SlideShare a Scribd company logo

Highthroughput Next Generation Sequencing Methods And Applications 1st Edition Kathleen E Steinmann

Z
zorartheut59

Highthroughput Next Generation Sequencing Methods And Applications 1st Edition Kathleen E Steinmann Highthroughput Next Generation Sequencing Methods And Applications 1st Edition Kathleen E Steinmann Highthroughput Next Generation Sequencing Methods And Applications 1st Edition Kathleen E Steinmann

Education
1 of 76
Download to read offline
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
Highthroughput Next Generation Sequencing Methods And Applications 1st Edition Kathleen E Steinmann download https://ebookbell.com/product/highthroughput-next-generation- sequencing-methods-and-applications-1st-edition-kathleen-e- steinmann-2120052 Explore and download more ebooks at ebookbell.com
Here are some recommended products that we believe you will be interested in. You can click the link to download. Highthroughput Mass Spectrometry In Drug Discovery 1 Chang Liu https://ebookbell.com/product/highthroughput-mass-spectrometry-in- drug-discovery-1-chang-liu-50753706 High Throughput Mass Spectrometry In Drug Discovery Chang Liu https://ebookbell.com/product/high-throughput-mass-spectrometry-in- drug-discovery-chang-liu-51310884 Highthroughput Image Reconstruction And Analysis Rao Ar Cecchi Ga Eds https://ebookbell.com/product/highthroughput-image-reconstruction-and- analysis-rao-ar-cecchi-ga-eds-2046986 Highthroughput Screening In Drug Discovery Methods And Principles In Medicinal Chemistry 1st Edition Jrg Hser Editor https://ebookbell.com/product/highthroughput-screening-in-drug- discovery-methods-and-principles-in-medicinal-chemistry-1st-edition- jrg-hser-editor-2164066
High Throughput Analysis For Early Drug Discovery 1st Edition James Kyranos Editor https://ebookbell.com/product/high-throughput-analysis-for-early-drug- discovery-1st-edition-james-kyranos-editor-2164632 Highthroughput Screening Methods In Toxicity Testing Steinberg https://ebookbell.com/product/highthroughput-screening-methods-in- toxicity-testing-steinberg-4171180 Highthroughput Phenotyping In Plants Methods And Protocols 1st Edition Benjamin J Cole https://ebookbell.com/product/highthroughput-phenotyping-in-plants- methods-and-protocols-1st-edition-benjamin-j-cole-4177116 Highthroughput Analysis A Tool For Combinatorial Materials Science 1st Edition Radislav A Potyrailo https://ebookbell.com/product/highthroughput-analysis-a-tool-for- combinatorial-materials-science-1st-edition-radislav-a- potyrailo-4204378 Highthroughput Screening Assays In Toxicology 2nd Ed 2022 Hao Zhu Menghang Xia https://ebookbell.com/product/highthroughput-screening-assays-in- toxicology-2nd-ed-2022-hao-zhu-menghang-xia-42200192
Highthroughput Next Generation Sequencing Methods And Applications 1st Edition Kathleen E Steinmann
Highthroughput Next Generation Sequencing Methods And Applications 1st Edition Kathleen E Steinmann
Me t h o d s i n Mo l e c u l a r Bi o l o g y ™ Series Editor John M. Walker School of Life Sciences University of Hertfordshire Hatfield, Hertfordshire, AL10 9AB, UK For other titles published in this series, go to www.springer.com/series/7651
Highthroughput Next Generation Sequencing Methods And Applications 1st Edition Kathleen E Steinmann
High-Throughput Next Generation Sequencing Methods and Applications Edited by Young Min Kwon DepartmentofPoultryScience,andCellandMolecularBiologyProgram, UniversityofArkansas,Fayetteville,AR,USA Steven C. Ricke CenterforFoodSafety&DepartmentofFoodScienceandtheCellandMolecular BiologyProgram,UniversityofArkansas,Fayetteville,AR,USA
Editors Young Min Kwon, Ph.D. Department of Poultry Science and Cell and Molecular Biology Program University of Arkansas Fayetteville, AR USA ykwon@uark.edu Steven C. Ricke, Ph.D. Center for Food Safety & Department of Food Science and the Cell and Molecular Biology Program University of Arkansas Fayetteville, AR USA sricke@uark.edu ISSN 1064-3745 e-ISSN 1940-6029 ISBN 978-1-61779-088-1 e-ISBN 978-1-61779-089-8 DOI 10.1007/978-1-61779-089-8 Springer New York Dordrecht Heidelberg London Library of Congress Control Number: 2011923657 © Springer Science+Business Media, LLC 2011 All rights reserved. This work may not be translated or copied in whole or in part without the written permission of the publisher (Humana Press, c/o Springer Science+Business Media, LLC, 233 Spring Street, New York, NY 10013, USA), except for brief excerpts in connection with reviews or scholarly analysis. Use in connection with any form of information storage and retrieval, electronic adaptation, computer software, or by similar or ­ dissimilar methodology now known or hereafter developed is forbidden. The use in this publication of trade names, trademarks, service marks, and similar terms, even if they are not identified as such, is not to be taken as an expression of opinion as to whether or not they are subject to proprietary rights. While the advice and information in this book are believed to be true and accurate at the date of going to press, neither the authors nor the editors nor the publisher can accept any legal responsibility for any errors or omissions that may be made. The publisher makes no warranty, express or implied, with respect to the material contained herein. Printed on acid-free paper Humana Press is part of Springer Science+Business Media (www.springer.com)
v Preface The increasing demand for more cost-effective high-throughput DNA sequencing in this postgenome era has triggered the advent of the “next generation sequencing” methods. Due to their novel concepts and extraordinary high-throughput sequencing capacity, these methods allow researchers to grasp system-wide landscapes of the complex molecu- lar events taking place in various biological systems, including microorganisms and micro- bial communities. These methods are now being recognized as an essential tool for more comprehensive and deeper understanding of the mechanisms underlying many biological processes. With realistic expectation that these methods will continue to improve at a rapid pace, biological scientists are excited about the growing possibilities for new research approaches that can be offered by these technologies. In High-Throughput Next Generation Sequencing: Methods and Applications, expert researchers explore the most recent advances in the applications of next generation sequencing technologies with emphasis on microor- ganisms and their community. However, the methods described in this book will also find general applications on the study of any living organisms. As part of the highly successful Methods in Molecular BiologyTM series, the chapters compile step-by-step readily reproduc- ible laboratory protocols, lists of the necessary materials and reagents, and tips on trouble- shooting and avoiding known pitfalls. Comprehensive and cutting-edge, High-Throughput Next Generation Sequencing: Methods and Applications is an excellent collection of chapters to aid all scientists who wish to apply this innovative research tools to enhance their own pursuits in microbiology and also biology in general. Fayetteville, AR Young Min Kwon Steven C. Ricke
Highthroughput Next Generation Sequencing Methods And Applications 1st Edition Kathleen E Steinmann
