Directed Enzyme Evolution Screening and Selection Methods 1st Edition Frances H. Arnold

Visit https://ebookultra.com to download the full version and
explore more ebooks or textbooks
Directed Enzyme Evolution Screening and Selection
Methods 1st Edition Frances H. Arnold
_____ Click the link below to download _____
https://ebookultra.com/download/directed-enzyme-evolution-
screening-and-selection-methods-1st-edition-frances-h-
arnold/
Explore and download more ebooks or textbooks at ebookultra.com

Here are some recommended products that we believe you will be
interested in. You can click the link to download.
Directed Evolution Library Creation Methods and Protocols
1st Edition Frances H. Arnold
https://ebookultra.com/download/directed-evolution-library-creation-
methods-and-protocols-1st-edition-frances-h-arnold/
Enzyme Assays High throughput Screening Genetic Selection
and Fingerprinting 1st Edition Jean-Louis Reymond (Editor)
https://ebookultra.com/download/enzyme-assays-high-throughput-
screening-genetic-selection-and-fingerprinting-1st-edition-jean-louis-
reymond-editor/
Enzyme Engineering Methods and Protocols 1st Edition Linda
Foit
https://ebookultra.com/download/enzyme-engineering-methods-and-
protocols-1st-edition-linda-foit/
Enzyme Technologies Metagenomics Evolution Biocatalysis
and Biosynthesis 1st Edition Wu-Kuang Yeh
https://ebookultra.com/download/enzyme-technologies-metagenomics-
evolution-biocatalysis-and-biosynthesis-1st-edition-wu-kuang-yeh/

Enzyme Kinetics Principles and Methods 2nd Edition Hans
Bisswanger
https://ebookultra.com/download/enzyme-kinetics-principles-and-
methods-2nd-edition-hans-bisswanger/
Enzyme Kinetics Principles and Methods 3rd Edition Hans
Bisswanger
https://ebookultra.com/download/enzyme-kinetics-principles-and-
methods-3rd-edition-hans-bisswanger/
Evolution Through Genetic Exchange 1st Edition Michael L.
Arnold
https://ebookultra.com/download/evolution-through-genetic-
exchange-1st-edition-michael-l-arnold/
Kinase Screening and Profiling Methods and Protocols 1st
Edition Hicham Zegzouti
https://ebookultra.com/download/kinase-screening-and-profiling-
methods-and-protocols-1st-edition-hicham-zegzouti/
Divine Action and Natural Selection Science Faith and
Evolution 1st Edition Joseph Seckbach
https://ebookultra.com/download/divine-action-and-natural-selection-
science-faith-and-evolution-1st-edition-joseph-seckbach/

Directed Enzyme Evolution Screening and Selection
Methods 1st Edition Frances H. Arnold Digital Instant
Download
Author(s): Frances H. Arnold, George Georgiou
ISBN(s): 9781588292865, 158829286X
Edition: 1
File Details: PDF, 4.91 MB
Year: 2003
Language: english

Methods in Molecular BiologyTM
Methods in Molecular BiologyTM
Edited by
Frances H. Arnold
George Georgiou
Directed Enzyme
Evolution
VOLUME 230
Screening and Selection
Methods
Edited by
Frances H. Arnold
George Georgiou
Directed Enzyme
Evolution
Screening and Selection
Methods

Genetic Complementation 3
3
From: Methods in Molecular Biology, vol. 230: Directed Enzyme Evolution: Screening and Selection Methods
Edited by: F. H. Arnold and G. Georgiou © Humana Press Inc., Totowa, NJ
1
Genetic Complementation Protocols
Jessica L. Sneeden and Lawrence A. Loeb
1. Introduction
Genetic selection provides a powerful tool for the study of cellular processes.
It is particularly useful in analyzing protein sequence constraints when used in
conjunction with directed molecular evolution. Our lab has used this approach
to analyze the function of enzymes involved in DNA metabolism, to study the
mutability of protein domains, and to generate mutant proteins possessing prop-
erties different from those selected by natural evolution (1–4). To illustrate the
concept, this chapter discusses genetic complementation of an E. coli strain
defective in expression of the small subunit of ribonucleotide reductase (NrdB).
Wild-type NrdB, in trans, is used to complement the hydroxyurea hypersensi-
tivity of the defective strain. Cloning of the wild-type gene, expression, and
complementation methods are discussed. The principles used for complemen-
tation with ribonucleotide reductase should be applicable to other enzymes for
which a complementation system can be established.
Genetic complementation in bacteria is a powerful method with which to
examine the biological function of a gene product. The concept is illustrated in
Fig. 1. Briefly, a bacterial strain lacking or deficient in gene A is compared to
a wild-type strain. Sometimes conditions can be found under which survival
rates are similar or indistinguishable (permissive conditions). However, under
conditions which restrict growth of strains failing to express gene A, only
strains expressing gene A (in cis or trans) continue to multiply at rates similar
to those under permissive conditions. This approach has been used for decades
in a variety of systems, to obtain useful genetic information about protein func-
tion, inactivating mutations, and protein-protein relationships. With the advent
of new molecular techniques and genome sequencing efforts, it is possible to
disable or inactivate a specific gene and complement the inactivating mutation
in trans, to obtain information about its physiological role.

4 Sneeden and Loeb
In addition to its use in obtaining information about wild-type gene func-
tion, it is also possible to use complementation systems to select for mutant
proteins with properties not selected in nature. One example is the conversion
of a DNA polymerase into an enzyme capable of polymerizing ribonucleotides
(1); another is the development of mutant enzymes highly resistant to antican-
cer agents that can be useful in the application of cancer gene therapy (2–4).
The key advantage of positive genetic selection is that one can grow cells
under restrictive conditions that select for only those gene products that com-
pensate for the deficiency. One can analyze large combinatorial libraries con-
sisting of as many as 107 mutant genes for their ability to display a desired
phenotype. The major limitation to the number of mutants that can be studied
is the transformation efficiency of E. coli (106–108). This is sharply contrasted
with screening methods, which rely on individual, not population, mutant
analysis. Even with the advent of automated screening technologies, the
throughput of this type of selection is much lower than that obtained by posi-
tive genetic selection. A critical feature of genetic selection is the window of
selection, or the phenotypic difference between the wild-type strain vs the strain
carrying the deficiency. When complementing the deficiency in trans, a differ-
ence of >103 is preferable, but a lower differential may be acceptable.
Prokaryotic selection systems offer a number of advantages over selection in
eukaryotes. Transformation efficiencies, hence the ability to screen larger num-
Fig 1. Schematic drawing of bacterial genetic complementation, where comple-
mentation is measured in a colony-forming assay.

