-type (pET/T7p/T7) plasmid were
used to generate two gene fragments, which were in turn assembled by overlap
PCR (17) (see Subheading 3.2.2.1.). In the selection in which both the promoter
and the polymerase were varied, T7 RNA polymerase was similarly randomized
at amino acid positions 748, 756, and 758 using the primer gcT7lib2.80.
gcT7a.6: GGACCGATAA CGAAGTAGTT ACCGTGACCG
gcT7lib1.66:
CTG cAA cCG GAA CTG cCC GAG GAA CAT CAG NNN NNN NNN
CGT CTG AAT gGG CTT CTT GTA TTC CTG (residues 2236–2244 are
randomized, silent mutations are in lower case)
gcT7lib2.80:
C GCT ATC cTT GTT GGT GTT gAT GGT AGG NNN TAA NNN GAA
CTG cCC GAG GAA CAT CAG NNN CAA GCG CGT CTG AAT AGG C
(residues 2241–2244, 2266–2268, and 2272–2274 are randomized, silent
mutations are in lower case)
gcT7a.9:
CTG ATG TTC CTC GGg CAG TTC CGg TTg CAG (mismatches are in
lower case)
gc3'pET: GCT CAG CGG TGG CAG CAG CCA ACT C
3.2.2.1. OVERLAP PCR
1. Set up a polymerase chain reaction with the pET/T7/T7 plasmid and primers
gcT7a.6 and gcT7lib1 to yield the upstream, double-stranded fragment. Set up
a PCR with primers gcT7a.9 and gc3'pET to yield the downstream, double-
stranded fragment.
2. Purify both fragments using a QIAquick gel purification kit.
3. In the overlap PCR, for a 50 µL total volume reaction, add upstream and down-
stream fragments in an equimolar ratio (less than 200 ng per fragment) and requi-
site amounts of PCR buffer, dNTPs and Taq polymerase. Carry out 5 thermal cycles
to generate the initial, full-length template. Then add 0.5 µL each of 20 µM solu-
tions of the gcT7a.6 and gc3'pET primers. Carry out 20 more thermal cycles.
4. Gel-purify the PCR amplification product using the QIAquick gel purification kit.
Quantitate the amount of product generated by visualization in a 3% agarose gel.
3.2.2.2. CLONING THE RANDOMIZED POLYMERASE GENE INTO THE AUTOGENE VECTOR
1. Digest the purified overlap PCR products and autogene vectors containing
mutated promoters (e.g., pET/T7p*/T7) (see Subheading 3.3.7.) with the restric-
tion enzymes AflII and EcoRI.

2. Gel purify the fragments containing randomized regions using the QIAquick gel
purification kit.
3. Ligate the purified fragments into the appropriate vectors (see Subheading
3.3.8.).
3.3. Selection Procedure
The scheme for autogene selections is shown in Fig. 1.
1. Transform the autogene pool into DH5∆lac pLysS cells by electroporation (see
Subheadings 3.3.1. and 3.3.2.)
2. Incubate the culture at 37°C for 7–10 h and induce T7 RNA polymerase expres-
sion by adding IPTG to a final concentration of 0.4 mM (see Subheading 3.3.3.).
3. After an hour of induction, extract RNA using the Masterpure RNA purification
kit (Epicenter Technologies) following the protocol suggested in the kit.
4. Treat the purified RNA with DNaseI (see Subheading 3.3.4.) to remove trace
DNA contamination and extract it with phenol-chloroform to remove the DNaseI.
5. Reverse-transcribe the extracted RNA (see Subheading 3.3.5.) using AMV-
reverse transcriptase (USB) and the primer gc3'pET.
6. PCR-amplify the resulting cDNA using the primers gcT7a.6 and gc3'pET. The
PCR mix should be treated with proteinase K to remove Taq DNA polymerase
(see Subheading 3.3.6.).
7. Gel purify the PCR products using the QIAquick PCR purification kit and digest
it with AflII and EcoRI (see Subheading 3.3.7.).
8. Ligate the purified insert back into the original autogene vector (see Subheading
3.3.8.) to form a fresh autogene pool for subsequent rounds of selection.
Several cycles of selection and amplification lead to the enrichment of those
polymerase variants that are most successful at recognizing the variant pro-
moter and facilitating their own expression. Bacteria containing these poly-
merase variants can be further identified by screening for colonies that are
unable to grow on IPTG plates (see Subheading 3.3.10.). The different steps
in the selection process are described in detail below.
3.3.1. Preparing Competent Cells for Electroporation
(modified from Dower’s protocol [18])
1. Pick a single colony of DH5∆lac pLysS from a fresh plate. Grow in LB media
containing appropriate antibiotics at 37°C for 8 h with vigorous shaking.
2. Dilute the initial culture 1:100 into a 1-L culture. Vigorously shake at 19°C to
an OD600 of 0.3–0.8.
3. Harvest the cells by chilling on ice for 5 min and centrifuging at 3250g for 10 min
at 4°C.
4. Gently resuspend the cell pellet in 1 L cold, autoclaved, double-distilled water.
5. Centrifuge at 3250g for 10 min at 4°C.
6. Gently resuspend the cell pellet in 0.5 L cold, autoclaved, double-distilled water.
7. Centrifuge at 3250g for 10 min at 4°C.

8. Finally, gently resuspend the pellet in 2–20 mL of cold 10% glycerol (or cold,
autoclaved, double-distilled water).
3.3.2. Transformation by Electroporation
1. Prepare fresh, electroporation competent cells for every transformation. Keep the
cells on ice at all times.
2. Add ligated DNA to the competent cells on ice.
3. Transfer the concentrated, competent cells containing DNA to a 0.2-cm
electroporation cuvet. Use at most 300 µL cells per cuvet. Electroporate at 2.5 kv
(we use the E. Pulser from Bio-Rad Laboratories, Hercules, CA). Add a 50-fold
excess volume of SOC immediately following electroporation.
4. Shake vigorously at 37°C for one hour. Add a 100-fold excess volume of Luria-
Bertani (LB) with antibiotics. Then shake at 37°C for no more than 10 h.
3.3.3. Induction and Total mRNA Purification Following Selection
1. At OD600 about 0.5, induce with IPTG to a final concentration of 0.4 mM.
2. After one hour of induction with IPTG, isolate total mRNA using the Masterpure
RNA purification kit (Epicenter Technologies) following the protocol suggested
in the kit (see Note 5).
3.3.4. DNaseI Treatment and mRNA Purification
The isolated mRNA should be further treated with DNAse to ensure the
complete removal of contaminating DNA.
1. For 500 µg of total RNA, add 25 Units of DNase I (Promega) with 50 µL 10X
RNase-free DNase I buffer (Promega). Add diethylpyrocarbonate (DEPC)-treated
water to 500 µL. Incubate at 37°C for 1 h.
2. Carry out a phenol-chloroform extraction to remove the DNase I.
3. Ethanol precipitate the purified RNA.
3.3.5. Reverse Transcription Using AMV Reverse Transcriptase
A trial reverse transcription reaction and PCR should be done prior to carry-
ing out a large scale RT-PCR reaction in order to optimize the amount of RNA
that will be used to create the pool for the next round of selection. Control
reactions without RNA input and without reverse transcriptase should also be
carried out to make sure that there is no residual DNA contamination.
1. Mix RNA (~1–5 µg), and primer (2.5 µM final concentration), and heat denature
at 72°C for 3 min. Cool on ice for 5 min.
2. Add 5X RTase buffer (USB), 4 Units AMV Reverse Transcriptase, and dNTP’s
(0.4 mM final concentration) in a total volume of 20 µL; incubate the mixture at
42°C for one hour.
3. For the trial PCR, 10 µL of the RT reaction is used as input for a 50 µL total
volume PCR. The trial reaction is iteratively thermal cycled in order to optimize