vii Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix Part I Genome Sequencing 1 Helicos Single-Molecule Sequencing of Bacterial Genomes . . . . . . . . . . . . . . . . . 3 Kathleen E. Steinmann, Christopher E. Hart, John F. Thompson, and Patrice M. Milos 2 Whole-Genome Sequencing of Unculturable Bacterium Using Whole-Genome Amplification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25 Yuichi Hongoh and Atsushi Toyoda Part II Gene Expression Analysis 3 RNA Sequencing and Quantitation Using the Helicos Genetic Analysis System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37 Tal Raz, Marie Causey, Daniel R. Jones, Alix Kieu, Stan Letovsky, Doron Lipson, Edward Thayer, John F. Thompson, and Patrice M. Milos 4 Transcriptome Profiling Using Single-Molecule Direct RNA Sequencing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51 Fatih Ozsolak and Patrice M. Milos 5 Discovery of Bacterial sRNAs by High-Throughput Sequencing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63 Jane M. Liu and Andrew Camilli 6 Identification of Virus Encoding MicroRNAs Using 454 FLX Sequencing Platform . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81 Byung-Whi Kong 7 Ribosomal RNA Depletion for Massively Parallel Bacterial RNA-Sequencing Applications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93 Zhoutao Chen and Xiaoping Duan Part III Microbial Diversity 8 Integrating High-Throughput Pyrosequencing and Quantitative Real-Time PCR to Analyze Complex Microbial Communities . . . . . . . . . . . . . . . 107 Husen Zhang, Prathap Parameswaran, Jonathan Badalamenti, Bruce E. Rittmann, and Rosa Krajmalnik-Brown 9 Tag-Encoded FLX Amplicon Pyrosequencing for the Elucidation of Microbial and Functional Gene Diversity in Any Environment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129 Yan Sun, Randall D. Wolcott, and Scot E. Dowd
viii Contents 10 Pyrosequencing of Chaperonin-60 (cpn60) Amplicons as a Means of Determining Microbial Community Composition . . . . . . . . . . . . . . . . . . . . . . 143 John Schellenberg, Matthew G. Links, Janet E. Hill, Sean M. Hemmingsen, Geoffrey A. Peters, and Tim J. Dumonceaux 11 Prescreening of Microbial Populations for the Assessment of Sequencing Potential . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 159 Irene B. Hanning and Steven C. Ricke Part IV Metagenomics 12 Metagenomics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 173 Jack A. Gilbert, Bonnie Laverock, Ben Temperton, Simon Thomas, Martin Muhling, and Margaret Hughes 13 Metagenomic Analysis of Intestinal Microbiomes in Chickens . . . . . . . . . . . . . . . 185 Taejoong Kim and Egbert Mundt 14 Gene Expression Profiling: Metatranscriptomics . . . . . . . . . . . . . . . . . . . . . . . . . . 195 Jack A. Gilbert and Margaret Hughes Part V  Sequence Profiling for Functional Analysis 15 High-Throughput Insertion Tracking by Deep Sequencing for the Analysis of Bacterial Pathogens . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 209 Sandy M.S. Wong, Jeffrey D. Gawronski, David Lapointe, and Brian J. Akerley 16 Determining DNA Methylation Profiles Using Sequencing . . . . . . . . . . . . . . . . . 223 Suhua Feng, Liudmilla Rubbi, Steven E. Jacobsen, and Matteo Pellegrini Part VI Sequencing Library Preparation 17 Preparation of Next-Generation Sequencing Libraries Using Nextera™ Technology: Simultaneous DNA Fragmentation and Adaptor Tagging by In Vitro Transposition . . . . . . . . . . . . . . . . . . . . . . . . . . 241 Nicholas Caruccio 18 Amplification-Free Library Preparation for Paired-End Illumina Sequencing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 257 Iwanka Kozarewa and Daniel J. Turner 19 Target-Enrichment Through Amplification of Hairpin-Ligated Universal Targets for Next-Generation Sequencing Analysis . . . . . . . . . . . . . . . . . 267 Pallavi Singh, Rajesh Nayak, and Young Min Kwon 20 96-Plex Molecular Barcoding for the Illumina Genome Analyzer . . . . . . . . . . . . . 279 Iwanka Kozarewa and Daniel J. Turner Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 299
ix Contributors Brian J. Akerley • Department of Molecular Genetics and Microbiology, University of Massachusetts Medical School, Worcester, MA, USA Jonathan Badalamenti • Center for Environmental Biotechnology, Biodesign Institute, Arizona State University, Tempe, AZ, USA Andrew Camilli • Howard Hughes Medical Institute and Tufts University School of Medicine, Boston, MA, USA Nicholas Caruccio • Epicentre Biotechnologies, Madison, WI, USA Marie Causey • Helicos BioSciences Corporation, Cambridge, MA, USA Zhoutao Chen • Life Technologies, Carlsbad, CA, USA Scot E. Dowd • Research and Testing Laboratory, Lubbock, TX, USA Xiaoping Duan • Life Technologies, Carlsbad, CA, USA Tim J. Dumonceaux • Agriculture and Agri-Food Canada Saskatoon Research Centre, Saskatoon, SK, Canada Suhua Feng • Department of Molecular, Cell and Developmental Biology, University of California, Los Angeles, CA, USA Jeffrey D. Gawronski • Department of Molecular Genetics and Microbiology, University of Massachusetts Medical School, Worcester, MA, USA Jack A. Gilbert • Plymouth Marine Laboratory, The Hoe, Plymouth, UK Irene B. Hanning • University of Tennessee, Department of Food Science and Technology, Knoxville, TN, USA Christopher E. Hart • Helicos BioSciences Corporation, Cambridge, MA, USA Sean M. Hemmingsen • National Research Council Plant Biotechnology Institute, Saskatoon, SK, Canada Janet E. Hill • Department of Veterinary Microbiology, University of Saskatchewan, Saskatoon, SK, Canada Yuichi Hongoh • Department of Biological Sciences, Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Tokyo, Japan Margaret Hughes • School of Biological Sciences, University of Liverpool, Liverpool, UK Steven E. Jacobsen • Department of Molecular, Cell and Developmental Biology, University of California, Los Angeles, CA, USA Daniel R. Jones • Helicos BioSciences Corporation, Cambridge, MA, USA Alix Kieu • Helicos BioSciences Corporation, Cambridge, MA, USA Taejoong Kim • Department of Population Health, College of Veterinary Medicine, University of Georgia, Athens, GA, USA Byung-Whi Kong • Department of Poultry Science, and Cell and Molecular Biology Program, University of Arkansas, Fayetteville, AR, USA Iwanka Kozarewa • The Wellcome Trust Sanger Institute, Hinxton, Cambridge, UK Rosa Krajmalnik-Brown • Center for Environmental Biotechnology,
x Contributors Biodesign Institute, Arizona State University, Tempe, AZ, USA Young Min Kwon • Department of Poultry Science, and Cell and Molecular Biology Program, University of Arkansas, Fayetteville, AR, USA David Lapointe • Information Services, University of Massachusetts Medical School, Worcester, MA, USA Bonnie Laverock • Plymouth Marine Laboratory, The Hoe, Plymouth, UK Stan Letovsky • Helicos BioSciences Corporation, Cambridge, MA, USA Matthew G. Links • Agriculture and Agri-Food Canada Saskatoon Research Centre, Saskatoon, SK, Canada; Department of Veterinary Microbiology, University of Saskatchewan, Saskatoon, SK, Canada Doron Lipson • Helicos BioSciences Corporation, Cambridge, MA, USA Jane M. Liu • Department of Chemistry, Drew University, Madison, NJ, USA Patrice M. Milos • Helicos BioSciences Corporation, Cambridge, MA, USA Martin Muhling • TU Bergakademie Freiberg, IÖZ – Interdisciplinary Centre for Ecology, Freiberg, Germany Egbert Mundt • Department of Population Health, College of Veterinary Medicine, University of Georgia, Athens, GA, USA Rajesh Nayak • U.S. Food and Drug Administration, National Center for