bers of mutants, are much higher in prokaryotes; prokaryotic genomes are less
complex, yet it is frequently possible to complement deficiencies using mamma-
lian gene products; and the cell division times of prokaryotes are much shorter
than for eukaryotes. Nevertheless, we have screened large libraries using genetic
complementation of yeast (5), and it should be feasible to use mammalian cells
in culture for analysis of libraries containing 104–105 mutant genes.
This chapter will focus on the cloning and expression of Escherichia coli
NrdB to illustrate complementation methods. NrdB encodes the E. coli small
subunit of ribonucleotide reductase. It catalyzes the removal of the 2'-hydroxyl
of ribonucleoside diphosphates, generating deoxyribonucleoside diphosphate
precursors for use in DNA synthesis. This gene has been extensively studied
(6–9) and its sequence is known (10). NrdB is cloned from E. coli genomic
DNA, and placed into a suitable expression vector. It is then transformed into a
strain of E. coli, KK446 (7), which is deficient in NrdB; complementation is
measured by the ability of NrdB in trans to complement the hydroxyurea
hypersensitivity of KK446.
2. Materials
1. Plasmids TOPO-TA (Invitrogen) and pBR322.
2. E. coli genomic DNA, from strain carrying wild-type NrdB.
3. Primers flanking the gene of interest.
4. PCR components: Taq polymerase; dNTPs; Taq buffer, 1X concentration: 10 mM
Tris-HCl, pH 9.0 at 25°C, 50 mM KCl, 0.1% Triton X-100.
5. E. coli strain with appropriate gene defect, here KK446 (6) which encodes a wild-
type NrdB that is presumably defective in wild-type expression levels. Obtained from
E. coli Genetic Stock Center at Yale (see Website: http://cgsc.biology.yale.edu/).
6. Restriction enzymes and buffers.
7. Agarose gel electrophoresis equipment.
8. Luria-Bertani (LB) medium.
9. Hydroxyurea.
3. Methods
The methods described outline construction of the plasmid containing the
gene of interest (NrdB) and procedures to establish and test for complementa-
tion in E. coli.
3.1. Cloning of NrdB
The methods described in Subheading 3.1. outline the cloning and expres-
sion of NrdB, which can be generalized for use in cloning a variety of genes.
The methods include 1) the design of PCR primers and PCR amplification of
the gene, 2) cloning into Topo-TA vector, 3) verification by restriction map-
ping and sequence analysis, and 4) subcloning into pBR322 vector.

6 Sneeden and Loeb
3.1.1. PCR of NrdB
Since the sequence of NrdB is known, it is possible to design primers for
PCR amplification of the gene directly from E. coli genomic DNA (see Note 1).
Ideally, the primers should flank the gene directly upstream and downstream of
the coding sequence. Cloning vectors often contain a multiple cloning site
(MCS) that is located within the coding frame of LacZ, allowing for blue/
white screening. Therefore, design of primers should include a stop codon, fol-
lowed by a Shine-Dalgarno sequence for ribosomal entry approx 8 nucleotides
upstream of the initiator methionine (see Fig. 2). Because subcloning is often
necessary, it is useful to include in the primer unique restriction sites on both
ends of the gene, flanking the 5' stop codon and Shine-Dalgarno sequence
upstream of the coding region (Fig. 2A).
PCR is carried out by standard molecular techniques. Briefly, add 10–50 ng
E. coli genomic DNA, 10 mM Tris-HCl, pH 9.0 at 25°C, 50 mM KCl, 0.1%
Triton X-100, 250 µM (total) dNTP mix (dGTP, dCTP, dATP, dTTP), 1 mM
MgCl2, 20 pmoles each primer, and 2.5 U Taq DNA polymerase in a total
volume of 50 µL H2O (see Note 2). Amplification is for 30 cycles of PCR. The
length of the product should be determined by electrophoresis on an agarose
gel. Ideally the product should contain a single band of the desired length
(Fig. 2B) (see Note 3).
3.1.2. Cloning into TOPO-TA Vector (see Note 4)
After the desired product has been verified by agarose gel analysis, it is
cloned into the TOPO-TA vector. The TOPO vectors have been developed by
Invitrogen to contain covalently attached topoisomerases on each end of a lin-
earized vector (Fig. 2C). This obviates the need for ligation cloning and gives
a reasonably high insertion rate (Invitrogen).
1. Mix 5 µL of unpurified PCR product (see Note 5) with 1 µL TOPO vector and
1 µL of 1X salt buffer (provided by Invitrogen).
2. Incubate 5 min at room temperature.
3. Transform into XL-1 (or your favorite strain) using standard methods (11).
4. Plate onto LB agar containing appropriate antibiotic selection.
5. Select single colonies and grow overnight in LB medium.
6. Isolate plasmid DNA by standard methods (11).
7. Check for incorporation of product of desired length by restriction analysis (11).
8. Verify construct by sequence analysis (11).
At this step, it is desirable to verify expression of NrdB in the TOPO vector,
which is capable of expression under the lac promoter. However, expression of
NrdB in a high-copy vector is toxic, as may be other genes. In the case of
NrdB, it can be subcloned into a medium-copy vector (pBR322) to alleviate
this problem (see Note 6).

3.1.3. Subcloning into pBR322
Digest TOPO plasmid containing NrdB using restriction enzymes that cleave
at flanking EcoRI sites. Clone into pBR322 using standard molecular biologi-
cal methods (11).
Fig 2. Schematic representation of (A) primer design for PCR cloning of genes
from genomic DNA, (B) PCR product obtained added to Topo-TA vector, and (C)
Topo-TA vector with NrdB, after transformation.

8 Sneeden and Loeb
3.2. Expression and Complementation
3.2.1. Expression of NrdB
When verifying expression of a protein where an antibody is available,
Western blots are preferable (11). Since no commercial antibody is available
for E. coli NrdB, verification of expression can be confirmed via complemen-
tation of an E. coli strain that is deficient in NrdB expression and displays
hypersensitivity to hydroxyurea (see Note 7). A similar functional comple-
mentation may be required for verification of other genes.
3.2.2. Complementation
Complemenation of sensitivity of E. coli strain KK446 to hydroxyurea is
accomplished by expression of NrdB. This strain was described in 1976 by
Fuchs and Karlstrom and the defect mapped to 48 min, the region encoding
NrdB, the small subunit of ribonucleotide reductase (7). Hydroxyurea is a radi-
cal scavenger that removes the stable tyrosyl radical on the small subunit of
ribonculeotide reductase, inactivating the enzyme. The defect was not further
characterized, but was complemented by the authors with wild-type NrdB (7).
The ability of NrdB to complement hydroxyurea hypersensitivity of KK446
can be tested as follows:
1. Transform plasmids containing NrdB into KK446 cells via electroporation (10).
2. As a control, separately transform plasmid only into KK446 cells.
3. Isolate plasmids based on carbenicillin resistance, and verify the construct by
restriction digestion analysis.
4. Inoculate KK446 only, KK446 bearing plasmid only, KK446 bearing plasmid
encoding NrdB, and XL-1 blue cells (or other strain with wild-type NrdB expres-
sion) into LB medium and grow overnight at 37°C.
5. Dilute each culture 1:100 into fresh LB medium and grow to 0.6 OD.
6. Plate onto 0, 0.25, 0.5, and 1.0 mg/mL hydroxyurea-containing LB plates and
grow overnight at 37°C.
7. Count colonies and determine differences in sensitivity to hydroxyurea.
Complementation is scored as a function of the colony-forming efficiency
of plasmids with and without NrdB, as compared to KK446 without plasmid
and XL-1 blue cells without plasmid (see Note 8). It is often not possible to
obtain an isogenic strain which differs only by the one gene defect. Estimates
using different cell strains may be used in this case.
4. Notes
1. This protocol is limited to cloning of genes with known sequence. It is important
to note that often multiple sequences of a given gene exist in sequence databases
and they are not always identical. Check different submitted sequences against
each other, to avoid mistakes in primer design.