the number of cycles required for large scale RT (typically it takes about 15–20
cycles for DNA from Round 1 to be visualized). At each interval (typically every
3–5 thermal cycles), 10 µL aliquots are resolved and visualized on a 1% agarose
gel. Once the optimal number of cycles for amplification has been determined,
this will be applied to the remainder of the RT reaction.
3.3.6. PCR Reaction Purification to Remove Taq Polymerase
1. For every 93 µL of amplified DNA (still in the PCR mix), add 1 µL 1 M Tris-
HCl, pH 7.8, 1 µL of 0.5 M ethylenediaminetetraacetic acid (EDTA), 5 µL 10%
sodium dodecylsulfate (SDS) (final concentrations of 10 mM Tris, 5 mM EDTA,
and 1% SDS).
2. Add 2.5 µL proteinase K (20 mg/mL). Incubate at 37°C for 30 min to 1 h.
3. Heat at 68°C for 15 min to inactivate proteinase K.
4. Purify the amplified DNA using the QIAquick PCR purification kit (Qiagen).
3.3.7. Digestion of the DNA Insert and Vector
Using Restriction Enzymes
3.3.7.1. FRAGMENT CONTAINING THE LIBRARY
The DNA obtained after RT-PCR is digested using the restriction enzymes
AflII and EcoRI. The digestion reactions are usually carried out at 37°C for
12–14 h unless otherwise recommended by the manufacturer. The fragment
containing the random region is incised and gel purified using the QIAquick
gel purification kit.
3.3.7.2. VECTOR PREPARATION
1. Digest the pET/T7p/T7 plasmid at 37°C overnight using the restriction enzymes
AflII and EcoRI to yield fragments of lengths 7.4 and 0.6 kb (from pET/T7p/T7).
2. Heat the digestion mixture to 65°C for 15 min to inactivate the restriction
enzymes.
3. Dephosphorylate the vector fragment using shrimp alkaline phosphatase (SAP;
10 units for ~1 µg of vector DNA) at 37°C for 30 min.
4. Inactivate the phosphatase at 65°C for 15 min. Purify the 7.4 kb fragment using
the QIAquick gel purification kit for subsequent ligation reactions.
3.3.8. Ligation Reactions
During each round of selection, a test ligation was performed prior to the
large scale ligation in order to determine the optimum insert-to-vector ratio for
library construction.
1. The test ligation reaction volume should be 20 µL with 5X T4 DNA ligase buffer,
and 1 unit of T4 DNA ligase. Perform ligations at 19°C for 6 h. Set up parallel
reactions with varying molar ratios of vector to insert. (typically, the insert to
vector ratios were varied between 1:1 to 4:1).

2. Deactivate the ligase by incubating the ligation at 70°C for 10 min.
3. Transform the ligated DNA into electrocompetent cells prepared as described in
Subheading 3.3.1.
4. Plate an aliquot of cells on selective medium and incubate at 37°C overnight in
order to assay the library size.
The optimal insert:vector molar ratio was typically found to be between 1:1
and 3:1. Large scale ligation is then performed by scaling up the test ligation
that gave the best transformation efficiency. Approximately 1 µg vector DNA
is used in the large ligation reaction during each round of selection along with
10 units of T4 DNA ligase in a total volume of 200 µL.
3.3.9. Cleaning up Ligation Products for Efficient Tranformation (19)
This procedure has been found to increase electroporation transformation
efficiency. Therefore, following the ligation step at each round of selection:
1. Add 4X vol of water to 1X vol of ligation reaction.
2. Add 50X vol of butanol and mix thoroughly.
3. Centrifuge at 13,000g for 10 min at 4°C.
4. Remove the supernatant completely. Air dry for 5 min.
5. Suspend the DNA pellet in 0.5X vol of water.
3.3.10. Screen for Active Mutants
A colony lift technique was used to monitor the progress of the selection.
Cells containing very active autogenes cease to grow when lifted to LB plates
containing IPTG.
1. Roughly 1 h after electroporation and growth at 37°C, plate an aliquot of the cell
culture containing the autogene pool onto LB plates containing appropriate anti-
biotics, and incubate at 37°C for 8–12 h.
2. Lift the colonies from these plates to plates containing IPTG using a butterfly
nitrocellulose membrane (Midwest Scientific, Valley Park, MO).
3. Incubate both plates at 37°C for approx 8 h.
4. Compare the sizes of corresponding colonies in the plates containing IPTG and
the ones without IPTG.
5. Pick colonies that did not grow well upon lifting to IPTG from the original plate
and characterize them by sequencing. In each round at least 5000 or more indi-
vidual variants can be examined.
4. Notes
1. The high level of T7 RNA polymerase expression from an active, wild-type T7
autogene has been found to be detrimental to the host cell growth (7–9). There-
fore, it is critical to control the activities of autogenes inside cells. In the T7 RNA
polymerase autogene construct, a lac operator was included between the T7 pro-
moter and the T7 RNA polymerase gene. The lac operator is bound tightly by the

lac repressor (dissociation constant K ~10–13 M–1). This binding efficiently
represses transcription (7,20,21). In the presence of the gratuitous inducer IPTG,
the affinity of lac repressor for the lac operator is reduced and transcription can
proceed. Each subunit of the lac repressor is capable of binding one IPTG mol-
ecule with a dissociation constant K ~10–6 M–1. However, transcriptional regula-
tion by the lac operator alone proved to be inadequate to completely stabilize
plasmids carrying the wild-type T7 RNA polymerase autogene. Therefore, an
additional layer of inhibition of transcription was added. T7 lysozyme is a phage
protein that naturally sequesters T7 RNA polymerase from transcription, thereby
regulating the expression of phage proteins (22). Plasmids containing the wild-
type T7 autogene could only be established in uninduced E. coli under both lac
repression and lysozyme inhibition.
2. The PCR-amplified fragment containing the T7 RNA polymerase gene was ini-
tially digested with BsmBI and EcoRI and ligated into a pET28a vector. The
ligation products were transformed into competent Novablue pLysS cells by heat
shock. However, only a few colonies grew and plasmid digestion patterns indi-
cated that the transformants contained vectors with no insert. After several more
trials of digestion, purification and ligation, the T7 RNA polymerase gene still
could not be successfully cloned into pET28a. In the ae32.1 primers, the BsmBI
restriction site was only 3 base-pairs away from the end of the fragment; there-
fore the BsmBI endonuclease may have failed to cleave. As an alternative, PCR-
amplified fragments containing the T7 RNA polymerase gene were first cloned
into pCR2.1 using the Topo TA cloning kit. The ligation reactions were then
transformed into competent Novablue pLysS cells.
3. Prior to the autogene selection, the toxicity of the wild-type autogene was moni-
tored on plates and in liquid cultures with or without IPTG induction. The
HMS174 pLysS cell line was first used to establish the plasmid pET/T7/T7,
which contains an active autogene. Nonetheless, these cells still grew slower
than cells that contained an inactive autogene (pET/T7p*/T7). Transformation
with pET/T7/T7 also gave substantially fewer colony-forming units (CFUs)
than transformation with pET/T7p*/T7. Therefore, a variety of cell lines were
assayed to identify which strain seemed to be most tolerant of the autogene.
Transformation efficiencies with pET/T7/T7 were determined for more than 10
different cell lines. In all instances, it was observed that if a cell line did not
contain pLysS, pET/T7/T7 could not be established. Among the cell lines
tested, DH5∆lac(pLysS) cells gave the best transformation efficiencies and
hence was chosen for selections.
4. In constructing the autogene pool for the selection where both the polymerase
and promoter were randomized, two stop codons were first introduced at amino
acid positions 747 and 748 in the wild-type RNA polymerase gene to form pET/
T7/T7stop. This safeguard eliminated the possibility that wild-type RNA poly-
merases could be selected due to undigested vector background. Also, preventing
the expression of active T7 RNA polymerase removed possible selection pres-
sure and obviated skewing of the promoter library due to the toxicities of active

autogene constructs. Oligonucleotides containing promoters randomized between
the –8 and –11 positions were then cloned into pET/T7/T7stop to form an
autogene construct with a promoter pool, pET/T7pp/T7stop. Unselected clones
from this pool were sequenced, and the distribution of random sequence nucle-
otides was estimated to be 29% G, 21% A, 19% T, and 24% C.
5. The growth curve of DH5∆lac pLysS cells containing an active autogene, pET/T7/
T7, is shown in Fig. 2. At an OD600 of 0.5, the culture was induced by adding IPTG
to a concentration of 0.4 mM. It is apparent that cells containing an active autogene
are viable for at least 2 h following induction with IPTG. Therefore, total RNA was
isolated one hour after induction with IPTG during each round of selection. The
timing of RNA harvesting could be varied in order to identify autogene variants
that were quickly transcribed or translated, or were slowly turned over.
6. Large-scale RT and PCR can be performed by scaling up the test reactions, either
in terms of volumes or the number of tubes. Typically 25–40 µg of RNA is intro-
duced into the reverse transcriptase reaction at each round of selection.
7. Because of the deleterious nature of autogene expression on both transformation
and cell growth, it is entirely possible that the most active autogenes were never
selected from our population. We do not believe this was not a problem given the
small library sizes that were used and the limited attempts to alter specificity that
have so far been carried out, but toxicity problems could confound other, more
ambitious selection experiments.
Fig. 2. Growth characteristics of cells containing a wild-type autogene (pET/T7/
T7; see Notes 1 and 5). Cells containing the wild-type autogene (pET/T7p/T7) were
grown at 37°C and induced with 0.4 mM IPTG at an OD600 of 0.5 (indicated by the
arrow). The OD600 was monitored every 15 min for 15 h using an automated microbi-
ology workstation, the Bioscreen C (Labsystems Oy, Finland).