Toxicological Research, Jefferson, AR, USA Fatih Ozsolak • Helicos BioSciences Corporation, Cambridge, MA, USA Prathap Parameswaran • Center for Environmental Biotechnology, Biodesign Institute, Arizona State University, Tempe, AZ, USA Matteo Pellegrini • Department of Molecular, Cell and Developmental Biology, University of California, Los Angeles, CA, USA Geoffrey A. Peters • National Microbiology Laboratory, Public Health Agency of Canada, Winnipeg, MB, Canada Tal Raz • Helicos BioSciences Corporation, Cambridge, MA, USA Steven C. Ricke • Center for Food Safety Department of Food Science and the Cell and Molecular Biology Program, University of Arkansas, Fayetteville, AR, USA Bruce E. Rittmann • Center for Environmental Biotechnology, Biodesign Institute, Arizona State University, Tempe, AZ, USA Liudmilla Rubbi • Department of Molecular, Cell and Developmental Biology, University of California, Los Angeles, CA, USA John Schellenberg • Department of Medical Microbiology, University of Manitoba, Winnipeg, MB, Canada Kathleen E. Steinmann • Helicos BioSciences Corporation, Cambridge, MA, USA Pallavi Singh • Cell and Molecular Biology Program, University of Arkansas, Fayetteville, AR, USA Yan Sun • Research and Testing Laboratory, Lubbock, TX, USA Ben Temperton • Plymouth Marine Laboratory, The Hoe, Plymouth, UK Edward Thayer • Helicos BioSciences Corporation, Cambridge, MA, USA Simon Thomas • Plymouth Marine Laboratory, The Hoe, Plymouth, UK John F. Thompson • Helicos BioSciences Corporation, Cambridge, MA, USA Atsushi Toyoda • Comparative Genomics laboratory, National Institute of Genetics,
xi Contributors Shizuoka, Japan Daniel J. Turner • The Wellcome Trust Sanger Institute, Hinxton, Cambridge, UK Randall D. Wolcott • Southwest Regional Wound Care Center, Lubbock, TX, USA Sandy M.S. Wong • Department of Molecular Genetics and Microbiology, University of Massachusetts Medical School, Worcester, MA, USA Husen Zhang • Department of Civil, Environmental, and Construction ­ Engineering, University of Central Florida, Orlando, FL, USA
Highthroughput Next Generation Sequencing Methods And Applications 1st Edition Kathleen E Steinmann
Part I Genome Seq uencing
Highthroughput Next Generation Sequencing Methods And Applications 1st Edition Kathleen E Steinmann
3 Young Min Kwon and Steven C. Ricke (eds.), High-Throughput Next Generation Sequencing: Methods and Applications, Methods in Molecular Biology, vol. 733, DOI 10.1007/978-1-61779-089-8_1, © Springer Science+Business Media, LLC 2011 Chapter 1 Helicos Single-Molecule Sequencing of Bacterial Genomes Kathleen E. Steinmann, Christopher E. Hart, John F. Thompson, and Patrice M. Milos Abstract With the advent of high-throughput sequencing technologies, multiple bacterial genomes can be sequenced in days. While the ultimate goal of de novo assembly of bacterial genomes is progressing, changes in the genomic sequence of closely related bacterial strains and isolates are now easily monitored by comparison of their sequences to those of a reference genome. Such studies can be applied to the fields of bacterial evolution, epidemiology, and diagnostics. We present a protocol for single-molecule sequenc- ing of bacterial DNA whose end result is the identification of single nucleotide variants, and various size insertions and deletions relative to a reference genome. The protocol is characterized by the simplicity of sample preparation and the lack of amplification-related sequencing bias. Key words: Bacterial genome, Single-molecule sequencing, Sequencing bias, SNV, PolyA tail, HeliScopeTM sequencer Sequencing of multiple bacterial genomes at a depth sufficient to allow their alignment to a reference genome can now be achieved in a single channel of a HeliscopeTM Genetic Analysis System (1) and other high-throughput sequencing platforms (2). The ability to determine differences between closely associated bacterial strains and isolates through alignment to a reference genome has contrib- uted greatly to an understanding of bacterial evolution (3, 4). This method of bacterial genome resequencing can be used to track the acquisition of virulence factors and antibiotic resistance through sequencing of multiple isolates (5–7). The genetic changes underlying mutant phenotypes can now be found more easily and at less cost by sequencing than by traditional genetic mapping (8). 1. Introduction
4 Steinmann et al. The DNA sample preparation technique used for single-molecule sequencing that is described below is unique in that no amplification or ligation is required. The DNA is fragmented. A polyA tail, added with terminal transferase and dATP, allows hybridization of the DNA to an oligodT-coated flow cell. Minimal sample manipulation results in the lack of GC bias associated with ampli- fication-based technologies (9, 10). Helicos BioSciences demon- strated this lack of bias by showing even coverage for three bacterial genomes with differing GC contents (1). The mean sequencing coverage within 200-bp sliding windows across the Escherichia coli K12 MG1655 (50.8% GC), Staphylococcus aureus USA 3000 (37.7% GC), and Rhodobacter sphaeroides 2.4.1 (68.8% GC) genomes was plotted against the GC content in the same window (Fig. 1). These data demonstrated flat coverage and sequencing accuracy of sequence contexts ranging from 20 to 80% GC. The overall sequence coverage required for accurate SNP calling is related to the evenness of coverage (11). The lack of bias observed with single-molecule sequencing on the HeliScopeTM Genetic Analysis System points to its use as a cost- effective and accurate method for bacterial genome resequencing. At present, a single HeliScopeTM Sequencer channel provides over 80-fold coverage for a single bacterial genome, far exceeding the 20× to 25× coverage needed for variant detection. When amplifi- cation-free barcoding methods are employed, three or more bac- terial genomes (depending on the genome size) can be resequenced per lane while retaining the lack of amplification bias. 1. Qiagen DNA purification Kit (Qiagen, Valencia, CA) (see Note 1). 2. S2 instrument (Covaris, Inc., Woburn, MA) (see Note 2). 3. Preparation station (Covaris, Inc., Woburn, MA). 4. MicroTube holder (single tube). (Covaris, Inc., Woburn, MA). 5. Snap-Cap microTube with AFA fiber and Pre-split Teflon/ silicone/Teflon septa (Covaris, Inc., Woburn, MA). 6. Distilled water (Invitrogen, Carlsbad, CA). 7. 10× TE, pH 8.0 (Invitrogen, Carlsbad, CA). 8. 1.5 mL MAXYMum recovery tubes (Axygen Scientific, Union City, CA) (see Note 3). 1. Agencourt® AMPure® XP Kit (Agencourt Bioscience Corp., Beverly, MA). 2. 100% Ethanol (Sigma, St Louis, MO). 2. Materials 2.1. DNA Isolation and Ultrasonic Shearing of DNA 2.2. Size Selection Using Solid Phase Reversible Immobilization
5 Helicos Single-Molecule Sequencing of Bacterial Genomes 3. Distilled water (Invitrogen, Carlsbad, CA). 4. Dynal® Magnet: DynaMag® -2 Magnet (Invitrogen, Carlsbad, CA) or similar. 5. Heatblock equipped with block milled for 1.5 mL tubes (VWR, Batavia, IL). Fig. 1. Single-molecule DNA sequencing provides minimal sequence bias across diverse genomic content. The local GC content and observed mean sequencing coverage were tabulated using a 200-bp sliding window.Windows were then aggregated into GC-content bins ranging from 0 to 1 with a step size of 0.1. Plotted is the mean coverage (GRAY; Right Y-axis) for each window within each of the aggregated GC-content bins (BLACK; Left Y-axis, Log scale). (a) E. coli. (b) Staphylococcus aureus. (c) Rhodobacter sphaeroides. (Reproduced from ref. 1 with permission from Helicos BioSciences Corporation.). 7 a b c 6 5 4 3 2 6 7 6 5 4 3 2 1 0 5 4 3 2 1 0 0.0 0.0 0.2 0.4 0.6 0.8 1.0 0.2 0.4 0.5 0.8 1.0 –1 1 0 0.0 0.2 0.4 Fraction GC Fraction GC Fraction GC Number of Windows Number of Windows Number of Windows Mean Coverage Mean Coverage Mean Coverage 0.6 0.8 1.0 90 80 70 60 50 40 30 20 10 60 50 40 30 20 10 0 120 140 100 80 60 40 20 0