2. This procedure uses Taq DNA polymerase which creates an 3' overhanging
adenine. It is also feasible to use polymerases which do not possess this func-
tion, and then to blunt-end clone the PCR product into a vector. However, this
will decrease transformation efficiency.
3. NrdB is approx 1200 bp, which is relatively easy to PCR clone. For genes longer
than 2.5 kb, optimization of PCR may be necessary to obtain a single gene prod-
uct. It may also be necessary to gel purify the band of interest in the event that a
single band is not obtained.
4. This method uses the TOPO-TA expression vector from Invitrogen, although
other TA vectors exist.
5. Unpurified PCR product gives a higher transformation rate than purified product,
likely because of the favorable salt concentration in the PCR mix. If the desired
product has been gel purified, a higher transformation rate can be obtained by
adding the product to a 50 µL tube containing the standard PCR reaction mix.
6. Although NrdB has been extensively studied, it is not reported to be toxic at high
expression levels. It is important to remember when establishing a complementa-
tion system that stability of the construct must be verified. When working with a
potentially toxic gene, high expression levels should be avoided. In addition, the
lac promoter is widely used in common expression vectors, but is leaky and cannot
be fully suppressed. For our purposes, expression in a medium-copy vector under
the lac promoter was sufficient to alleviate toxicity. It may be necessary in some
cases to express in low-copy vector under a more tightly controllable promoter.
7. It is important to note that expression verified by complementation of a pheno-
type, even in a strain where the gene defect is known, while compelling evidence,
is not absolute proof of expression of an active protein. Western blots are pre-
ferred where an antibody is available.
8. A critical feature of complementation, especially when used to select for mutant
proteins, is the difference in phenotype between cells with and without the com-
plementing gene. In general at least 1000-fold difference is preferable, although
results may be obtained with somewhat smaller phenotypic differences.
References
1. Patel, P. H. and Loeb, L. A. (2000) Multiple amino acid substitutions allow DNA
polymerases to synthesize RNA. J. Biol. Chem. 275, 40,266–40,272.
2. Encell, L. P. and Loeb, L. A. (1999) Redesigning the substrate specificity of
human O(6)-alkylguanine-DNA alkyltransferase. Mutants with enhanced repair
O(4)-methylthymine. Biochemistry 38, 12,097–12,103.
3. Encell, L. P., Landis, D. M., and Loeb, L. A. (1999) Improving enzymes for can-
cer gene therapy. Nat. Biotechnol. 17, 143–147.
4. Landis D. M., Heindel C. C., and Loeb, L. A. (2001) Creation and characteriza-
tion of 5-fluorodeoxyuridine-resistant Arg50 loop mutants of human thymidylate
synthase. Cancer Res. 61, 666–672.
5. Glick, E., Vigna, K. L., and Loeb, L. A. (2001) Mutations in human DNA poly-
merase eta motif II alter bypass of DNA lesions. EMBO J. 20, 7303–7312.

10 Sneeden and Loeb
6. Reichard, P., Baldesten, A., and Rutberg, L. (1961) Formation of deoxycytidine
phosphates from cytidine phosphates in extracts from Escherichia coli. J. Biol.
Chem. 236, 1150–1157.
7. Fuchs, J. A. and Karlstrom, H. O. (1976) Mapping of nrdA and nrdB in Escheri-
chia coli K-12. J. Bacteriol. 128, 810–814.
8. Fontecave, M. (1998) Ribonucleotide Reductases and Radical Reactions. Cell.
Mol. Life Sci. 54, 684–695.
9. Jordan, A. and Reichard, P. (1998) Ribonucleotide Reductases. Annu. Rev.
Biochem. 67, 71–98.
10. Carlson, J., Fuchs, J. A., and Messing, J. (1984) Primary structure of the Escheri-
chia coli ribonucleoside diphosphate reductase operon. Proc. Natl. Acad. Sci. USA
81, 4294–4297.
11. Sambrook, J. and Russell, D. W. (2001) Molecular Cloning: A Laboratory
Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

DNA Polymerase Complementation in E. coli 11
11
2
Use of Pol I-Deficient E. coli for Functional
Complementation of DNA Polymerase
Manel Camps and Lawrence A. Loeb
1. Introduction
The E. coli JS200 strain carries a temperature-sensitive allele of DNA
polymerase I that renders this strain conditional lethal. Growth under restric-
tive conditions is restored by small amounts of DNA polymerase activity.
Even mutants with greatly reduced (1–10% of wild-type) catalytic activity or
distantly-related polymerases of bacterial, eukaryotic, or viral origin effec-
tively complement JS200 cells. The versatility of this complementation sys-
tem makes it advantageous for selection of active polymerase mutants, for
screening of polymerase inhibitors, or for screening of mutants with altered
properties. Here we describe complementation of JS200 cells with the wild-
type E. coli DNA polymerase I to illustrate such functional polymerase
complementation.
Polymerases catalyze the template-directed incorporation of nucleotides
or deoxynucleotides into a growing primer terminus. DNA polymerases and
reverse transcriptases share a common structure and mechanism of catalysis
in spite of low sequence conservation (1). As central players in replication,
repair, and recombination, DNA polymerases have been intensely studied
since the early days of molecular biology. Errors in nucleotide incorporation
have been recognized as significant sources of mutations, contributing to the
generation of genetic diversity, of which HIV reverse transcriptase is a dra-
matic example. Polymerase errors may also contribute to the genetic insta-
bility that characterizes certain disorders, such as cancer and trinucleotide
expansion diseases. Finally, polymerases are finding an ever-growing num-
ber of applications in sequencing, amplification, mutagenesis, and cDNA
library construction.