8. While these experiments describe the selection of T7 RNA polymerase autogenes,
it is relatively easy to envision other selection experiments that similarly ask for
a ‘reflective’ interaction between a gene and its gene product or cellular pheno-
type. For example, similar methods could be used to evolve transcription factors
that enhanced their own synthesis. A tRNA synthetase gene placed in parallel
with the T7 RNA polymerase gene could function as a selectable ‘mini-operon’
that could evolve to suppress stop codons within either gene. Another example is
the evolution of a mutator allele to yield higher mutation frequencies, allowing
faster adaptation to a variety of antibiotics.
References
1. Normark, B. H. and Normark, S. (2002) Evolution and spread of antibiotic resis-
tance. J. Intern. Med. 252, 91–106.
2. Mortlock, R. P. (1982) Metabolic acquisitions through laboratory selection. Annu.
Rev. Microbiol. 36, 259–284.
3. Brisson, M., He, Y., Li, S., Yang, J. P., and Huang, L. (1999) A novel T7 RNA
polymerase autogene for efficient cytoplasmic expression of target genes. Gene
Ther. 6, 263–270.
4. Li, S., Brisson, M., He, Y., and Huang, L. (1997) Delivery of a PCR amplified
DNA fragment into cells: a model for using synthetic genes for gene therapy.
Gene Ther. 4, 449–454.
5. Walker, K., Xie, Y., Li, Y., et al. (2001) Cytoplasmic expression of ribozyme in
zebrafish using a T7 autogene system. Curr. Issues Mol. Biol. 3, 1–6.
6. Ghadessy, F. J., Ong, J. L., and Holliger, P. (2001) Directed evolution of poly-
merase function by compartmentalized self-replication. Proc. Natl. Acad. Sci. USA
98, 4552–4557.
7. Dubendorff, J. W. and Studier, F. W. (1991) Controlling basal expression in an
inducible T7 expression system by blocking the target T7 promoter with lac re-
pressor. J. Mol. Biol. 219, 45–59.
8. Dubendorff, J. W. and Studier, F. W. (1991) Creation of a T7 autogene. Cloning
and expression of the gene for bacteriophage T7 RNA polymerase under control
of its cognate promoter. J. Mol. Biol. 219, 61–68.
9. Chelliserrykattil, J., Cai, G., and Ellington, A. D. (2001) A combined in vitro/
in vivo selection for polymerases with novel promoter specificities. BMC
Biotechnol. 1, 13.
10. Sarkar, P., Sengupta, D., Basu, S., and Maitra, U. (1985) Nucleotide sequence of
a major class-III phage-T3 RNA-polymerase promoter located at 98.0% of phage-
T3 genetic map. Gene 33, 351–355.
11. Adhya, S., Basu, S., Sarkar, P., and Maitra, U. (1981) Location, function, and
nucleotide sequence of a promoter for bacteriophage T3 RNA polymerase. Proc.
Natl. Acad. Sci. USA 78, 147–151.
12. Bailey, J. N., Klement, J. F., and McAllister, W. T. (1983) Relationship between
promoter structure and template specificities exhibited by the bacteriophage T3
and T7 RNA polymerases. Proc. Natl. Acad. Sci. USA 80, 2814–2818.

13. Raskin, C. A., Diaz, G., Joho, K., and McAllister, W. T. (1992) Substitution of a
single bacteriophage T3 residue in bacteriophage T7 RNA polymerase at position
748 results in a switch in promoter specificity. J. Mol. Biol. 228, 506–515.
14. Rong, M., He, B., McAllister, W. T., and Durbin, R. K. (1998) Promoter specific-
ity determinants of T7 RNA polymerase. Proc. Natl. Acad. Sci. USA 95, 515–519.
15. Raskin, C. A., Diaz, G. A., and McAllister, W. T. (1993) T7 RNA polymerase
mutants with altered promoter specificities. Proc. Natl. Acad. Sci. USA 90,
3147–3151.
16. Imburgio, D., Rong, M., Ma, K., and McAllister, W. T. (2000) Studies of pro-
moter recognition and start site selection by T7 RNA polymerase using a compre-
hensive collection of promoter variants. Biochemistry 39, 10,419–10,430.
17. Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease, L. R. (1989) Site-
directed mutagenesis by overlap extension using the polymerase chain reaction.
Gene 77, 51–59.
18. Dower, W. J., Miller, J. F., and Ragsdale, C. W. (1988) High efficiency transfor-
mation of E. coli by high voltage electroporation. Nucl. Acids Res. 16, 6127–6145.
19. Thomas, M. R. (1994) Simple, effective cleanup of DNA ligation reactions prior
to electro-transformation of E. coli. Biotechniques 16, 988–990.
20. Schmitz, A. and Galas, D. J. (1979) The interaction of RNA polymerase and lac
repressor with the lac control region. Nucl. Acids Res. 6, 111–137.
21. Dunaway, M., Olson, J. S., Rosenberg, J. M., Kallai, O. B., Dickerson, R. E., and
Matthews, K. S. (1980) Kinetic studies of inducer binding to lac repressor.operator
complex. J. Biol. Chem. 255, 10,115–10,119.
22. Moffatt, B. A., and Studier, F. W. (1987) T7 lysozyme inhibits transcription by
T7 RNA polymerase. Cell 49, 221–227.

Selection Via CAT Fusion 45
45
5
Selection for Soluble Proteins via Fusion
with Chloramphenicol Acetyltransferase
Volker Sieber
1. Introduction
The low solubility of a protein is one of the most frequent impediments for
its structural and functional analysis and, on a more practical aspect, for its
application as an industrial enzyme. The reason for low solubility can lie in
low conformational stability (1), in a high number of surface-exposed hydro-
phobic amino acids (2) or in certain structural features, such as membrane bind-
ing regions (3). By changing the amino acid sequence of these proteins, their
solubility can be significantly improved (4,5). Hence a general method that can
efficiently identify (i.e., select) more soluble protein variants from a large rep-
ertoire is very useful in evolving such proteins.
A solubility selection can also be used to accelerate a general screening pro-
cess. The limit in evolutionary approaches is rarely the creation of the repertoire
but instead the analysis, i.e., the identification of the few interesting candidates.
When evolving enzymes for certain activities, unwelcome mutations usually
extensively dilute the repertoire. To most efficiently sieve through the many
variants, it is advisable to apply a tiered screen. A good first tier should accom-
modate a high number of variants and should target a property that is sensitive to
negative mutations. Both are provided by a selection for solubility.
Protein solubility and protein stability are often closely related. The PROSIDE
approach (6) (see Chapter 6) is useful in selecting more stable proteins and can
in general also be applied for the selection of more soluble variants. One limita-
tion, though, is that it requires both termini to be on the surface of the protein and
that it cannot be applied to enzymes that require the processing of proteins with
pro- or prepro-domains to reach an active state. A possible approach to over-
come this is to fuse the protein of choice to a reporter protein whose activity will