6 Steinmann et al. 1. 4–20% TBE gel, 1.0 mM, 12 well or similar (Invitrogen, Carlsbad, CA) (see Note 4). 2. Ultrapure 10× TBE buffer (Invitrogen, Carlsbad, CA). 3. Para-film. 4. 10× BlueJuiceTM gel loading buffer (Invitrogen, Carlsbad, CA). 5. 25 bp DNA ladder (Invitrogen, Carlsbad, CA). 6. 1 kB DNA ladder (Invitrogen, Carlsbad, CA). 7. SYBR® Gold nucleic acid gel stain (Invitrogen, Carlsbad, CA). 8. Photodocumentation system compatible with a SYBR® Gold photographic filter. 9. SYBR® Gold Nucleic photographic filter (Invitrogen, Carlsbad, CA). 10. XCell SurelockTM Mini-cell (Invitrogen, Carlsbad, CA). 11. NanodropTM 1000, 2000, 2000c, or 8000 spectrophotome- ter (Thermo Fisher Scientific, Waltham, MA). 1. Terminal transferase kit: includes terminal transferase enzyme (20,000 U/mL), CoCl2 at 2.5 mM, 10× terminal transferase buffer (New England BioLabs, Ipswich, MA). 2. HelicosTM DNA sample preparation reagents kit: includes HelicosTM PolyA tailing control oligonucleotide TR and HelicosTM PolyA tailing dATP. (Helicos BioSciences Corpora­ tion, Cambridge, MA). Store Kit at −80°C (see Note 5). 3. Distilled water (Invitrogen, Carlsbad, CA). 4. 0.2 mL MAXYMum recovery thin wall PCR tubes and 1.5 mL MAXYMum recovery tubes (Axygen Scientific, Union City, CA) (see Note 3). 5. Aluminum block milled for 0.2 mL tubes (VWR, Batavia, IL). 6. DNA engine thermal cycler (BioRad Laboratories, Hercules, CA). 1. 4–20% TBE gel, 1.0 mM, 12 well or similar (Invitrogen, Carlsbad, CA) (see Note 4). 2. Ultrapure 10× TBE buffer (Invitrogen, Carlsbad, CA). 3. 10× BlueJuiceTM gel loading buffer (Invitrogen, Carlsbad, CA). 4. 100 bp DNA ladder (Invitrogen, Carlsbad, CA). 5. SYBR® Gold nucleic acid gel stain (Invitrogen, Carlsbad, CA). 6. Photodocumentation system compatible with a SYBR® Gold photographic filter. 7. SYBR® Gold nucleic photographic filter (Invitrogen, Carlsbad, CA). 8. XCell SurelockTM Mini-cell (Invitrogen, Carlsbad, CA). 2.3. Calculating the Approximate Concentration of 3¢ Ends 2.4. PolyA Tailing Reaction 2.5. Determining the Success of Tailing Reaction
7 Helicos Single-Molecule Sequencing of Bacterial Genomes 1. Terminal transferase enzyme (20,000 U/mL) (New England BioLabs, Ipswich, MA). 2. HelicosTM PolyA tailing dATP (Helicos BioSciences Corporation, Cambridge, MA). 3. Aluminum block milled for 0.2 mL tubes (VWR, Batavia, IL). 4. DNA engine thermal cycler (BioRad Laboratories, Hercules, CA). 1. Terminal transferase enzyme (20,000 U/mL) (New England BioLabs, Ipswich, MA). 2. 1 mM Biotin-11-ddATP (PerkinElmer, Waltham, MA). 3. Aluminum block milled for 0.2 mL tubes (VWR, Batavia, IL). 4. DNA engine thermal cycler (BioRad Laboratories, Hercules, CA). The major steps in preparing bacterial DNA for single-molecule sequencing on the HeliScopeTM Sequencer consist of shearing the DNA to 200–300 bp, adding a polyA tail to allow hybridization to the oligonucleotide-coated HelicosTM Flow Cell and blocking the 3¢ end of the DNA with ddATP to prevent that end of the DNA from acting as a substrate for the sequencing-by-synthesis reaction. A bead-based size-selection step after the shearing step removes salts and small nucleic acids that would be tailed, but are not sufficiently long to yield meaningful sequence information. A quality control step ensures that samples are sheared to the appropriate size. A second quality control step uses a control reac- tion to monitor the tail length of a PolyA tailing control oligo- nucleotide TR spike to insure sample polyA tail lengths of between 90 and 200 dA. Sequencing of the resultant sample and subse- quent data analysis using Helicos variant detection software results in the enumeration of single nucleotide variants (SNVs), and insertions and deletions (indels) of up to 4 bp in length between the sequenced bacteria and a reference using alignment-based methods. Alternative approaches for detecting much longer variants using assembly-based methods are under development. The method used for bacterial DNA isolation is dependent upon the bacterial source. The Qiagen DNA Purification Kit has been used successfully for bacterial DNA isolation following manufac- turer’s instructions (see Note 1). 1. Prepare the Covaris S2 instrument for ultrasonic shearing of DNA by filling the tank on the Covaris S2 instrument with 2.6. Short Tail Correction 2.7. 3¢ Blocking Reaction 3. Methods 3.1. DNA Isolation and Ultrasonic Shearing of DNA
8 Steinmann et al. deionized water to level 12 on the fill line label. The water should cover the visible parts of the microTube when it is in the microTube holder (i.e., to the bottom of the snap cap). 2. Set the chiller to 4°C and turn it on. 3. Turn on the S2 unit by depressing the red switch located at the upper right corner of the instrument. 4. After the instrument is on, open the software. Click the ON button on the control panel under the word DEGAS to begin the degassing procedure. The instrument is ready to use when the water has been degassed for 30 min and the temperature software display is between 6°C and 8°C. 5. Prepare 500 ng to 3 mg of DNA in 120 ml of TE, pH 8.0. If the DNA is not in 120 mL of TE, add the appropriate amount 10× TE, pH 8.0 to make the overall concentration of TE in the solution 1× (see Note 6). 6. Place an unfilled Covaris microTube into the preparation sta- tion holder. 7. Keeping the cap on the tube, use a p200 pipette and 200-mL aerosol-free tip to transfer the 120 mL of DNA sample by inserting the tip through the pre-split septa. Place the tip along the interior wall of the tube. Slowly discharge the fluid into the tube, moving the pipette tip up along the interior wall as the tube fills. Be careful not to introduce a bubble into the bottom of the tube. If a bubble appears, remove the bub- ble by briefly (1–2 s) centrifuging the tube in a low-speed tabletop centrifuge equipped with appropriate adaptors. 8. Slide the tube into the microTube holder while keeping the tube vertical. Make sure the tube is centered in the holder. Carefully insert the holder into the machine. Take care not to introduce bubbles into the bottom of the tube during this process. 9. Click on Configure. On the Method Configuration Screen, set the Mode to Frequency Sweeping and the Bath Temperature Limit to 20°C. In the Treatment 1 box, set the Duty Cycle to 10%, the Intensity to 5 and the Cycles/Burst to 200. Set the time to 60 s and the Number of Cycles to 3. Click on Return to Main Panel. Click Start and Start again when the second screen appears. 10. After shearing is complete, remove the tube from the S2 holder and place it into the preparation station. Remove the snap cap with the tool supplied with the preparation station. Use a p200 pipette to transfer the sheared DNA to a new, clean 1.5-mL tube. A brief centrifugation may be used to col- lect any DNA remaining in the microTube. 11. Samples may be stored at −20°C after this step.