12 Camps and Loeb
E. coli DNA polymerase I is encoded by the polA gene. It has two relatively
independent functional units: a polymerase (with a 3'5' exonuclease proof-
reading domain), and a separate 5'3' exonuclease subunit. In vitro, the coor-
dinated action of these two subunits results in efficient nick translation. In vivo,
pol I is involved in lagging-strand synthesis during chromosomal replication
and in DNA excision repair. Pol I mediates the processing of Okazaki frag-
ments by extending from the 3' end of the RNA primer and by excising the
RNA primer from the 5' end of the downstream fragment. Removal of all resi-
dues of the RNA primer is essential for joining of Okazaki fragments (2). Simi-
larly, the coordinated action of polymerase and 5'3' exonuclease activities on
an RNA primer initiates ColE1 plasmid replication (3). On the DNA repair
front, pol I catalyzes fill-in reactions in base and nucleotide excision repair. In
the latter, pol I also contributes to releasing the oligonucleotide fragment and
UvrC protein from the postincision complex (4,5). Pol I expression is constitu-
tive, with an estimated 400 molecules/cell. It seems, however, that only a frac-
tion of these molecules are engaged in lagging strand synthesis catalysis under
normal circumstances, which would leave a substantial cellular complement
available for DNA excision repair.
Pol I is not essential for growth in minimal medium, although pol I-deleted
strains show slower growth rates. In rich medium, pol I is essential, presum-
ably because cells are unable to complete lagging-strand synthesis before the
next round of replication (6). Expression of either of the polymerase I subunits
restores growth in rich media (6), implying that other enzymes are able to sub-
stitute for pol I in lagging-strand synthesis. In agreement with pol I’s partial
redundancy in vivo, pol A shows epistasis with a number of genes involved in
DNA repair and recombination, including rnhA (7), polC (8,9), uvrD (10), recA
(11–13), and recB (11).
PolA12 encodes a misfolding form of pol I that is a defective in the coordi-
nation between the polymerase and 5'-exonuclease activities (14). PolA12 also
exhibits reduced temperature stability, and in vivo, its polymerase and 5'-exo-
nuclease activities decrease 4-fold at 42°C (14). In combination with recA- and
recB-inactivating mutations, polA12 is lethal in rich medium (11). Surprisingly,
RecA-mediated constitutive expression of the SOS response also renders
polA12 cell growth sensitive to high temperature (13). The polA12 recA718
temperature-sensitive strain (JS200 strain) probably falls into this category (9).
RecA718 is a sensitized allele of recA (15) that is likely activated as a result of
slow Okazaki fragment joining under conditions that are restrictive for polA12.
The combination of a 5'3' exonuclease- inactivating mutation and constitu-
tive SOS expression is viable under restrictive conditions (13), however, and
expression of polymerase activity alone (without 5'3' exonuclease) relieves
polA12 recA718 conditional lethality (9). These two observations point to poly-

merase as the rate-limiting activity in pol I-deficient, SOS-induced cell condi-
tional lethality. Complementing polymerase activity can be provided even by
distantly-related polymerases of bacterial, eukaryotic, or viral origin, although
polymerase overexpression may be required for complementation in some
cases (9,17). Examples of complementing polymerases include E. coli pol III
α subunit (9), Thermus aquaticus (Taq) polymerase (16), rat pol β (17), and
HIV and MLV reverse transcriptases (18). JS200 complementation by some of
these polymerases occurs even after partial inactivation by mutagenesis (19–
22) (the threshold being 10% of wild-type activity for Taq and pol I, based on
colony formation). With its great versatility, the polA12 recA718 complemen-
tation system in E. coli has been used for selection of active mutants of Thermus
aquaticus (Taq), and E. coli pol I (19,21,22), pol β (20), and HIV reverse tran-
scriptase (23). These mutants were further screened for altered properties. A
TrpE65 ochre mutation was used as a secondary screen for pol β mutators (24).
Finally, expression of low-fidelity pol I mutants in this system achieved in
vivo mutagenesis with some specificity for a ColE1 plasmid (25).
In the following chapter we present a protocol for functional complementa-
tion of polA12 recA718 cells by E. coli DNA polymerase I. This protocol can
be easily adapted for complementation by other DNA polymerases, for muta-
tor screening and for in vivo mutagenesis.
2. Materials
1. JS200 (recA718 polA12 (ts) uvrA155 trpE65 lon-11 sulA) competent cells see
Notes 1–3).
2. pHSG576 empty vector control (see Note 4) and pECpol I construct containing
the E. coli pol I gene (or another polymerase) under the tac promoter (see Note 5)
in water solution (from mini, midi, or maxiprep).
3. LB (Luria-Bertani) medium.
4. Tetracycline solution: 12.5 mg/mL stock in 50% ethanol, light-sensitive, keep
at –20°C.
5. Chloramphenicol solution: 30 mg/mL stock in 100% ethanol, keep at –20°C.
6. Isopropyl-β-D-1-thiogalactopyranoside (IPTG) solution: 100 mM stock in water,
sterile-filtered, keep at –20°C.
7. 15-mL plastic, 1.5-mL eppendorf tubes, and racks to hold them.
8. Biorad Gene pulser ™ electroporator and 0.2-cm electroporation cuvets.
9. Sterile toothpicks.
10. LB tetracycline (12 µg/mL) and LB tetracycline (12 µg/mL) chloramphenicol
(30 µg/mL) plates.
11. Petri dish turntable, 10 µL inoculation loop, and ethanol for flaming.
12. Bunsen burner.
13. 30 and 37°C incubators.
14. 30°C shakers.

14 Camps and Loeb
3. Methods
1. Combine 40 µL (5 × 109 cells) competent cells with 1 µL of pHSG576 or pECpolI
construct in electroporation cuvets.
2. Electroporate the cells (at 400 Ω, 2.20 V, and 2.5 µFD).
3. Resuspend in 1 mL LB (see Note 6) immediately after electroporation and trans-
fer to a 15-mL plastic tube.
4. Place in a shaker at 30°C for 1 h (see Note 7).
5. Plate a 1:0 and a 1:103 dilution of cells (to ensure single colony formation) on LB
tetracycline chloramphenicol plates (see Note 6).
6. Incubate at 30°C for 24 h (see Note 7).
7. Pick at least two single colonies from each electroporation into 5 mL LB with
tetracycline (12 µg/mL) and chloramphenicol (30 µg/mL) (see Note 8).
8. Grow overnight in a 30°C incubator (without shaking). The next morning vortex
briefly and shake at 30°C until the culture reaches mid-exponential phase (1– 2 h)
(see Note 7).
9. Test for temperature sensitivity in rich medium: Inoculate a spiral of increasing
dilution in two LB agar plates with tetracycline and chloramphenicol (see Note 8).
One of the plates needs to be pre-warmed at 37°C and the other plate pre-warmed
at 30°C (see Note 9). This is done placing the loop of the inoculation rod (~ 2 ×
106 cells) in the center of a plate and moving the loop toward the periphery as the
plate spins. Incubate 1 plate at 37°C (see Note 10) and the duplicate plate at 30°C
for 24–30 h (see Notes 11 and 12). Some growth in the center of the plate (where
there is a high cell density) is expected, but there should be no growth in low cell
density areas (see Fig. 1, Note 13).
4. Notes
1. JS200 cells were originally designated SC18-12 (9) and are tetracycline-resistant.
2. The uvrA155 genotype means JS200 cells are deficient in nucleotide excision
repair. This might contribute to the relative deficiency in polymerase (compared
to 5'3' exonuclease) activity in these cells, as 5'3' exonuclease activity has a
prominent role in nucleotide excision repair (26).
3. Competent cells can be prepared as follows: single JS200 colonies growing on
LB plates with appropriate antibiotic selection (in this case, 12.5 µg/mL tetracy-
cline) are picked into a flask containing 50 mL of LB plus antibiotic and grown at
30°C overnight without shaking (see Notes 6 and 7). The next morning, cells are
shaken for 1 h at 30°C. All 50 mL of bacterial culture are transferred to a flask
containing 450 mL LB with antibiotic, and left in the 30°C shaker for 3–4 h (to an
OD600 of 0.5–1). Cells are chilled on ice for 20 min, pelleted in a Sorval® RC 5B
plus centrifuge (10 min at 6000 rpm 4°C), and washed twice in 10% glycerol.
The last spin is performed in bottles with conical bottom for easy removal of the
supernatant in a Sorval® RC 3B centrifuge (10 min at 4000 rpm 4°C). The pellet
is resuspended in ~2 mL 10% glycerol, stored in 120 µL aliquots, and quick-
frozen in dry ice.