46 Sieber
depend on the solubility and stability of the former. Waldo et al. (5,6) have
shown that the activity of a reporter protein can correlate with the stability of
different variants of one protein when these were fused with the green fluo-
rescent protein (GFP). Maxwell et al. (4) used chloramphenicol acetyltrans-
ferase (CAT) as fusion partner for variants of HIV integrase and also found a
very good correlation between the solubility of this protein and the ability of
E. coli to grow on chloramphenicol (cam). Their approach has the advantage
of allowing a true selection: negative variants are directly eliminated. Sieber
et al. (7) used a fusion with CAT in order to select protein variants of cyto-
chrome P450 that had lost their affinity to the membrane and were more
soluble. Their approach was to use the selection as a first-tier filter before an
enzymatic activity screen. It also helped to eliminate all variants that were
not completely translated (shift in the reading frame). This identification of
more soluble variants of cytochrome P450 enzymes from a library of chi-
meric P450 enzymes will be used here to illustrate the methods utilized for a
successful application of a solubility selection based on a fusion with
chloramphenicol acetyltransferase.
2. Materials
2.1. Solutions
1. Luria-Bertani (LB) broth with appropriate antibiotic as liquid and as agar.
2. Chloramphenicol stock solution of 4 mg/mL in ethanol.
3. Chloramphenicol stock solution of 40 mg/mL in ethanol.
4. Oligonucleotide primers, 10 pmol/µL stock in ddH2O.
5. dNTP mixture, 10 mM each dATP, dCTP, dGTP, dTTP.
2.2. Enzymes
1. Restriction endonucleases with appropriate buffers.
2. T4 DNA ligase, 2000 U/µL (New England Biolabs, Beverly, MA).
3. Pfu DNA Polymerase 2.5 U/µL (Fermentas, Hanover, MD).
4. T4 DNA Polymerase (New England Biolabs).
2.3. Miscellaneous
1. Parental gene in expression vector.
2. Plasmid pACYC184 (New England Biolabs).
3. Escherichia coli competent cells with a minimum competency of 108/µg DNA and
cells with a minimum competency of 107/µg DNA, e.g., XL1-Blue (Stratagene,
La Jolla, CA).
4. 37°C incubator and shaker.
5. Equipment, buffer and chemicals to run and analyze agarose gels.
6. Spectrophotometer or microplate reader to measure bacterial growth via absorp-
tion at 600 nm.

Another Random Scribd Document
with Unrelated Content

And for you, Mr. Crespin? For you? I suppose, in truth, you knew of
this--had some affair of commerce, too, which brought you this way,
on the idea that they would be sure to capture the place.
Ay, I had some idea, I answered, moodily, thinking it mattered
very little what I said now, short of the still great secret that the
galleons were going into Vigo, and never did mean coming into
these more southern regions. This secret I still kept, I say--and for
one reason. It was this, namely, that I thought it very likely that,
even though the fleet under Rooke might be driven back from Cadiz,
they yet had a chance of encountering the galleons making their
way up to Vigo, and, if they did so, I felt very sure that they would
attack those vessels, even in their own hour of defeat. Therefore, I
said nothing about the real destination of the Spanish treasure ships,
though I knew well enough that all hope was gone of my being the
fortunate individual to put my countrymen on their track.
Also, I remembered that that hoary-headed old ruffian, Carstairs,
had spoken of two at least of those galleons as being of importance
to him--and you may be sure that I had no intention whatever of
enlightening him as to anything I knew.
What did the Portuguese picaroon tell you? I asked of Tandy,
now; what information give? And--are they sure of their news?
Oh, very sure, he answered. No doubt about that. No doubt
whatever that we have failed in the attack on Cadiz--abandoned the
siege, gone home. They were too many for us there, and--'tis not
often that it happens, God be praised!--we are beaten.
But why so sure? And are they--these Portuguese--to be
trusted?
What use to tell lies? They are Portuguese, and would have
welcomed a victory.

I shrugged my shoulders at this--then asked again what the
strength of their information was.
To which the captain made reply:
They came in, it seems, early in the month, and called on the
governor to declare for Austria against France, to which he returned
reply that it was not his custom to desert his king, as many of the
English were in the habit of doing, he understood; whereon--the
Duke of Ormond being vexed by such an answer, which, it seems,
did reflect on him--the siege of Port St. Mary's commenced, the
place being taken by our people and being found to be full of
wealth----
Taken and full of wealth! I exclaimed. Yet you say we are
defeated!
Listen, went on Tandy, that was as nothing; for now the
German Prince of Hesse-Darmstadt, who had come too, in the
interests of his Austrian master, interfered, begging of Rooke and
that other not to destroy the town, since it would injure their cause
forever with the Spaniards, and--and--well, the Portygee captain of
that picaroon I spoke says that they were only too willing to fall in
with his desires and retire without making further attempt.
And these are English seamen and soldiers! I muttered furiously.
My God! To turn tail thus!
Ormond agreed not with these views, it seems, Tandy went on,
but he could not outweigh the admirals--and that is all I know,
except that he will perhaps impeach 'em when they get back to
England. And, anyway, they are gone.
And with them, I thought to myself, go all my hopes. The
galleons will get in safe enough; there is nothing for it but to make
back for Holland and tell the earl that I have failed. No more than

that, and my bitterness was great within me at these reflections,
you may be sure.
Tandy, I doubted not, observed these feelings which possessed
me, for a minute later he said--while I observed that in a kindly way
he filled up my glass for me, as I sat brooding with my head upon
my hands by the side of the cuddy table:
I see this touches you nearly, Mr. Crespin, and am grieved. Yet
what will you do now? Since you have missed your chance--I know
not what--will you return with me? If so you are very welcome, and-
-and, he spoke this with a delicacy I should scarce have looked for,
and there will be no--no--passage money needed. La Mouche Noire
is at your service to Rotterdam, or, for the matter of that, to Deal or
London, or where you will. I shall but stay to go in to Lagos for
wood and water, and, perhaps, sell some of my goods, if fortune
serves so far, and then--why then, 'tis back again to Holland or
England to see what may be done. I have the passage moneys of
you and that old ribald aft. For me things might be worse, thank
God!
At first I knew not what answer to make to this kindly, offer--for
kindly it was, since there was according to our compact no earthly
reason whatsoever why he should convey me back again, except as
a passenger paying highly for the service. In truth, I was so sick and
hipped at the vanishing of this, my great opportunity, that I had
recked nothing of what happened now. All I knew was that I had
failed; that I had missed, although through no fault of mine own, a
glorious chance. Therefore I said gloomily:
Do what you will--I care not. I must get me back to Holland
somehow, and may as well take passage there with you as go other
ways. In truth there is none that I know of. Yet, kind as your offer is
to convey me free of charge, it must not be. I cannot let you be at a
loss, and I have a sufficiency of money.

Oh! as for that, 'tis nothing. However, we will talk on this later.
Now let's see for getting into Lagos--there is nothing else to be
done. 'Specially as I must have wood and water.
Then he went away to study his chart and compass, while I
sought my bed again, and, all being perfect silence at this time in
Carstairs' cabin--doubtless he was quite drunk by now!--I managed
to get some sleep, though 'twas uneasy at the best.
In the morning when I again went on deck I saw that we were in
full sail, as I had guessed us to be from the motion of the ship while
dressing myself below; also, a look at the compass box told me we
were running due north--for Lagos. And, if aught could have cheered
the heart of a drooping man, it should have been the surroundings
of this fair, bright morning. It was, I remember well, September 22--
the glistening sea, looking like a great blue diamond sparkling
beneath the bright sun, the white spume flung up forward over our
bows, the equally white sheets above. Also, near us, to add to the
beauty of the morn, the sea was dotted with a-many small craft,
billander rigged, their sails a bright scarlet--and these, Tandy told
me, were Portuguese fishing boats out catching the tunny, which
abounds hereabout. While, away on our starboard beam, were--I
started as I looked at them--what were they?
Three great vessels near together, their huge white sails bellied
out to the breeze, sailing very free; the foam tossed from their
stems, almost contemptuously, it seemed, so proudly did they dash
it away from them; vessels full rigged, and tightly, too; vessels along
the sides of which there ran tier upon tier of gun-ports; vessels also,
from each of whose mastheads there flew a flag--the flag of
England!
What does it mean? I asked Tandy, who strolled along the poop
toward me, his face having on it a broad grin, while his eye drooped
into that wink he used so. What does it mean? They are our own
ships of war; surely they are not chasing us!

Never fear! said he. They are but consorts of ours just now.
Oh! it's a brave talk we have been having together with the flags this
morning. They are of the fleet--are Her Majesty's ships Eagle, Stirling
Castle and Pembroke--and are doing exactly the same as ourselves,
are going into Lagos for water. Also those transports behind, and he
pointed away aft, where half a dozen of those vessels were
following.
The fleet, I gasped, the fleet that has left Cadiz--the great fleet
under Sir George Rooke--and going into Lagos!
Some of them--those you see now on our beam, and the
transports coming up.
And the others, I gasped again, overcome by this joyful news,
the others? What of them?
Oh! they will lie off till these go out with the fresh water casks.
Then for England.
Never, I said to myself. Not yet, at least, and I turned my face
away so that Tandy should not perceive the emotion which I felt
sure must be depicted on it.
For think, only think, what this meant to England--to me!
It meant that I--the only man in the seas around Spain and
Portugal who knew of where the galleons would be, or were by now-
-I who alone could tell them, tell this great fleet, which I had but
lately missed, of the whereabouts of those galleons--had by God's
providence come into communication with them again; meant that
the instant we were in Lagos bay I could go aboard one of those
great warships and divulge all--tell them to make for Vigo, tell them
that it was in their power to deal so fierce a blow to Spain and
France as should cripple them.