9 Helicos Single-Molecule Sequencing of Bacterial Genomes 12. When the shearing is completed, click the OFF button under DEGAS, empty the water tank, turn off the chiller, close the software, and power down the instrument. 1. Warm the AMPure XP bead solution to room temperature and vortex thoroughly to resuspend all beads. 2. Prepare 70% ethanol. Prepare fresh by diluting 7 mL of abso- lute ethanol into 3 mL of distilled water. Do not use a stock 70% ethanol. 3. Vortex the AMPure XP beads and add 360 mL of the AMPure XP bead slurry to each tube of sheared DNA. Pipette up and down ten times to mix. 4. Incubate the sample slurry for 5–10 min at room temperature. 5. Capture the AMPure XP beads by placing the tube(s) on the DynalTM magnet until the beads are separated from the solu- tion (approximately 5 min). 6. Carefully aspirate the supernatant keeping the tube(s) on the magnet. Do not disturb the beads adhering to the side of the tube. Take care not to remove any AMPure XP beads (see Note 7). 7. Add 700 ml of 70% EtOH to each tube on the DynalTM mag- net. Wait for 30 s. 8. Keep the tubes on the magnet and carefully aspirate the supernatant (see Note 7). 9. Repeat steps 7 and 8. 10. Briefly centrifuge the tubes to collect any remaining 70% EtOH to the bottom of the tube. Place the tubes back on the magnet and remove the last drops of 70% EtOH with a p10 pipette. 11. Dry the pellet at 37°C in a heat block milled for 1.5 mL tubes. Pellets should be dried until cracks appear in them (approxi- mately 1–5 min). Take care not to over dry the pellets as they will be difficult to resuspend. This step can be performed at room temperature with the drying time being extended to a minimum of 10 min before cracks appear. 12. Elute the sheared DNA sample from the AMPure beads by adding 20 mL of distilled water to each tube. A brief (1–2 s) centrifugation may be necessary to collect all the beads at the bottom of the tube. 13. Pipette the entire volume of each tube up and down 20 times so that the beads are completely resuspended. 14. Place the tube back on the magnet. After the beads are sepa- rated from the solution, collect the 20 mL of solution and 3.2. Size Selection Using Solid Phase Reversible Immobilization
10 Steinmann et al. place it into a new 1.5-mL tube. This supernatant contains the sheared, size-selected DNA (see Note 8). 15. Add another 20 mL of water to the tube. Repeat steps 13 and 14, this time adding the supernatant to the first elute. The final sheared, size-selected DNA volume should be 40 mL. 16. The DNA can be stored at −20°C after this step. 1. These instructions assume the use of an XCell SureLockTM Mini-cell and Invitrogen 4–20% gradient gels. An equivalent electrophoresis apparatus compatible with 10×10 cm gel ­ cassettes can also be used. Non-gradient gels are not recommended. 2. Remove the 4–20% TBE gel from its storage pouch. Remove the comb, rinse the wells with water two to three times and remove the plastic strip at the bottom of the gel. Complete the assembly of the gel unit. 3. Prepare 1× TBE running buffer by diluting 100 mL of 10× TBE with 900 mL of water in a graduated cylinder. Cover with para-film and invert to mix. Running buffer may be stored at room temperature. 4. Add running buffer to the center reservoir of the gel appara- tus. Check for leaks and reassemble if necessary. Add 1–2 in. of buffer to the bottom reservoir. 5. Load 2 ml aliquots of the samples in 1× BlueJuiceTM buffer in a total volume of 10 ml. Make a 1:10 dilution of the 1 kB and 25-bp ladders in distilled water. Load 1 ml of the diluted markers in 1× BlueJuiceTM buffer in a total volume of 10 ml. 6. Run the gel at 180 V for 45 minutes. 7. After removing the gel from the cassette, using the tool pro- vided with the XCell SureLockTM Mini-cell, stain the gel for 10 min in freshly prepared SYBR® Gold nucleic acid gel stain diluted 1:100,000 in water (see Note 9). 8. Destain the gel in water for 10–15 min, changing the water every 2 min. 9. Image with a photodocumentation system compatible with a SYBR® Gold photographic filter. 10. Determine the average size of your sample by comparing the size of the middle of the sample smear to the size standards (see Note 10). 11. Determine the double-stranded DNA concentration in ng DNA/mL at this step using a NanodropTM 1000, 2000, 2000c, or 8000 spectrophotometer. 3.3. Calculating the Approximate Concentration of 3¢ Ends
11 Helicos Single-Molecule Sequencing of Bacterial Genomes 12. Calculate the pmoles of ends in the sample using the following formula: pmoles ends/mL=(X ng DNA/mL)×(1,000 pg/ng)× (pmole/660 pg)×(1/average # bp as determined from the gel photo)×2 ends/molecule. 1. Based on the calculations in step 12 of Subheading 3.3, pre- pare a Sample DNA tube for each DNA to be tailed by deter- mining the volume of DNA that would give 3 pmoles of ends. Put that volume of DNA into a 0.2-mL PCR tube along with distilled water to bring the final volume to 26 mL. 2. Prepare a Control DNA tube for each DNA to be tailed by determining the volume of DNA that would give 0.8 pmoles of ends. Put that volume of DNA into a 0.2-mL PCR tube along with 1 mL of HelicosTM PolyA Tailing Control Oligo TR and distilled water to bring the final volume to 26 mL. 3. Prepare a separate Oligo TR Control DNA tube (without DNA sample) by putting 4 mL of HelicosTM PolyA Tailing Control Oligo TR in a tube containing 22 mL of distilled water. 4. Prepare a sample master mix by adding 4.4 mL of 10× termi- nal transferase buffer, 4.4 mL of CoCl2 (2.5 mM), 4.2 mL of HelicosTM PolyA Tailing dATP, and 2.2 mL terminal trans- ferase enzyme (20 U/mL) per sample (see Note 11). The master mix volume includes a 10% scale-up. Mix thoroughly by pipetting the entire mix up and down several times (see Note 12). Keep on ice. 5. Prepare a control master mix by adding 4.4 mL of 10× termi- nal transferase buffer, 4.4 mL of CoCl2 (2.5 mM), 3 mL of distilled water, 1.4 mL of HelicosTM PolyA Tailing dATP, and 2.2 mL terminal transferase enzyme (20 U/mL) per control reaction (see Note 13). The master mix includes a 10% scale- up. Mix thoroughly by pipetting the entire mix up and down several times (see Note 12). Keep on ice. 6. Heat the Sample and Control Tubes DNA tubes to 95°C for 5 min in a thermocycler. Immediately remove the DNA tubes from the thermocycler and snap cool for a minimum of 2 min by placing the tubes in an aluminum block milled for 0.2 mL tubes that has been prechilled in ice water (see Note 14). 7. Add 14 mL of sample master mix to the sample DNA tubes and 14 mL of control master mix to the control DNA tubes. Mix thoroughly by pipetting up and down ten times (see Note 12). 8. Collect the contents of the tubes into the bottom by briefly centrifuging. 3.4. PolyA Tailing Reaction
12 Steinmann et al. 9. Place the tubes in the thermocycler and incubate at 37°C for 60 min, 70°C for 10 min followed by a 4°C hold. 10. The tailed DNA can be stored at −20°C after this step. 1. Gel type and running instructions are identical to those in Subheading 3.3. Instructions here will be limited to how to prepare samples for loading and how to interpret results. 2. Load 20 ml aliquots of the control reactions in 1× BlueJuiceTM buffer (18 mL of the control reaction and 2 mL of 10× BlueJuiceTM ). 3. Make a 1:10 dilution of the 100-bp ladder in distilled water. Load 1 ml of the diluted markers in 1× BlueJuiceTM buffer in a total volume of 20 ml. 4. The sample itself is difficult to visualize. The band corre- sponding to the TR oligo spike is visible in the control lanes and monitors the tail length of the sample. All control reac- tions should migrate at the size of the Oligo TR Control Sample. A longer polyA tail may be indicative of a sample with a reduced number of strands ending in a 3¢OH. Only strands having a 3¢OH can be tailed. Tailed oligos with 90–200 dA are expected to migrate below the 600-bp band to midway between the 200- and 300-bp bands on the 100- bp ladder (see Note 15 and Fig. 2). If the TR oligo band in the Control reaction lane migrates anywhere between 250 bp and 600 bp, you may proceed to steps in Subheading 3.7. 5. In the rare instances where the band in the Control reaction lane migrates below 250 bp, the sample has a polyA tail shorter than 90 nucleotides. Proceed to steps in Subheading 3.6. 6. If the band in the Control reaction lane migrates above 600 bp, the polyA tail contains more than 200 dA. In this case, the sample could be run on the HelicosTM Genetic Analysis System. However, if sample is not limiting, we recommend repeating the PolyA tailing reaction on another sheared DNA aliquot using twice the amount of input DNA. 1. Both the control and sample reactions undergo the ­ correc­ tion. The denaturation step and thermocycler incubation ­ conditions are as for the PolyA tailing reactions in Subheading 3.4. 2. After snap cooling the tubes, the following reagents are added. For the 3 pmole sample reactions, add 3.9 mL of dATP and 2 mL of terminal transferase. For the 0.8 pmole control reactions, prepare a 1:2 dilution of the dATP stock in water. Add 1.3 mL of diluted dATP and 1 mL of terminal trans- ferase. Mix by pipetting up and down thoroughly ten times. 3.5. Determining the Success of the Tailing Reaction 3.6. Short Tail Correction
13 Helicos Single-Molecule Sequencing of Bacterial Genomes 3. Steps in Subheading 3.5 maybe performed on the control reaction to determine if the polyA tail length is greater than 90 dA. 1. The 3¢ Blocking reaction is performed only on the Sample reac- tions. The denaturation step and thermocycler ­ incubation con- ditions are as for the PolyA tailing reactions in Subheading 3.4. The reagents to be added to the tubes are outlined below. 2. Dilute the 1-mM Biotin-11-ddATP 1:6 in water. After snap cooling the sample tubes, add 1 mL of the diluted Biotin-11- ddATP and 2 mL of terminal transferase to each tube. 3. After the blocking reaction is completed, add 1 mL of 500 mM EDTA to the samples. Samples should be stored at −20°C. Sample quantification and sample loading are typically performed by the operator of the HeliscopeTM Single Molecule Sequencer, and will therefore be outlined only briefly here. Sample concentration is determined using the HelicosTM OptihybTM assay. For the assay, a 1:50 dilution of a DNA sample 3.7. 3¢ Blocking Reaction 3.8. Sample Quantification and Sequencing Fig. 2. Migration pattern of tailed TR oligonucleotide in control reactions with optimal dA tail lengths. Tailed TR oligos with 90–200 dA are expected to migrate below the 600-bp and to midway between the 200- and 300-bp bands on the 100-bp ladder. PolyA tailed samples do not migrate normally in the gel. Lane 1: 100-bp DNA ladder. Lane 2: A con- trol reaction with 200 dA. Lane 3: A control reaction with 90 dA. Lane 4: Tailing Control Oligo TR with 90 dA. Lane 5: 25-bp DNA ladder.