4. pHSG576 is a low-copy plasmid encoding chloramphenicol resistance (27). This
plasmid carries the pol I-independent pSC100 origin of replication (28). Provid-
ing the test polymerase in a pol I-independent vector is of relevance, as mainte-
nance of a ColE1 plasmid in JS200 cells under restrictive conditions would
compete for residual or redundant pol I activity and effectively increase the
threshold for functional complementation. On the other hand, increasing the
threshold for complementation might be desirable in some cases (for example to
minimize the likelihood of reversion [see Note 6]).
5. pECpol I construction: the entire open reading frame of the pol I gene (polA) of
E. coli DH5α was amplified with primers 5'-ATATATATAAGCTTATGGTT
CAGATCCCCCAAAATCCACTTATC-3' (initiating methionine in bold) and
5'-ATATATAATGAATTCTTAGTGCGCCTGATCCCAGTTTTCGCCACT
(stop codon in bold) and cloned into the HindIII EcoRI sites of the pHSG576
polylinker using HindIII EcoRI adapters (italics). This places the pol I gene
under transcriptional control of the tac promoter.
6. Nutrient Broth has been used instead in the work reported in the literature (17–
19,21). In our hands, growth in LB appears to be similar in the rates of loss of
temperature-sensitivity or in the strength of the conditional lethal phenotype.
7. Pol I-deficient strains in combination with alterations in RecA, RecB or UvrD
are easily overgrown by suppressors or revertants under non-permissive condi-
tions (10). This problem is less severe for polA12 recA718 double mutants (9),
but revertants/suppressors still occur at a detectable frequency (about 1 in 500
after overnight culture). To avoid overgrowth by these revertants, we maintain
conditions as permissible as possible, growing the cultures at 30°C, and keeping
the cell density to less than OD600 = 1. The temperature sensitivity of these cells
should be checked periodically (see step 9 in Subheading 3.). Most of the cells
that lose temperature sensitivity appear to be suppressors rather than simple
revertants and often exhibit a milder but not wild-type phenotype (Tsai, C.-H.,
personal communication and our own observations). In the polA12 uvrE502 back-
ground one apparent revertant was found to be an intragenic suppressor (10).
8. Overexpression of the polymerase can be induced at this point by adding 1 mM
IPTG to the medium. IPTG induction of transcription was required for comple-
mentation in the case of pol III α subunit and pol β (9,17).
9. Pre-warming of the plates is critical. The temperature-sensitive phenotype of
JS200 cells (see Fig. 1) and that of other polA12 recA, polA12 recB, or polA12
uvrD derivatives is only apparent in isolated cells. These cells lose viability
quickly (2–4 h) after switching to the restrictive temperature, at least in liquid
culture (11,13). In consequence, for tests or selections that depend on conditional
lethality it is essential that the plates achieve the restrictive temperature before
the JS200 cells plated on them reach the local cell density that allows survival.
10. Initially 42°C was chosen as the restrictive temperature for functional comple-
mentation in JS200 cells (9,17,20,29). We have since switched to 37°C
(16,19,22,23,25), as we still see strong conditional lethality at this temperature
(see ref. 18 for a comparison).

16 Camps and Loeb
11. In cases of partial functional complementation plates can be incubated for longer
periods of time, up to 48 h, to detect growth at 37°C (17–19).
12. The plates should be placed upside-down in the incubator to prevent excessive
evaporation from the agar.
13. Alternatively, the temperature-sensitivity assay can de done in a quantitative man-
ner by plating approx 103 cells (in duplicate or triplicate) instead of inoculating
them. Briefly, add 100 µL of a dilution containing 104 cells/mL to 4 LB agar plates
with tetracycline and chloramphenicol, 2 of them pre-warmed to 30°C, and the
other 2 pre-warmed to 37°C. Spin the plate on the turntable while evenly spreading
the bacterial dilution with a glass rod (previously flamed in ethanol). Place the
duplicate plates in the 30°C and 37°C incubators, and incubate for 24–30 h. No
more than 2 or 3 cells should grow at 37°C for every 1000 cells that grow at 30°C.
Acknowledgments
Support for this manuscript was from NIH (CA78885). We would like to
acknowledge the members of the Loeb lab for support and helpful discussions.
Special thanks to Drs. Premal Patel and Akeo Shinkai for generously sharing
their expertise in the system and to Ern Loh for sharing graphic material.
References
1. Patel, P. H. and Loeb, L. A. (2001) Getting a grip on how DNA polymerases
function. Nat. Struct. Biol. 8, 656–659.
Fig. 1. Spiral assay for temperature sensitivity. PolA12 rec718 cells were plated
and grown as described in Subheading 3., step 9. On the left, growth at 30°C, on the
right growth at 37°C (Modified from Ern Loh, unpublished).

2. Funnell, B. E., Baker, T. A., and Kornberg, A. (1986) Complete enzymatic repli-
cation of plasmids containing the origin of the Escherichia coli chromosome. J.
Biol. Chem. 261, 5616–5624.
3. Itoh, T. and Tomizawa, J. (1979) Initiation of replication of plasmid ColE1 DNA
by RNA polymerase, ribonuclease H, and DNA polymerase I. Cold Spring Harb.
Symp. Quant. Biol. 43, 409–417.
4. Husain, I., Van Houten, B., Thomas, D. C., Abdel-Monem, M., and Sancar, A.
(1985) Effect of DNA polymerase I and DNA helicase II on the turnover rate of
UvrABC excision nuclease. Proc. Natl. Acad. Sci. USA 82, 6774–6778.
5. Caron, P. R., Kushner, S. R., and Grossman, L. (1985) Involvement of helicase II
(uvrD gene product) and DNA polymerase I in excision mediated by the uvrABC
protein complex. Proc. Natl. Acad. Sci. USA 82, 4925–4929.
6. Joyce, C. M. and Grindley, N. D. (1984) Method for determining whether a gene
of Escherichia coli is essential: application to the polA gene. J. Bacteriol. 158,
636–643.
7. Cao, Y. and Kogoma, T. (1993) Requirement for the polymerization and 5'3'
exonuclease activities of DNA polymerase I in initiation of DNA replication at
oriK sites in the absence of RecA in Escherichia coli rnhA mutants. J. Bacteriol.
175, 7254–7259.
8. Banerjee, S., Kim, H. Y., and Iyer, V. N. (1996) Use of a DNA polymerase III
bypass mutant of Escherichia coli, pcbA1, to isolate potentially useful mutations
of a complex plasmid replicon. Plasmid 35, 58–61.
9. Witkin, E. M. and Roegner-Maniscalco, V. (1992) Overproduction of DnaE pro-
tein (alpha subunit of DNA polymerase III) restores viability in a conditionally
inviable Escherichia coli strain deficient in DNA polymerase I. J. Bacteriol. 174,
4166–4168.
10. Smirnov, G. B. and Saenko, A. S. (1974) Genetic analysis of a temperature-resis-
tant revertant of the conditional lethal Escherichia coli double mutant polA12
uvrE502. J. Bacteriol. 119, 1–8.
11. Monk, M. and Kinross, J. (1972) Conditional lethality of recA and recB deriva-
tives of a strain of Escherichia coli K-12 with a temperature-sensitive deoxyribo-
nucleic acid polymerase I. J. Bacteriol. 109, 971–978.
12. Gross, J. D., Grunstein, J., and Witkin, E. M. (1971) Inviability of recA-deriva-
tives of the DNA polymerase mutant of De Lucia and Cairns. J. Mol. Biol. 58,
631–634.
13. Fijalkowska, I., Jonczyk, P., and Ciesla, Z. (1989) Conditional lethality of the
recA441 and recA730 mutants of Escherichia coli deficient in DNA polymerase I.
Mutat. Res. 217, 117–122.
14. Uyemura, D. and Lehman, I. R. (1976) Biochemical characterization of mutant
forms of DNA polymerase I from Escherichia coli. I. The polA12 mutation. J.
Biol. Chem. 251, 4078–4084.
15. McCall, J. O., Witkin, E. M., Kogoma, T., and Roegner-Maniscalco, V. (1987)
Constitutive expression of the SOS response in recA718 mutants of Escherichia
coli requires amplification of RecA718 protein. J. Bacteriol. 169, 728–734.