I could have danced and sung for very joy. I could have flung my
arms around Tandy's sun-burned and hairy neck in ecstasy, have
performed any act of craziness which men indulge in when a great
happiness falls upon them; nay, would have done any deed of folly,
but that I was restrained by the reflection of how all depended on
me now, and of how--since I was the bearer of so great a piece of
news from so great a man as the Earl of Marlborough--it behooved
me to act with circumspection and decorum. Therefore I calmed
myself, instead of indulging in any transports whatever. I recollect
that I even forced myself to make some useless remark upon the
beauty of the smiling morn; that I said also that I thought La
Mouche Noire was making as good seaway as the great frigates
themselves, then asked coldly and indifferently, with the same desire
for disguise, when Tandy thought we might all be in the bay and at
anchorage.
He glanced up at the sun--he had a big tortoise-shell watch in his
pocket, but, sailor-like, never looked at it during the day, and when
he had the sun for horologe--then leaned over the high gunwale of
the ship and looked between his hands toward the north, and said:
The old castle of Penhas is rising rapidly to view. 'Tis now eight
of the clock. By midday we shall have dropped anchor.
And the frigates? I asked, with a nod toward the queen's great
ships, which still were on our beam, in the same position to us as
before.
About the same. Only they will go in first to make choice of their
anchorage. Then he added: But they will not stay long; no longer
than to fill the casks. Perhaps a day, or till nightfall.
'Twill be long enough for me, I thought. An hour would suffice
to get on board one of them, ask to be taken off and sent to the
admiral's ship to tell my tale. Long enough.

And now I went below again--with what different feelings from
those which possessed me when I went on deck, you may well
suppose--and began hastily to bestow my necessaries, such as they
were, into the bag I had carried behind me on my horse from Venloo
to Rotterdam: a change of linen, some brushes, a sleeping gown and
a good cloak, carried either around me or the bag, if warm and dry
weather, my powder flask and a little sack of bullets for my cavalry
pistols--that was all. Also I counted my pieces, took out my shagreen
bill case and saw that my Lord Marlborough's money drafts were
safe, as well as my commission to the regiment, which must now
serve as a passport and letter of presentation, and I was ready to go
ashore at any moment, and to transfer myself to one of the ships if
they would take me with them after I had told my news, as my Lord
had said I was to demand they should do. Yet, little while enough as
I had been a-doing of these things, 'twas not so quickly finished but
that there was time for an interruption; interruption from Mr.
Carstairs, who, a moment or so after I had been in my cabin, tapped
gently, almost furtively, it seemed to me, upon the door, and on my
bidding him come in--I suspecting very well who it was--put his head
through the opening he had made by pushing it back.
Are we in danger? he asked, while as he spoke, I could not but
observe that he looked very badly this morning--perhaps from the
renewals of his drinkings. His face was all puckered and drawn, and
whiter, it seemed to me, than before; his eyes were hideously
bloodshot--that must, I guessed, be the drink--while the white,
coarse hand with which he grasped the panel shook, I observed.
Danger! I repeated coldly, as well as curtly, for, as you may be
sure, I had come to thoroughly despise, as well as cordially to
detest, this dissolute old man who, besides, had a black and fearful
past behind him, if his feverish wanderings of mind were to be
trusted. Danger! From what?
There are war frigates by us, he whispered. Do you not know?

Yes, I know. But you who have been, it seems, a sailor, should
also know our own flag, I think.
Our own flag! Our English flag!
Can you not see?
They are on the other side of the ship. I cannot see aught
through my port.
Look through mine, then, I answered, pointing to it, and he,
with many courteous excuses for venturing to intrude--he was much
changed now, I thought--went over to my window, and gazed at the
queen's vessels.
True, he said. True. They are English--our--ships. Where could
they come from, do you suppose?
From the Cadiz fleet. And they are going into Lagos, as we are.
And then--do you know where to, then--afterward--noble sir?
Then they will go north.
He drew a long breath at this--I guessed it to be a sigh of
satisfaction at the thought that the English fleet should be going
north, while the galleons, in which he had seemed to be so
concerned, should either be going into, or gone into, Cadiz--as he
supposed. Then he said:
Oh, sir, this is, indeed, good news. For--for--I have business at
Cadiz--very serious business, and--if they had remained here in the
south they might have done much harm to honest traders, might
they not? Do you not think so?
They may do harm elsewhere, I answered, again curtly. And my
brevity caused him to look at me enquiringly.

What harm? What can they do?
Oh! as for that, I said, unable to resist the temptation of
repaying him somewhat for all the discomfort he had caused in the
ship, and also because I so much despised him, as for that, they
might do much. They say there are some galleons about. Supposing
they should meet them. 'Tis a great fleet; it could be fateful to a
weaker one.
Galleons! Galleons about! he repeated--shrieked, almost. Nay!
Nay! Nay! The galleons are safe in Cadiz by now.
Are they? I said, shrugging of my shoulders.
Are they not? And now his face was death itself.
We spoke a ship last night which did not say so, I answered.
No galleons have passed this way, gone in yet.
I almost regretted my words, seeing, a moment later, their effect
on him. For that effect was great--I had nigh written terrible.
He staggered back from the port-hole by which he had been
standing, gazing out at the Pembroke and her consorts, his face
waxy now from the absence of blood; his lips a bluish purple, so that
I could see the cracks in them; his coarse white hands twitching;
and his eyes roving round my cabin lighted on my washing
commode, on which stood the water ewer; then he seized it and the
glass, poured out from one to the other--his hand shook so that the
neck of the vessel clinked a tune upon the rim of the glass--and
drank, yet not without some sort of a murmured apology for doing
so--an apology that became almost a whine.
Not passed this way--not gone in yet? My God! Where are they?
And--and--with that fleet here--here--here--'twixt here and Cape St.
Vincent! Where are they?

Probably coming in now--on their way, I made answer. Or very
near. Then next said, quietly: You seem concerned about this?
Concerned! he wailed. Concerned! I have my fortune, my all--
'tis not much, yet much to me--on board two of the galleons, and--
and--ah! and he clutched at his ruffled shirt front. The English fleet
is there--across their path! My God!
CHAPTER VII.
LAGOS BAY.
Tandy had timed our arrival in the bay with great exactness,
since, soon after midday, both the queen's ships and ourselves had
dropped anchor within it, the former saluting, and being saluted in
return, by some artillery from the crazy old castle that rose above
the shore. And now from those three frigates away went pinnaces
and jolly boats, as well as the great long boats and launches, all in a
hurry to fetch off the water which they needed, while also I could
see very well that from the Pembroke they were a-hoisting
overboard their barge, into which got some of the land officers--as
the sailors call the soldiers--and also a gentleman in black who was,
I supposed, a chaplain.
And then I considered that it was time for me to be ashore, too,
since I knew not how long 'twould take for the ships of war to get in
what they wanted, and to be off and away again; though Tandy told
me I need be in no manner of hurry, since they had let down what
he called their shore anchors, which they would not have done had

they intended going away again in a moment, when they would
have used instead their kedge, or pilot, anchors.
However, I was so impatient that I would not be stayed, and
consequently begged the captain to let me have one of the shore
boats, which had come out on our arrival and were now all around
us, called alongside; and into this I jumped the instant it touched
our ship. My few goods I left on board, to be brought on land when
the captain himself came, which he intended to do later; nor did I
make my farewells to him, since I felt pretty sure we should meet
again shortly, while it was by no means certain that the admiral
would take me with him, after I had delivered my news; but,
instead, might order me to return at once to the earl with some
reply message. Yet I hoped this would not be so, especially since his
Lordship had bidden me see the thing out and then bring him, as
fast as I could make my way back to the Netherlands, my account of
what had been done.
As for that miserable old creature, Carstairs, I clean forgot all
about him; nor even if I had remembered his existence, should I
have troubled to pay him any adieux, for in truth, I never supposed
that I should see him again in this world, and for certain, I had no
desire to do so; yet as luck would have it--but there is no need to
anticipate.
I jumped into the shore boat, I say, as soon as it came alongside
La Mouche Noire, and was quickly rowed into the port, observing as
I went that there was a considerable amount of craft moored in the
bay, many of which had doubtless run in there during the storms of
a night or two ago, while, also, there were some sheltering in it
which would possibly have been lying in other harbors now--and
those, Spanish ones--had it not been for the war and the
consequent danger of attack from the English and Dutch navies in
any other waters than those of Portugal, she being, as I have said,
neutral at present, though leaning to our--the allies'--side. To wit,