14 Steinmann et al. is prepared by adding 2 mL of a DNA sample to 98 mL of hybridization buffer. A standard curve is generated by serially diluting HelicosTM Control Oligonucleotides at concentrations from 500 to 20 pM. The PolyA tailed and biotin-ddATP blocked control oligonucleotides and DNA samples are captured in a 96-well plate. After washing and blocking, the plates are incu- bated with an HRP (horseradish peroxidase) conjugate. The streptavidin–biotin complexes that are formed are washed to remove excess HRP. TMB, a chromogenic substrate for the HRP, is added to the plate. The reaction is stopped by the addition of 1 N HCl and read on a plate reader at 450 nm. The concentration of the DNA sample is determined by comparison of the signal generated by the DNA sample to the standard curve generated with the HelicosTM Control Oligonucleotides. The HeliScopeTM Sequencer obtains sequence from one or two 25 channel flow cells, making it possible to sequence 50 bac- terial genomes per run. DNA Samples are loaded onto the HeliscopeTM Flow Cell at a recommended concentration of 200 pM using the HeliscopeTM Sample Loader. The samples hybridize to the oligo dT primers on the flow cell surface and are locked into place by a procedure that ensures that sequencing-by- synthesis starts immediately after the first nonA base on the DNA samples. 120 nucleotide cycle additions are performed in an 8-day run, though the timing is adjustable based on user throughput needs. The HeliScopeTM analysis engine on the instrument creates .srf files that correlate template position images with nucleotide addition images to generate sequence information. After the run is completed, .srf files are converted to .sms files which are used for subsequent data analysis. HeliScopeTM data analysis can be done using a Unix system with at least 5 GB per CPU core. The HeliSphereTM data analysis pipeline is an open-source software written in the Python pro- gramming language. It is available for download at: http:/ /open. helicosbio.com/mwiki/index.php/Releases. Download both the HeliSphereTM package and the examples. Follow the HeliSphereTM User’s Guide documentation available at http:/ /open.helicosbio. com/helisphere_user_guide/index.html after installation. The resequencing pipline uses the raw sequence input file (.sms) to generate reads aligned to a reference genome and to report SNVs and short insertions and deletions (indels) between the sequenced material and the reference. The current version of the resequencing pipeline analyzes data from a single channel. Reliable SNV calling requires roughly 20× depth. With current machine performance of roughly 12–16 M reads per channel and an aver- age read length of 35 bp, we would then recommend this single channel pipeline for resequencing applications where the genome is less than 25 Mb. 3.9. Data Analysis 3.10. Running the Resequencing Pipeline
15 Helicos Single-Molecule Sequencing of Bacterial Genomes In order to run the pipeline, you must specify certain analysis parameters. A detailed description of all analysis parameters and how to apply them under more complex situations (e.g., for a barcoded sample) can be found in the HelisphereTM Users Guide. Default values for most analysis parameters are appropriate for running the pipeline on a single bacterial genome in a single chan- nel. The following example outlines what must be specified for each analysis, how to set up the corresponding run configuration file, and how to launch the analysis. 1. Determine the input file directory and the .sms file name of the file to be processed. For example: /ifs/bioinf/workspace/ bacreseq/smsDirectory/file.sms 2. Determine the flow cell and channel to be processed. For example: the flow cell is 1 and the channel is 5. 3. Chose an output directory. For the example: /ifs/bioinf/ workspace/bacreseq/outputDir. 4. A reference fasta file has to be chosen and placed in the refer- ence data directory. This directory is defined as the refer- enceDir variable inside the file (helicos installation root)/ pypeline/config/pypeline-site.conf. If an indexDPgenomic database does not exist for this reference it needs to be cre- ated with preprocessDB and placed in the same directory. In the example, the reference is human.fasta and the indexD- Pgenomic data base prefix is human.seed18 5. For accurate mutation detection using SNPSniffer, consider- ation should be given only to mutations for which the allele with maximum p-Value is 1e-10 or less. Such data can be gen- erated automatically by running the tool with the flag --pvalue_ threshold 1e-10. 6. The above information is incorporated into a config file for the run. For example: [Global] channels=1:5 input=/ifs/bioinf/workspace/bacreseq/smsDirectory/file. sms outdir=/ifs/bioinf/workspace/bacreseq/outputDir referenceName=human [snpSniffer] p-valueThreshold=1e-10 It is saved in a .conf file. For example, this file is named run. resequencing.conf. 7. To incorporate the parameters used in the example, the pipe- line should be launched with the following command: pypeline -p resequencing -c run.resequencing.conf
16 Steinmann et al. The resequencing pipeline generates various reports. The Resequencing summary report (reseq.summary.txt) can be used to assess the quality of a run. The table generated contains the following information: 1. Group: flow cell and channel of the processed data. 2. Reference: reference used to align the data. 3. Raw: number of unfiltered reads in the input file. 4. Filtered: number of reads remaining after a filtering step for read length and some sequence contexts. To accurately detect indels of longer lengths (up to 4) during bacterial genome resequencing, filtering out reads shorter than 25 is recommended. 5. Aligned: number of reads aligning to the given reference at a minAlignScore threshold of 1.3 or higher. This score takes into account length of the read, the number of matched nucleotides, and penalties for misalignments using a scoring scheme unique to the resequencing pipeline. 6. %filtered: filtered reads/raw reads. 7. %aligned: aligned reads/filtered reads. 8. MeanLen: mean length of aligned read. Mean length is around 35. 9. Del, Ins, Sub, Error: assessed per-base deletion, insertion, substitution, and total error rates, respectively based on align- ments reference. 10. NumSNPs: number of sequence variants detected by SNPSniffer. SNPSniffer generates a table of SNPs named: out_prefix_SNP. txt. The Mutation Analysis report has the following fields (see Table 1): 1. Num: mutation number 2. RefName: reference name 3. Start: start position of mutation 4. End: end position of mutation 5. Ref: reference nucleotide/s 6. Type: type of mutation SUB (substitution), INS (insertion), DEL (deletion) or LEN (homopolymer deletion) 7. ModelScore: defined only for LEN mutation. Deletions in homopolymers are indicated by the LEN mutation type. This type of mutation is determined by matching the observed dis- tribution of HP (homopolymer) length in the reads to a set of possible models. Two alleles will be present in the output table when the best matching model is the mixture of the 3.11. Resequencing Summary Report 3.12. The Mutation Analysis Report
17 Helicos Single-Molecule Sequencing of Bacterial Genomes Table 1 Mutation Table resulting from an alignment of the sequence generated from Escherichia coli K12 MG1655 to the E. coli EDL933 reference sequence Part A Num RefName Start End Ref Type Model score Shift Allele 1 Allele2 Depth Count 1 Count 2 14722 gi|56384585|gb|AE005174.2| 1671091 1671091 A SUB 0 G 252 233 14718 gi|56384585|gb|AE005174.2| 1670442 1670442 C SUB 0 G 232 225 14719 gi|56384585|gb|AE005174.2| 1670606 1670606 T SUB 0 C 230 228 14720 gi|56384585|gb|AE005174.2| 1670736 1670736 G SUB 0 T 223 218 14717 gi|56384585|gb|AE005174.2| 1670224 1670224 T SUB 0 C 179 170 14721 gi|56384585|gb|AE005174.2| 1670843 1670843 A SUB 0 G 173 168 29003 gi|56384585|gb|AE005174.2| 3109283 3109283 G SUB 0 A G 172 56 112 14723 gi|56384585|gb|AE005174.2| 1671310 1671310 C SUB 0 T 164 162 4359 gi|56384585|gb|AE005174.2| 406325 406325 C SUB 0 T C 157 41 114 29002 gi|56384585|gb|AE005174.2| 3109275 3109275 T SUB 0 C T 151 70 78 9367 gi|56384585|gb|AE005174.2| 867170 867170 A SUB 0 G 122 120 53715 gi|56384585|gb|AE005174.2| 5210721 5210721 G SUB 0 T G 111 41 66 51180 gi|56384585|gb|AE005174.2| 5013503 5013503 T SUB 0 G T 109 28 79 40900 gi|56384585|gb|AE005174.2| 4076594 4076594 T SUB 0 C T 108 41 67 51432 gi|56384585|gb|AE005174.2| 5029061 5029061 T SUB 0 C T 101 42 59 42574 gi|56384585|gb|AE005174.2| 4225504 4225504 N SUB 0 C 100 98 34786 gi|56384585|gb|AE005174.2| 3572816 3572816 A SUB 0 A C 98 41 55 (continued)