18 Camps and Loeb
16. Patel, P. H. and Loeb, L. A. (2000) Multiple amino acid substitutions allow DNA
polymerases to synthesize RNA. J. Biol. Chem. 275, 40,266–40,272.
17. Sweasy, J. B. and Loeb, L. A. (1992) Mammalian DNA polymerase beta can sub-
stitute for DNA polymerase I during DNA replication in Escherichia coli. J. Biol.
Chem. 267, 1407–1410.
18. Kim, B. and Loeb, L. A. (1995) Human immunodeficiency virus reverse tran-
scriptase substitutes for DNA polymerase I in Escherichia coli. Proc. Natl. Acad.
Sci. USA 92, 684–688.
19. Suzuki, M., Baskin, D., Hood, L., and Loeb, L. A. (1996) Random mutagenesis of
Thermus aquaticus DNA polymerase I: concordance of immutable sites in vivo
with the crystal structure. Proc. Natl. Acad. Sci. USA 93, 9670–9675.
20. Sweasy, J. B. and Loeb, L. A. (1993) Detection and characterization of mamma-
lian DNA polymerase beta mutants by functional complementation in Escheri-
chia coli. Proc. Natl. Acad. Sci. USA 90, 4626–4630.
21. Patel, P. H. and Loeb, L. A. (2000) DNA polymerase active site is highly mutable:
evolutionary consequences. Proc. Natl. Acad. Sci. USA 97, 5095–5100.
22. Shinkai, A., Patel, P. H., and Loeb, L. A. (2001) The conserved active site motif A
of Escherichia coli DNA polymerase I is highly mutable. J. Biol. Chem. 276,
18,836–18,842.
23. Kim, B., Hathaway, T. R., and Loeb, L. A. (1996) Human immunodeficiency
virus reverse transcriptase. Functional mutants obtained by random mutagen-
esis coupled with genetic selection in Escherichia coli. J. Biol. Chem. 271,
4872–4878.
24. Washington, S. L., Yoon, M. S., Chagovetz, A. M., et al. (1997) A genetic system
to identify DNA polymerase beta mutator mutants. Proc. Natl. Acad. Sci. USA 94,
1321–1326.
25. Shinkai, A. and Loeb, L. A. (2001) In vivo mutagenesis by Escherichia coli DNA
polymerase I. Ile(709) in motif A functions in base selection. J. Biol. Chem. 276,
46,759–46,764.
26. Cooper, P. (1977) Excision-repair in mutants of Escherichia coli deficient in DNA
polymerase I and/or its associated 5' leads to 3' exonuclease. Mol. Gen. Genet.
150, 1–12.
27. Takeshita, S., Sato, M., Toba, M., Masahashi, W., and Hashimoto-Gotoh, T.
(1987) High-copy-number and low-copy-number plasmid vectors for lacZ alpha-
complementation and chloramphenicol- or kanamycin-resistance selection. Gene
61, 63–74.
28. Cabello, F., Timmis, K., and Cohen, S. N. (1976) Replication control in a com-
posite plasmid constructed by in vitro linkage of two distinct replicons. Nature
259, 285–290.
29. Sweasy, J. B., Chen, M., and Loeb, L. A. (1995) DNA polymerase beta can sub-
stitute for DNA polymerase I in the initiation of plasmid DNA replication. J.
Bacteriol. 177, 2923–2925.

Complementation of Eukaryotic DNA Polymerase 19
19
3
Selection of Novel Eukaryotic
DNA Polymerases by Mutagenesis
and Genetic Complementation of Yeast
Ranga N. Venkatesan and Lawrence A. Loeb
1. Introduction
DNA-directed DNA polymerases have been broadly classified into seven
families based on their sequence homology (1). It is surprising to learn that
enzymes such as DNA polymerases, which carry out pivotal role during DNA
replication, repair, and recombination, are poorly conserved amongst different
families, but within a given family, all the members are highly conserved.
These observations have profound implications and suggest that DNA poly-
merases have been plastic during evolution, but can tolerate multiple muta-
tions (2). The mutability of DNA polymerases has been utilized extensively
in our studies and has shed light on structure-function relationships of each
domain. Any single amino acid residue or the entire domain can be randomly
mutagenized and the active mutants can be selected by genetic complementa-
tion. Here we describe the complementation of Saccharomyces cerevisiae Pol3
(Pol δ) by utilizing a common technique in yeast genetics known as “plasmid
shuffling,” where the wild-type copy of the Pol3 present in a Ura3 selective
marker plasmid is exchanged or genetically complemented for in vitro mutated
version(s) of Pol3 in the domain-of-interest. Since Pol3p is essential for viabil-
ity of yeast, only those mutants that genetically complement the loss of wild-
type Pol3p survive.
2. Materials
1. pYcplac 111 and pYcplac 33 (ATCC, Manassas, VA).
2. Saccharomyces cerevisiae genomic DNA (Invitrogen, Carlsbad, CA).
3. E. coli strains DH5α and XL1-blue (Invitrogen and Stratagene, La Jolla, CA).