there were at this moment some German ships, also a Dane or two,
a Dutchman and a Swedish bark here.
And now I stepped ashore on Portuguese ground, and found
myself torn hither and thither by the most ragged and disorderly
crowd of beggars one could imagine, some of them endeavouring to
drag me off to a dirty inn at the waterside, in front of which there
sat two priests a-drinking with some scaramouches, whom I took to
be Algarvian soldiers, while others around me had, I did believe,
serious intentions on my pockets had I not kept my hands tight in
them. Also--which hearted me up to see--there were many of our
English sailors about, dressed in their red kersey breeches with
white tin buttons, and their grey jackets and Welsh kersey
waistcoats, all of whom were bawling and halloaing to one another--
making the confusion and noise worse confounded--and using fierce
oaths in the greatest good humour. And then, while I stood there
wondering how I should find those whom I sought for, I heard a
voice behind me saying in cheery tones in my own tongue:
Faith, Tom, 'tis an Englishman, I tell you. No doubt about that.
Look to his rig; observe also he can scarce speak a word more of the
language of the country he is in than we can ourselves. Does not
that proclaim him one of us? Except our beloved friends, the French,
who are as ignorant of other tongues as we are, we are the worst.
Let's board him--we are all in the same boat.
Now, knowing very well that these remarks could hardly be
applied to any one but me, I turned round and found close to my
elbow a fat, jolly-looking gentleman, all clad in black, and with a
black scarf slung across him, and wearing a tie-wig, which had not
been powdered for many a day--a gentleman with an extremely red
face, much pitted with the small-pox. And by his side there stood
four or five other gentlemen, who, 'twas easy to see at a glance,
were of my own trade--their gold laced scarlet coats, the aiguillettes
of one, the cockades in all their hats, showed that.

Sir, said the one who had spoken, taking off his own black hat,
which, like his wig, would have been the better for some attention,
and bowing low. I fear you overheard me. Yet I meant no offense.
And, since I am very sure that you are of our country, there should
be none. Sir, I am, if you will allow me to present myself, Mr.
Beauvoir, chaplain of her Majesty's ship, Pembroke. These are my
friends, officers serving under his Grace of Ormond, and of my Lord
Shannon's grenadiers and Colonel Pierce's regiment; whereon he
again took off his hat to me, in which polite salutation he was
followed by the others, while I returned the courtesy.
And now I knew that I had found what I wanted--knew that the
road was open to me to reach the admiral, to tell my tale. I had
found those who could bring me into communication with the fleet;
be very sure I should not lose sight of them now. But first I had to
name myself, wherefore I said:
Gentlemen, I am truly charmed to see you. Let me in turn
present myself. My name is Mervyn Crespin, lieutenant in the
Cuirassiers, or Fourth Horse, and it is by God's special grace that I
have been so fortunate as to encounter you. For, and here I
glanced round at the filthy crowd which environed us, and lowered
my voice a little, I am here on a special mission to your commander
from my Lord Marlborough. Yet I thought I had failed when I heard
you were off and away from Cadiz.
Now, when I mentioned the position which I held in the army all
looked with increased interest at me, and again took off their hats,
while when I went on to speak of my mission from the Earl of
Marlborough there came almost a dazed look into some of their
faces, as though 'twas impossible for them to understand what the
Captain-General of the Netherlands could have to say with the fleet
that had been sent forth from England to Cadiz.
A message to our commander, Mr. Beauvoir said. A message to
our commander. By the Lord Harry, I am afraid 'tis even now a

bootless quest, though. Our commander with all his fleet is on his
way back to England--and pretty well dashed, too, through being
obliged to draw off from Cadiz, I can tell you. I fear you will not see
him this side of Spithead, even if you go with us, who are about to
follow him.
That I was also pretty well dashed at this news needs no telling,
since my feelings may be well enough conceived; yet I plucked up
heart to say:
I do think, if your captain but hears the news I bring, that he will
endeavour to catch the fleet and turn it from its homeward course--
ay, even though he sets sail again to-night without so much as a
drop of fresh water in his casks. 'Tis great news--news that may do
much to cripple France.
Is it private, sir? the chaplain asked. For the ears of the
admirals alone?
Nay, said I; by no means private from English ears; yet, I
continued, with still another glance around, not to be spoken
openly. Is there no room we can adjourn to?
We have been trying ourselves for half an hour to find an inn,
said one of the grenadiers, with a laugh, which swarms not with
vermin of all sorts. Yet, come, let us endeavour again. Even though
there is naught for gentlemen to eat or drink, we may, at least, be
alone and hear this news. Come, let us seek for some spot, and he
elbowed his way through the waterside crowd which still stood
gaping round us, and which, even when we all moved away, hung
on our heels, staring at us as though we were some strange beings
from another world. Also, perhaps, they thought to filch some scrap
of lace or galloon from off our clothes.
Away, vagabonds! What in heaven's name is Portuguese for
'away, vagabonds'? muttered Mr. Beauvoir, making signs to the
beggarly brood, who--perhaps because often our ships put in here

for water, and they were accustomed to seeing the English--held out
their dirty, claw-like hands, and shrieked: Moaney! Moaney! Englase
moaney! Away, I say, and leave us in peace!
And gradually, seeing there was nothing more to be gotten after
one or two of us had flung them a coin or so, they left us to our
devices, so that we were able to stroll along the few miserable
streets which the town possessed; able to observe, also, that there
was no decent inn into which a person, who valued his future
comfort and freedom from a month or so of itching, could put his
foot in safety.
But now we reached a little open spot, or plaza, a place which
had a melancholy, deserted look--there being several empty houses
in this gloomy square--while, on another, we saw the arms of France
stuck up, a shield with a blazing sun upon it,--the emblem of Louis!--
and the lilies on it, also--and guessed it must be the consul's place of
business. And here it seemed to me as if this was as fitting an
opportunity as I should find for making the necessary disclosures--
disclosures which, when these gentlemen had heard them, might
induce them to hurry back to the Pembroke, bring me into
communication with the captain, and lead him to put to sea, in the
hopes of picking up the remainder, and chief part, of the English
fleet, which was but twenty-four hours ahead of them.
Gentlemen, I said, here is a quiet spot--as indeed it was,
seeing that there was nothing alive in this mournful plaza but a few
scraggy fowls pecking among the stones, and a lean dog or two
sleeping in the sun. Let me tell you my news.
Whereupon all of them halted and stood round me, listening
eagerly while I unfolded my story and gave them the intelligence
that the galleons had gone into Vigo, escorted, as the earl had said
while we rode toward Rotterdam, by a large French fleet.