18 Steinmann et al. Part B Num Freq1 Freq2 p-Value1 p-Value2 Freq A Freq C Freq G Freq T Freq - 14722 0.924603 0 0.0238095 0 0.924603 0 0.0515873 14718 0.969828 0 0.0043103 0 0.969828 0 0.0258621 14719 0.991304 0 0 0.991304 0 0 0.0086957 14720 0.977578 0 0 0 0 0.977578 0.0224215 14717 0.949721 0 0.0055866 0.949721 0 0 0.0446927 14721 0.971098 0 0 0 0.971098 0 0.0289017 29003 0.325581 0.651163 7.48E-90 1.79E-223 0.325581 0 0.651163 0 0.0232558 14723 0.987805 0 0.0060976 0 0 0.987805 0.0060976 4359 0.261146 0.726115 1.18E-61 1.71E-236 0 0.726115 0 0.261146 0.0127389 29002 0.463576 0.516556 2.29E-125 1.74E-144 0 0.463576 0 0.516556 0.0198676 9367 0.983607 6.87E-286 0.0081967 0 0.983607 0 0.0081967 53715 0.369369 0.594595 5.97E-69 2.47E-128 0 0.009009 0.594595 0.369369 0.027027 51180 0.256881 0.724771 2.19E-42 2.87E-164 0.0091743 0 0.256881 0.724771 0.0091743 40900 0.37963 0.62037 1.49E-69 3.92E-132 0 0.37963 0 0.62037 0 51432 0.415842 0.584158 2.67E-73 3.23E-114 0 0.415842 0 0.584158 0 42574 0.98 4.49E-233 0 0.98 0 0 0.02 34786 0.418367 0.561224 9.92E-72 3.52E-105 0.418367 0.561224 0 0.0102041 0.0102041 Table 1 (continued)
19 Helicos Single-Molecule Sequencing of Bacterial Genomes Part C Num p-Value A p-Value C p-Value G p-Value T p-Value - Flanking 14722 0.00052 0 0.000336 GCGACAGCAGTAAGACTTCCTTCCTAGTATTGCTTACGCCAGAG AAATAAC 14718 0.59641 0 0.186581 TTTCACTGTTGAAGCCGCCGGTAGTCACCGCCCAGTGCAGTGCC TCACGAT 14719 0 0.893853 TGTGCCCGTTTCGATGGCGGTACAGTAGGTTTTCGCTCAAGCAAC AGCGCA 14720 0 0.307612 CCCATACCCGACGATAACCATACGTGGGCAGCTCTCCGATAACAT GGTGTA 14717 0.50345 0 0.010203 GTCACGCTTTATCGTTTTCACGAAGTTCTCTGCTATTCCGTTACT CTCCGG 14721 0 0.15894 TCATCGGTTCGTCTGAGAATGACGTACAACTGCGCACGCGACAC CCGGAGA 29003 7.48E-90 1.79E-223 0.315601 ACGCCGCATCCGACATCTAACGCCCGAGCCGGTTGCCTGATGCG ACGCTGG 14723 0.47345 0 0.934513 AAGACTATCACTTATTTAAGTGATACTGGTTGTCTGGAGATTCAGG GGGCC 4359 1.71E-236 1.18E-61 0.73285 ACCGATGCCTGATGCGCCGCTGACGCGACTTATCAGGCCTACGG GGTGAAC 29002 2.29E-125 1.74E-144 0.454427 AAGCGGTCACGCCGCATCCGACATCTAACGCCCGAGCCGGTTGC CTGATGC 9367 0.37944 6.87E-286 0.868376 TTGCGTCAGCAACGGCCCGTAGGGCAAGCGAAGCGAGTCATCCT GCACGAC 53715 0.352165 2.47E-128 5.97E-69 0.276962 GTAAACGCCTTATCCGGCCTACGGAGGGTGCGGGAATTTGTAGG CCTGATA (continued)
20 Steinmann et al. Table 1 (continued) Part C Num p-Value A p-Value C p-Value G p-Value T p-Value - Flanking 51180 0.34708 2.19E-42 2.87E-164 0.836628 CGCAAATTCAATATATTGCAGAGATTGCGTAGGCCTGATAAGCGT AGCGCA 40900 1.49E-69 3.92E-132 ATAAGCCGCTTTCTTTTGGGTATAGTGTCGTGGACAGTCATTCAT CTTTCT 51432 2.67E-73 3.23E-114 TTGCGGCACTGGAGTTTGGCAACAGTGCCGGATGCGGCGCAAG CGCCTTAT 42574 4.49E-233 0.492269 TGTNTGGCAGTTTATGGCGGGCGTCNTGCCCGCCACCCTCCGG GCCGTTGC 34786 9.92E-72 3.52E-105 0.318375 0.803853 GGTAACCCTGAGCACGCAGTTCTTCAGTCAGGCGTGGTGCACC GTAACGCT The complete table was sorted for descending depth and then for ascending p-values for allele 1. Only the first 17 lines of the table are presented. It is divided into three parts for ease of viewing
21 Helicos Single-Molecule Sequencing of Bacterial Genomes distributions corresponding to the two lengths. The score with which the best matching model matches the data is the model score. The closer it is to one the better the match. A score above .98 is a good score. A score of .99 and above is an excellent score. A score below .95 is not particularly good. In order to be confident of a length mutation, it is necessary to both have a good model score and a low p-value. 8. Shift: 0 for substitutions and deletions negative for insertions. A shift of −1 indicates that the insertion is immediately to the left of the position indicated. A shift of −2 indicates that the insertion is to the left of the first insertion at −1. 9. Allele1/Allele2: this indicates the nucleotide composition of each allele. 10. Depth: the number of reads that span the mutation. A mini- mum depth of 20 is acceptable for mutation calling for any diploid organism when there are no mixtures of strains. The table can be filtered to exclude SNPS in locations with depths less than 20. 11. Count1/Count2: the number of reads that have each one of the alleles. 12. Freq1/Freq2: frequency of each allele that is Count i/Freq i where i=1 or 2. 13. p-Value1/p-Value2: each variation has a p-value associated with it. This is the probability that the mutation observed was generated by chance due to sequencing errors. It is recom- mended to consider only mutations for which the allele with maximum p-value is 1e-10 or less. Such data is generated automatically by including p-valueThreshold=1e-10 in the config file. 14. Freq A/C/G/T/-: counts/depth for each nucleotide type. 15. p-Value A/C/G/T/-: p-values for each of the nucleotides. 16. Flanking: flanking region for mutation with an additional 25 nucleotides on each side. 1. The method used for bacterial DNA isolation is dependent upon the bacterial source. The Qiagen kit has been used suc- cessfully for bacterial DNA isolation. It can be used for Gram-negative and some Gram-positive bacteria. Various phenol–chloroform extraction and isopro- panol precipitation methods have also successfully been used to purify bacterial DNA for sequencing. We discourage the 4. Notes
22 Steinmann et al. use of any protocol that involves bead-beating, as it has been shown to reduce the yield of DNA in the correct size range for sequencing. 2. For higher throughput applications, the Covaris E210 Instrument uses the same shearing parameters as the S2 instrument, but is capable of shearing up to 96 samples unat- tended. Higher throughput enzymatic methods for obtaining fragment sizes between 200 and 300 bp (New England Biolabs, Ipswich, MA; Epicentre® Biotechnologies, Madison, WI) that are compatible with this protocol can also be used. 3. Axygen MAXYMum Recovery tubes have been shown to increase sample yield and reduce variability in the polyA tailing reaction. MAXYMum Recovery tubes should be used through- out the sample preparation process and for sample storage. 4. 4–20% Gradient gels should be used in these steps. They opti- mize both the ability to determine that there is no detectable DNA less than 50 bp after size selection and the ability to visualize the TR oligo in the control tailing reaction. 5. The TR oligo and dATP should be purchased from Helicos BioSciences Corporation. The reagents have been optimized to produce correct tail lengths and stabilized to permit long- term storage. 6. Smaller quantities of DNA can be sheared. If the sample reac- tion is modified to use 0.5–1 pmole of DNA (see Note 11) and the control reaction is modified to use 0.5 pmoles of DNA (see Note 13), as little as 100 ng of high quality DNA can be used at this step. 7. If you notice you are removing beads during aspiration, do not attempt to remove all the beads with a p1000 pipette. Rather, remove the last 20–50 mL with a p200 pipette. 8. If 100 ng of DNA has been sheared, the elution volumes should be reduced to 10 mL in both steps 12 and 15. In all cases, care should be taken to avoid getting beads in the supernatant. This can be achieved more easily by using a p10 pipette to aspirate the supernatant and by leaving the last microliter behind. 9. Care should be taken to avoid touching the gel. Clean containers and clean gloves should be used. 10. This gel step is largely a QC step. If you are processing many similar samples and find through initial gel studies that they shear to approximately the same size, this gel step can be omitted and an average size be used in subsequent calcula- tions. Portions of the sheared samples may be retained to run on a gel for troubleshooting purposes if the tailing reaction does not succeed.