20 Venkatesan and Loeb
4. Yeast strains (ATCC) (see Note 1).
5. Standard microbiological culture media (E. coli): Luria Bertani.
6. Standard microbiological culture media (S. cerevisiae): YPD.
7. S. cerevisiae selection medium: SC-amino acid drop out mixture.
8. Oligonucleotide primers.
9. Thermocycler.
10. Quik-change PCR mutagenesis kit (Stratagene).
11. Restriction enzymes, T4 DNA ligase.
12. Agarose gel electrophoresis apparatus.
13. DNA sequencing apparatus or available core facility.
14. Qiagen gel and plasmid purification kit (Qiagen, Valencia, CA).
13. Carbenicillin (Sigma, St. Louis, MO).
14. Canavanine (Sigma).
15. 5-Fluoro-orotic acid (5-FOA) (Qbiogene, Carlsbad, CA).
16. G418 (Invitrogen).
17. Frozen-EZ yeast transformation II kit (Zymo Research, Orange, CA).
3. Methods
The methodology presented here is applicable to the “essential” replicative
DNA polymerase α, δ, and ε, whose complete loss of function is lethal to the
viability of haploid yeast (see Note 2). Theoretically this methodology can
also be utilized to study “non-essential” DNA polymerases, if mutant allele of
the enzyme exhibits a selectable phenotype, for example, enhanced sensitivity
to UV radiation or temperature sensitivity to growth that can be rescued by
genetic complementation (3,4). Here we describe genetic complementation of
the DNA polymerase δ “knock out” strain with any (Pol3p) library of interest.
3.1. Amplification of Yeast Pol3 Targeting Module
Standard recombinant DNA techniques were followed throughout this chap-
ter (5). One of the most important parameters in this protocol is the choice of
appropriate haploid yeast strain. Technically any wild-type yeast strain can be
used and the minimum prerequisites are sensitivity to canavanine and auxotro-
phy for Leu2, Ura3, and/or Trp1, His3, Lys2 markers. We used YGL27-3D
(MATa, leu2 his3 trp1 lys2 ura3 CAN1, pol3::KanMX) engineered by Simon
and co workers (6) and Singh and co workers (7). The chromosomal copy of
the Pol3 was replaced with KanMX cassette that provided resistance to the
antibiotic G418 and the lethality was rescued by presence of wild-type Pol3 on
an episomal plasmid with the Ura3 selective marker (8,9).
3.1.1. Generation of Designer Polymerase “Knock Out” Strain
1. Transform the haploid yeast strain with the wild-type copy of the DNA poly-
merase gene-of-interest cloned into Ycplac33 vector that has Ura3 selection
marker (see Notes 3–7 for information on molecular cloning, purification and

Complementation of Eukaryotic DNA Polymerase 21
propagation of the Ycplac 33 vectors). Select for the transformants on SC-Ura
plates by incubation at 30°C for 2–4 d (see Note 8). For routine yeast transforma-
tion, use the Frozen-EZ II kit (see Note 9).
2. Entire ORF of any yeast gene can be easily deleted by utilizing PCR-based gene-
disruption method (8). To delete the chromosomal copy of any DNA polymerase
gene-of-interest, design chimeric primers in following manner. For the forward and
reverse primers fuse 50 bases flanking the start and stop codon upstream of 20 bases
which anneals to the KanMX cassette. The Pol3 primers are shown as an example,
KanMX annealing sequence is in bold, start and stop codon are in bold italics.
Forward primer:
5'CTTGCTATTAAGCATTAATCTTTATACATATACGCACAGCA
ATGAGTGAACTGTTTAGCTTGCCTCGTCC 3'
Reverse primer:
5' GCCTTTCTTAATCCTAATATGATGTGCCACCCTATCGTTTTTTAC
CATTTGAATCGACAGCAGTATAGCG 3'
3. Amplify the KanMX cassette in the plasmid pFA6KanMX4 (obtained from Dr.
Philippsen, ref. 8) using the above primers. Start with the following conditions
before optimizing for the specific primers. Combine 10 ng of template, 200 µM
of dNTPs, 20–50 pmoles of primers, 2–3 mM MgCl2, 5 units of Taq DNA poly-
merase, 1X PCR buffer and sterile ddH2O to 50 µL total volume, and amplify
using the following conditions: initial denaturation at 94°C for 1 min, 94°C for
30 s, 60°C for 30 s, 72°C for 1.5 min, 30 cycles, final extension at 72°C for 7
min. Set up a negative control PCR reaction by including all the components
except the DNA template (see Note 10).
4. Resolve 10 µL of the PCR reactions on a 1% agarose gel to assess yield. Success-
ful amplification results in a sharp band that migrates at 1.5 kb as delineated by
size markers in adjacent lanes. Set up 5–15 PCR reactions (depending on your
yield), resolve the reactions on a quantitative 1% agarose gel, photo-document
the gel and excise the 1.5 kb band from the gel using a new razor blade. Trim as
much excess agarose from gel band as possible. Chop the excised agarose bands
into 5–6 mm sized pieces and transfer them into a 15-mL centrifuge tube. Gene-
targeting experiments require at least 1–2 µg of DNA (from a preferably high
concentration stock) and the PCR reactions can be scaled accordingly.
5. Purify the DNA using Qiagen gel extraction kit (see Note 6). Quantitate the DNA
yield using UV absorption spectrophotometer.
6. Transform the yeast strain from step 1 (Ura3 selected) with 1–2 µg of the PCR
product by scaling up the reaction 2–4-fold according to the Frozen-EZ II trans-
formation kit. The gene-targeted integrands can be selected by either of two ways:
a. After incubation of the yeast at 30°C (step 4 in the kit instructions), pellet
the yeast, suspend them in 5 mL of YPD and culture for 4 h (two genera-
tions) at 30°C. Re-pellet yeast cells, suspend them in 0.5 mL of sterile water
and plate them in 3–5 YPD+G418 plates (G418 200 µg/mL). Incubate at

Other documents randomly have
different content

about donations to the Project Gutenberg Literary Archive
Foundation.”
• You provide a full refund of any money paid by a user who
notifies you in writing (or by e-mail) within 30 days of receipt
that s/he does not agree to the terms of the full Project
Gutenberg™ License. You must require such a user to return or
destroy all copies of the works possessed in a physical medium
and discontinue all use of and all access to other copies of
Project Gutenberg™ works.
• You provide, in accordance with paragraph 1.F.3, a full refund of
any money paid for a work or a replacement copy, if a defect in
the electronic work is discovered and reported to you within 90
days of receipt of the work.
• You comply with all other terms of this agreement for free
distribution of Project Gutenberg™ works.
1.E.9. If you wish to charge a fee or distribute a Project Gutenberg™
electronic work or group of works on different terms than are set
forth in this agreement, you must obtain permission in writing from
the Project Gutenberg Literary Archive Foundation, the manager of
the Project Gutenberg™ trademark. Contact the Foundation as set
forth in Section 3 below.
1.F.
1.F.1. Project Gutenberg volunteers and employees expend
considerable effort to identify, do copyright research on, transcribe
and proofread works not protected by U.S. copyright law in creating
the Project Gutenberg™ collection. Despite these efforts, Project
Gutenberg™ electronic works, and the medium on which they may
be stored, may contain “Defects,” such as, but not limited to,
incomplete, inaccurate or corrupt data, transcription errors, a
copyright or other intellectual property infringement, a defective or