'Fore George, Harry, said Mr. Beauvoir, turning toward the elder
of the officers with him, a captain in Pierce's regiment, but this is
mighty fine news. Only--can it be true? I mean, he went on with a
pleasant bow to me, can it be possible that the Earl of Marlborough
is not mistaken? For, if 'tis true and we can only communicate with
Sir George Rooke and get him back again, 'twill be a fine thing; wipe
out the scandal and hubbub that will arise over our retreat from
Cadiz, go far to save Parliament enquiries and the Lord knows what--
to say nothing of court martials. Humph?
Why should the earl be mistaken in this? asked one of the
others. At least he was right in judging they would not go into
Cadiz.
We must take you at once to Captain Hardy, of our ship, said
the chaplain. 'Tis for him to decide when he has heard your story.
Come, let us get back to the pinnace--no time must be wasted.
With the very greatest will in the world, said I. 'Tis for that I
have travelled from Holland, and, pray God, I have not come too
late. Success means much for me.
Then we turned to go, while the officers attacked me on all sides
for an account of the siege of Kaiserswerth, of which they had not
yet heard full accounts, and we were just leaving the square when
there appeared at the door of the French consul's house a man who,
no sooner did he observe us and our English appearance--which
betrays us all over Europe, I have noticed, though I know not why--
and also the brilliancy of the officers' dress, than he set to work
bowing and grimacing like a monkey; also he began calling out
salutations to us in French, and asking us how the English did now
in the wars? and saying that, for himself, he very much regretted
that France and England had got flying at one another's throats once
more, since if they were not fools and would only keep united, as
they had been in the days of him whom he called le grand roi
Charles Deux, they might rule the world between them; which was

true enough as regarded their united powers (if not the greatness of
that late king of ours), as many other people more sensible than he
have thought.
'Tis a merry heart, said Mr. Beauvoir, smiling on the fantastic
creature as he gibbered and jumped about on his doorstep, while
the others looked contemptuously at him, for we soldiers had but a
poor opinion of the French, though always pleased to fight them; a
joyous blade! Let us return his civility; whereupon he took off his
hat, which courtesy we all imitated, and wished him Good day
politely in his own language.
Ha! you speak French, monsieur, the other said at this; also
you have the bonne mine. English gentlemens is always gentlemens.
Ha! I ver' please see you.--he was himself now speaking half
English and half French. Je vous salue. Lagos ver' triste. I always
glad see gentlemens. Veuillez un verre de vin? C'est Français, vrai
Français! Ver' goot.
'Tis tempting, said the chaplain of the Pembroke, his face
appearing to get more red than before at the invitation. Well, we
can do no harm in having a crack with him. Only--silence,
remember, and he glanced at the officers. Not a word of our
doings--lately, now, or to come.
Never fear, said the eldest. We can play a better game than
that would be, whereon the chaplain, after bowing gracefully to our
would-be host, said in very fair French that, if he desired it, we
would all drink a glass of wine with him--only he feared we were too
many.
Not a jot, not a jot, this strange creature cried, beckoning all of
us into the house and forthwith leading us into a whitewashed room,
in the middle of which was a table with, upon it, a great outre of
wine, bound and supported by copper bands and flanked with a
number of glasses, so that one might have thought he was ever

offering entertainment to others. Then, with great dexterity, he filled
the requisite number of glasses, and, after making us each touch his
with ours, drank a toast.
A la fin de la guerre, he said, after screaming, first, Attention,
messieurs, and rapping on the table with his glass to claim that
attention, à l'amitié incassable de la France et de l'Angleterre.
Vivent, vivent, vivent la France et l'Angleterre, and down his throat
went all the wine.
A noble toast, said Mr. Beauvoir, with a gravity which--I know
not why!--I did not think, somehow, was his natural attribute, a
noble toast. None--be he French or English--could refuse to pledge
that, and, with a look at the others, away went his liquor, too, while
my brother officers, with a queer look upon their faces, which
seemed to express the thought that they scarce knew whether they
ought to be carousing in this manner with the representative of an
enemy, swallowed theirs.
Ha! goot, ver' goot, our friend went on, we will have some
more. And in a twinkling he had replenished the glasses and got his
own up to, or very near to, his lips. And catching a glance of Mr.
Beauvoir's grey eye as he did this, I felt very sure that the reverend
gentleman knew as well as I did, or suspected as well as I did, that
these were by no means the first potations our friend had been
indulging in this morning.
Another toast, he cried now, sacré nom d'un chien! we will
drink more toasts. A la santé--then paused, and muttered: No, no.
I cannot propose that. No. Ce n'est pas juste.
What is not just, monsieur? asked Mr. Beauvoir, pausing with his
own uplifted glass.
Why, figurez-vous, I was going to commit an impolitesse--what
you call a rudesse--rudeness--in your English tongue. To propose the
continued prosperity of France--no! vraiment il ne faut pas ça.

Because you are my guests--I love the English gentlemens always--
and it is so certain--so very certain.
The continued success of France is very certain, monsieur? said
one of the grenadiers, looking darkly at him. You say that?
Sans doute. It cannot be otherwise. On sea and land we must
triumph now--and then--then we shall have la paix incassable. Oh!
yes, now that Chateaurenault is on the seas, we must perforce win
there--win every--everything. And for the land, why----
Chateaurenault is on the seas! exclaimed the chaplain, looking
very grave. And how long has that been, monsieur?
Oh, some time, some time. Then he put his finger to his nose
and said, looking extremely cunning in his half drunkenness. And
soon now he will be free to scour them, turn his attention to you and
the Dutch--curse the Dutch always, they are cochons!--soon, ver'
soon. Just as soon as the galleons are unloaded at Vigo--when we
need protect them no more.
Swift as lightning all our eyes met as the good-natured sot said
this in his boastfulness; then Mr. Beauvoir, speaking calmly again,
said:
So he is protecting them at Vigo, eh? 'Tis not often they unload
there.
Ah, non, non. Not ver' often. But, you see, you had closed Cadiz
against them, so, naturellement, they must go in somewhere.
Naturally. No--not another drop of wine, I thank you.

CHAPTER VIII.
ON BOARD H. M. S. PEMBROKE.
A good snoring breeze was ripping us along parallel with the
Portuguese coast a fortnight later, every rag of canvas being
stretched aloft--foretop gallant royals, mizzentop gallant royals and
royal staysails. For we had found the main body of the fleet at last,
after eleven days' search for them, and we were on the road to Vigo.
Only, should we be too late when we got there? That was the
question!
Let me take up my tale where I left off. Time enough to record
our hopes and fears when that is told.
Our French friend, whose boastfulness had increased with every
drop of Montrâchet he swallowed (and 'twas real good wine, vastly
different, the chaplain, who boasted himself a fancier, said
afterward, from the filthy concoctions to be obtained in that part of
Portugal), had been unable to hold his tongue, having got upon the
subject of the greatness of his beloved France, and the consequence
was that every word he let fall served but to corroborate the Earl of
Marlborough's information and my statement. Nay! by the time he
allowed us to quit his house, which was not for half an hour after he
had first divulged the neighborhood of Chateaurenault and the
galleons, and during which period he drank even more fast and
furious than before, he had given us still further information. For,
indeed, it seemed that once this poor fool's tongue was unloosed,
there were no bounds to his vaunts and glorifications, and had it not
been that he was our host and, also, that every word he said was of
the greatest value to us, I do, indeed, believe that one or other of
the officers would have twisted his neck for him, so exasperating
was his bragging.

Pauvre Angleterre! Pauvre Angleterre! he called out, after we
had refused to drink any more, though he himself still kept on
unceasingly; Poor England. Ah, mon Dieu, what shall become of
her! Beaten at Cadiz----
Retired from Cadiz, if you please, monsieur, one of Pierce's
officers said sternly, because the Dutch ships had runout of
provisions, and because, also, the admiral and his Grace could not
hope to win Spain to the cause of Austria by bombarding their towns
and invading their country. Remember that, sir, if you please.
Oh, la la! C'est la même chose. It matters not. Then the
talkative idiot went on: I hope only that the fleet is safe in England
by now. Ver' safe, because otherwise----
Have no fear, sir, the officer said again, though at a sign from
Mr. Beauvoir, he held his peace and allowed the Frenchman to
proceed.
Ver' safe, because, otherwise, Chateaurenault will soon catch
them--poof! like a mouse in grimalkin's claws. The débarquement
must be over by now--oh yes, over by now!--l'amiral will be free to
roam the seas with his great fleet. Tiens! c'est énorme! There is, for
instance, La Sirène, L'Espérance, La Superbe, Le Bourbon,
L'Enflame--all terrible vessels. Also many more. Le Solide, Le Fort, Le
Prompte--Fichtre! I cannot recall their names--they are fifteen in all.
What can you do against that?
What did we do at La Hogue? asked Mr. Beauvoir quietly.
Ha! La Hogue! Voilà--faute de bassesse--faute de----
Sir, said the chaplain, interrupting, let us discourse no more on
this subject. If we do we shall but get to quarrelling---and you have
been polite and hospitable. We would not desire that to happen. Sir,
we are obliged to you, and he held out his hand.

The strange creature took it--he took all our hands and shook
them; he even seemed about to weep a little at our departure, and
muttered that Lagos was ver' triste. He loved to see any one, even
though a misguided enemy.
And, said Mr. Beauvoir, as we made our way down to the quay
where the pinnace was to take them off, to chatter to them as well
as see them. Forgive him, Lord, he is a madman! Yet, I think,
turning to me, you should be satisfied. He corroborates you, and he
has told us something worth knowing. Fifteen ships of war in all,
eh? whereon he fell a-musing. A great fleet, in truth; yet ours is
larger and we are English. That counts.
It took us a very little while to fetch off to the Pembroke, and on
arriving on board, Mr. Beauvoir instantly sent to know if he could see
the captain, since he brought great news from the shore. The sentry
would not, however, by any means undertake to deliver the
message, since Captain Hardy was now abed, he having been on the
poop all night while the ships were coming in; whereupon Mr.
Beauvoir, saying that the business we were now on took precedence
of sleep and rest, pushed his way into the great cabin and instantly
knocked at the door outside the captain's berth. Also, he called to
him to say that he had news of the galleons and the French
admiral's fleet, and that there waited by his side an officer of the
land forces charged with a message to him from the Earl of
Marlborough.
What! called out the captain as we heard him slip his door open,
after hearing also a bound as he leaped from his bunk to the floor.
What! and a minute after he stood before us, a fine, brave-
seeming gentleman, without his coat or vest on.
What! News of the galleons! Are you the messenger, sir? looking
at me and returning my salute. Quick! Your news; in as few words
as may be.

And in a few words I told him all while he stood there before me,
the chaplain supplementing of my remarks in equally few words by a
description of what the drunken French consul had maundered on
about in his boastings.
And the actions of this captain showed me at once that I was
before one of those sea commanders who, by their daring and
decision, had done so much to make our power on the ocean feared,
notwithstanding any checks such as that of Cadiz, which they might
now and again have to submit to.
Sentry! he called out, running into his cabin to strike upon a
gong by his bedside at the same time. Sentry! And then, when the
man appeared, went on: Send the yeoman of the signals to me at
once. Away with you.
Make signal, he said to the lad, who soon came tumbling down
the companion ladder, his glass under his arm, to Captain Wishart
in the Eagle, and all the captains in the squadron, to repair here for
consultation without loss of time. Up! and waste no moment.
And sure enough--for in Her Majesty's navy they are as prompt as
we of the sister service, if not prompter, since to a sailor, minutes
are sometimes of as much importance as an hour on land--ere a
quarter of an hour had passed the waters of the harbour were
dotted with the barges of the other captains making for our ship,
and, five minutes after that, all were assembled in the great cabin
listening to my tale. And all were at once agreed on what must be a-
doing.
'Tis of vast importance, said Captain Wishart, who I think was
the senior, since he presided, that the admiral be acquainted with
this. 'Tis for him to decide what shall be done when he has heard
the mission on which this officer has come, and heard also the
words of the Frenchman. Now, who has the fastest sailer? You, I
think, Hardy.

True enough, replied that captain, as to speed, I can sail two
feet to every one of all the rest. Yet the head of the ship is
somewhat loose, which may endanger the masts; she is also leaky,
and our food is short. Nevertheless, since the intelligence has been
by good luck brought to my hands I am loth indeed to resign the
honor of finding Sir George.
Nor shall you resign it, exclaimed the other captains. The
chance is yours. Succeed in it and you will get your flag. Hardy, you
must take it.
Enough that I say he took it--had he not done so he would not
have been worth one of his ship's biscuits, the cases of which were,
as it happened, now running extremely low. Took it, too, in spite of
the murmurings of some of his men, who said that they had signed
for the expedition to Cadiz, and for that alone, and, therefore, it was
plainly his duty to return to England. But Captain Hardy had a short
way with such as these--a way well enough known to sailors!--while
to others, with whom he thought it worth while to explain at all, he
pointed out that there must be in the galleons, if they could only get
alongside of them, sufficient prize money for all.
Off we went, therefore, to find the admiral and the main body of
the fleet, while, as luck would have it, there blew from off the
Portuguese coast a soft, brisk wind which took us along on the
course we desired, namely, that in which we supposed and hoped
that Sir George Rooke and the Dutch fleet had gone. All the same, it
was no very pleasant cruise; the food ran lower and lower as day
after day passed and we could not see so much as a topsail
anywhere, until at last we came to two biscuits a day, officers and
men. Then, to make matters worse, the weather came on rough and
boisterous, so that the captain said for sure the fleet would
separate; that though we might find one or two of the number 'twas
scarce likely we should find more, and that even those which we
might by chance come across would possibly not have the Royal
Sovereign, which was Rooke's ship, amongst them.

Briefly, however, we did find them after eleven days, and when
we had begun to give up all hope, and while another terrible fear
had taken possession of our minds--the fear that even should we
come together and proceed to Vigo, we might find the galleons
unloaded and their treasure removed inland. However, as I have now
to tell--and, indeed, as you have read of late in the published
accounts of our attack upon those galleons--that was not to be.
We found, therefore--to hurry on--the two fleets very close to one
another, and no sooner had Sir George communicated the news to
the Dutch admiral, Vandergoes, and to the Duke of Ormond, than it
was determined to at once proceed on the way to Vigo to see if the
galleons were there, and if--above all things--they still had their
goods in them; for, though 'twas like enough that we should destroy
them if we could, and crush Chateaurenault as well, 'twould be but
half a victory if we could not wrench away the spoils from the enemy
and profit by it ourselves.
And now off went two frigates to scout in the neighbourhood of
the Bay of Vigo and see how much truth there was in the
information my Lord Marlborough had sent; and on the night of
October 9, to which we had come by this time, they returned;
returned with the joyful intelligence that the treasure ships were
drawn up as far as possible in a narrow strait in the harbour; that
outside and guarding them, were some twenty French and Spanish
ships of war, and that across the harbour was stretched a huge
boom of masts and spars, protected on either side by great batteries
of cannon.
Also they brought another piece of good news: The galleons, they
thought, were still unloaded.
And still another piece of intelligence, equally welcome: The
frigates had sighted Sir Cloudesley Shovel's fleet in the
neighbourhood of Cape Finisterre, had communicated with him, and

brought back word that as we drew near to Vigo he would combine
with us.
That night we kept high revels on board all our ships--those only
whose duty it was to take the watches being prevented from joining
in the delirium of joy. Casks were broached and healths were drunk,
suppers eaten joyously--we of the Pembroke having now all we
could desire given us from our consorts--songs sung. And, if there
was one who more than others was the hero of the evening, it was
the simple gentleman who had brought the first intimation of the
whereabouts of those whom we now meant to burn, plunder, and
destroy, as the old naval motto runs; the man who now pens these
lines--myself.
Perhaps 'twas no very good preparation for a great fight that, on
the night before the day when we hoped to be gripping French and
Spaniards by the throat, blowing up, burning or sinking their ships,
and seizing their treasures, we should have been wassailing and
carousing deeply all through that night. Yet, remember, we were
sailors and soldiers; we were bent on an errand of destruction
against the tyrant who had crushed and frighted all Europe for now
nigh sixty years; the splendid despot who, but a few months ago,
had acknowledged as King of England one whom every Englishman
had sworn deeply should never sit on England's throne, nor inherit
the crown of his ancestors--if, indeed, the Stuarts were the
ancestors of the youth whom the late James called his son.
For this remembrance we may be forgiven--forgiven for hating
Louis and all his brood--hating him, the tyrant of Versailles, and the
fat booby, his grandson, who aspired to grasp the throne of Spain by
the help of Versailles and its master, that great, evil King of France!
Through that night, I say, we drank and caroused, called toasts to
our good queen, prayed God that we might do her credit on the
morrow, and exalt the name of great Anna? And even the watch,
coming off duty in turns, ran into the main cabin ere they sought

Welcome to our website – the ideal destination for book lovers and
knowledge seekers. With a mission to inspire endlessly, we offer a
vast collection of books, ranging from classic literary works to
specialized publications, self-development books, and children's
literature. Each book is a new journey of discovery, expanding
knowledge and enriching the soul of the reade
Our website is not just a platform for buying books, but a bridge
connecting readers to the timeless values of culture and wisdom. With
an elegant, user-friendly interface and an intelligent search system,
we are committed to providing a quick and convenient shopping
experience. Additionally, our special promotions and home delivery
services ensure that you save time and fully enjoy the joy of reading.
Let us accompany you on the journey of exploring knowledge and
personal growth!
ebookultra.com

Directed Enzyme Evolution Screening and Selection Methods 1st Edition Frances H. Arnold

More Related Content

Similar to Directed Enzyme Evolution Screening and Selection Methods 1st Edition Frances H. Arnold (20)

Recently uploaded (20)

Directed Enzyme Evolution Screening and Selection Methods 1st Edition Frances H. Arnold