damaged disk or other medium, a computer virus, or computer
codes that damage or cannot be read by your equipment.
1.F.2. LIMITED WARRANTY, DISCLAIMER OF DAMAGES - Except for
the “Right of Replacement or Refund” described in paragraph 1.F.3,
the Project Gutenberg Literary Archive Foundation, the owner of the
Project Gutenberg™ trademark, and any other party distributing a
Project Gutenberg™ electronic work under this agreement, disclaim
all liability to you for damages, costs and expenses, including legal
fees. YOU AGREE THAT YOU HAVE NO REMEDIES FOR
NEGLIGENCE, STRICT LIABILITY, BREACH OF WARRANTY OR
BREACH OF CONTRACT EXCEPT THOSE PROVIDED IN PARAGRAPH
1.F.3. YOU AGREE THAT THE FOUNDATION, THE TRADEMARK
OWNER, AND ANY DISTRIBUTOR UNDER THIS AGREEMENT WILL
NOT BE LIABLE TO YOU FOR ACTUAL, DIRECT, INDIRECT,
CONSEQUENTIAL, PUNITIVE OR INCIDENTAL DAMAGES EVEN IF
YOU GIVE NOTICE OF THE POSSIBILITY OF SUCH DAMAGE.
1.F.3. LIMITED RIGHT OF REPLACEMENT OR REFUND - If you
discover a defect in this electronic work within 90 days of receiving
it, you can receive a refund of the money (if any) you paid for it by
sending a written explanation to the person you received the work
from. If you received the work on a physical medium, you must
return the medium with your written explanation. The person or
entity that provided you with the defective work may elect to provide
a replacement copy in lieu of a refund. If you received the work
electronically, the person or entity providing it to you may choose to
give you a second opportunity to receive the work electronically in
lieu of a refund. If the second copy is also defective, you may
demand a refund in writing without further opportunities to fix the
problem.
1.F.4. Except for the limited right of replacement or refund set forth
in paragraph 1.F.3, this work is provided to you ‘AS-IS’, WITH NO
OTHER WARRANTIES OF ANY KIND, EXPRESS OR IMPLIED,

INCLUDING BUT NOT LIMITED TO WARRANTIES OF
MERCHANTABILITY OR FITNESS FOR ANY PURPOSE.
1.F.5. Some states do not allow disclaimers of certain implied
warranties or the exclusion or limitation of certain types of damages.
If any disclaimer or limitation set forth in this agreement violates the
law of the state applicable to this agreement, the agreement shall be
interpreted to make the maximum disclaimer or limitation permitted
by the applicable state law. The invalidity or unenforceability of any
provision of this agreement shall not void the remaining provisions.
1.F.6. INDEMNITY - You agree to indemnify and hold the Foundation,
the trademark owner, any agent or employee of the Foundation,
anyone providing copies of Project Gutenberg™ electronic works in
accordance with this agreement, and any volunteers associated with
the production, promotion and distribution of Project Gutenberg™
electronic works, harmless from all liability, costs and expenses,
including legal fees, that arise directly or indirectly from any of the
following which you do or cause to occur: (a) distribution of this or
any Project Gutenberg™ work, (b) alteration, modification, or
additions or deletions to any Project Gutenberg™ work, and (c) any
Defect you cause.
Section 2. Information about the Mission
of Project Gutenberg™
Project Gutenberg™ is synonymous with the free distribution of
electronic works in formats readable by the widest variety of
computers including obsolete, old, middle-aged and new computers.
It exists because of the efforts of hundreds of volunteers and
donations from people in all walks of life.
Volunteers and financial support to provide volunteers with the
assistance they need are critical to reaching Project Gutenberg™’s
goals and ensuring that the Project Gutenberg™ collection will

remain freely available for generations to come. In 2001, the Project
Gutenberg Literary Archive Foundation was created to provide a
secure and permanent future for Project Gutenberg™ and future
generations. To learn more about the Project Gutenberg Literary
Archive Foundation and how your efforts and donations can help,
see Sections 3 and 4 and the Foundation information page at
www.gutenberg.org.
Section 3. Information about the Project
Gutenberg Literary Archive Foundation
The Project Gutenberg Literary Archive Foundation is a non-profit
501(c)(3) educational corporation organized under the laws of the
state of Mississippi and granted tax exempt status by the Internal
Revenue Service. The Foundation’s EIN or federal tax identification
number is 64-6221541. Contributions to the Project Gutenberg
Literary Archive Foundation are tax deductible to the full extent
permitted by U.S. federal laws and your state’s laws.
The Foundation’s business office is located at 809 North 1500 West,
Salt Lake City, UT 84116, (801) 596-1887. Email contact links and up
to date contact information can be found at the Foundation’s website
and official page at www.gutenberg.org/contact
Section 4. Information about Donations to
the Project Gutenberg Literary Archive
Foundation
Project Gutenberg™ depends upon and cannot survive without
widespread public support and donations to carry out its mission of
increasing the number of public domain and licensed works that can
be freely distributed in machine-readable form accessible by the
widest array of equipment including outdated equipment. Many

small donations ($1 to $5,000) are particularly important to
maintaining tax exempt status with the IRS.
The Foundation is committed to complying with the laws regulating
charities and charitable donations in all 50 states of the United
States. Compliance requirements are not uniform and it takes a
considerable effort, much paperwork and many fees to meet and
keep up with these requirements. We do not solicit donations in
locations where we have not received written confirmation of
compliance. To SEND DONATIONS or determine the status of
compliance for any particular state visit www.gutenberg.org/donate.
While we cannot and do not solicit contributions from states where
we have not met the solicitation requirements, we know of no
prohibition against accepting unsolicited donations from donors in
such states who approach us with offers to donate.
International donations are gratefully accepted, but we cannot make
any statements concerning tax treatment of donations received from
outside the United States. U.S. laws alone swamp our small staff.
Please check the Project Gutenberg web pages for current donation
methods and addresses. Donations are accepted in a number of
other ways including checks, online payments and credit card
donations. To donate, please visit: www.gutenberg.org/donate.
Section 5. General Information About
Project Gutenberg™ electronic works
Professor Michael S. Hart was the originator of the Project
Gutenberg™ concept of a library of electronic works that could be
freely shared with anyone. For forty years, he produced and
distributed Project Gutenberg™ eBooks with only a loose network of
volunteer support.

Project Gutenberg™ eBooks are often created from several printed
editions, all of which are confirmed as not protected by copyright in
the U.S. unless a copyright notice is included. Thus, we do not
necessarily keep eBooks in compliance with any particular paper
edition.
Most people start at our website which has the main PG search
facility: www.gutenberg.org.
This website includes information about Project Gutenberg™,
including how to make donations to the Project Gutenberg Literary
Archive Foundation, how to help produce our new eBooks, and how
to subscribe to our email newsletter to hear about new eBooks.

Welcome to our website – the ideal destination for book lovers and
knowledge seekers. With a mission to inspire endlessly, we offer a
vast collection of books, ranging from classic literary works to
specialized publications, self-development books, and children's
literature. Each book is a new journey of discovery, expanding
knowledge and enriching the soul of the reade
Our website is not just a platform for buying books, but a bridge
connecting readers to the timeless values of culture and wisdom. With
an elegant, user-friendly interface and an intelligent search system,
we are committed to providing a quick and convenient shopping
experience. Additionally, our special promotions and home delivery
services ensure that you save time and fully enjoy the joy of reading.
Let us accompany you on the journey of exploring knowledge and
personal growth!
ebookultra.com

Directed Enzyme Evolution Screening and Selection Methods 1st Edition Frances H. Arnold

More Related Content

Similar to Directed Enzyme Evolution Screening and Selection Methods 1st Edition Frances H. Arnold (20)

Recently uploaded (20)

Directed Enzyme Evolution Screening and Selection Methods 1st Edition Frances H. Arnold