23 Helicos Single-Molecule Sequencing of Bacterial Genomes 11. If sample is limiting, as little as 1 pmole of DNA can be put in a 40-mL sample reaction. For quantities of DNA less than 3 pmoles, the amount of dATP added must be scaled down in proportion to the amount of DNA added (e.g., for 2 pmoles of DNA, add 2.8 mL of dATP to the sample master mix; for 1 pmole, add 1.4 mL dATP). For quantities less than 1 pmole, the volume of the entire reaction should be scaled down (e.g., for 0.5 pmoles of DNA, the DNA should be in a final volume of 13 mL. The sample master mix should contain 2.2 mL of 10× terminal transferase buffer, 2.2 mL of CoCl2 (2.5 mM), 1.4 mL of a 1:2 dilution of HelicosTM PolyA Tailing dATP in water, 0.8 mL distilled water and 1.1 mL terminal transferase enzyme (20 U/mL) per sample. Seven microliters of sample master mix should be added to each 0.5 pmole DNA tube). 12. The mixing step is crucial to the success of the tailing reaction. 13. If sample is limiting, the control reaction can be scaled down to use 0.4 pmoles of DNA. The DNA should be in a final volume of 12 mL and 1 mL of a 1:2 dilution of the HelicosTM PolyA Tailing Control Oligo TR in water should be added. Two microliter of TR oligo should be used in the Oligo TR Control. The control master mix should contain 2.2 mL of 10× terminal transferase buffer, 2.2 mL of CoCl2 (2.5 mM), 1.4 mL of a 1:2 dilution of HelicosTM PolyA Tailing dATP in water, 0.8 mL of distilled water and 1.1 mL terminal trans- ferase enzyme (20 U/mL) per sample. Seven microliters of control master mix should be added to each tube. Scaling this reaction down does preclude verifying the outcome of a short tail correction reaction (steps in Subheading 3.6). 14. It is essential to chill the block to 0°C in an ice and water slurry, and cool the DNA as quickly as possible to 0°C to prevent re-annealing of the denatured, single-stranded DNA products. 15. The size of the single-stranded polyA tailed samples cannot be determined by direct comparison to the double-stranded DNA ladders. The migration patterns of TR oligos contain- ing dA90 and dA200 were determined experimentally. Acknowledgments The authors would like to acknowledge the valuable contribu- tions of Katica Ilic, Kristen Kerouac, and Eldar Giladi.
24 Steinmann et al. References 1. Eliminating amplification bias from genome analysis. Helicos BioSciences Corporation Tech Note, Available for download at: http:/ /helicosbio.com/HeliSphereCenter/ PublicationsLibrary/HelicosMarketing Collateral/tabid/168/Default.aspx. 2. MacLean, D., Jones, J. D. G., and Studholme, D. J. (2009) Application of ‘next-generation’ sequencing technologies to microbial genet- ics. Nat Rev Microbiol 7, 287–296. 3. Holt, K. E., Parkhill, J., Mazzoni, C. J., Roumagnac, P., Weill, F. -X., Goodhead, I., Rance, R., Baker, S., Maskell, D. J., Wain, J., Dolecek, C., Achtman, M., and Dougan, G. (2008) High-throughput sequencing pro- vides insights into genome variation and evo- lution in Salmonella Typhi. Nat Genet 40, 987–993. 4. Harris, S. R., Feil, E.J., Holden, M. T. G., Quail, M. A., Nickerson, E. K., Chantratita, N., Gardete, S., Tavares, A., Day, N., Lindsay, J. A., Edgeworth, J. D., de Lencastre, H., Parkhill, J., Peacock, S. J., and Bentley, S. D. (2010) Evolution of MRSA during hospital and inter- continental spread. Science 327, 469–474. 5. Smith, E. E., Buckley, D. G., Wu, Z., Saenphimmachak, C., Hoffman, L. R., D’Argenio, D. A., Miller, S. I., Ramsey, B. W., Speert, D. P., Moskowitz, S. M., Burns, J. L., Kaul, R. and Olson, M. V. (2006) Genetic adaptation by Pseudomonas aeruginosa to the airways of cystic fibrosis patients. Proc Natl Acad Sci USA 103, 8487–8492. 6. Mwangi, M. M., Wu, S. W., Zhou, Y., Sieradzki, K. de Lencastre, H., Richardson, P., Bruce, D., Rubin, E., Myers, E., Siggia, E. D., and Tomasz, A. (2007) Tracking the in vivo evolution of multidrug resistance in Staphylococcus aureus by whole-genome sequencing. Proc Natl Acad Sci USA 104, 9451–9456. 7. La Scola, B., Elkarkouri, K., Li, W., Wahab, T., Fournous, G., Rolain, J. -M., Biswas, S., Drancourt, M., Robert, C., Audic, S., Lofdahl, S., and Raoult, D. (2010) Rapid comparative genomic analysis for clinical microbiology: the Francisella tularensis paradigm. Genome Res 18, 742–750. 8. Srivatsan, A., Han, Y., Peng, J., Tehranchi, A. K., Gibbs, R. Wang, J. D. and Chen, R. (2008) High-precision, whole-genome sequencing of laboratory strains facilitates genetic studies. PLoS Genet 4, e1000139. 9. Dohm, J. C., Lottaz, C., Borodina, T. and Himmelbauer, H. (2008) Substantial biases in ultra-short read data sets from high-through- put DNA sequencing. Nucleic Acids Res 36, e105. 10. Hillier, L. W., Marth, G. T., Quinlan, A. R., Dooling, D., Fewell, G., Barnett, D., Fox, P., Glasscock, J. I., Hickenbotham, M., Huang, W., Magrini, V. J., Richt, R. J., Sander, S. N., Stewart, D. A., Stromberg, M., Tsung, E. F., Wylie, T., Schedl, T., Wilson, R. K., and Mardis, E. R. (2008) Whole-genome sequenc- ing and variant discovery in C. elegans. Nat Methods 5, 183–188. 11. Harismendy, O., Ng, P. C., Strausberg, R., L., Wang, X., Stockwell, T. B., Beeson, K. Y., Schork, N. J., Murray, S. S., Topol, E. J., Levy, S. and Frazer, K. A. (2009) Evaluation of next generation sequencing platforms for population targeted sequencing studies. Genome Biol 10, R32.
25 Chapter 2 Whole-Genome Sequencing of Unculturable Bacterium Using Whole-Genome Amplification Yuichi Hongoh and Atsushi Toyoda Abstract More than 99% of microorganisms on the earth are unculturable with known culturing techniques. The emergence of metagenomics with high-throughput sequencing technologies has enabled researchers to capture a comprehensive view of a complex bacterial community which comprises both culturable and unculturable species. However, the function of an individual species remains difficult to elucidate in a conventional metagenomic study, which generates numerous genomic fragments of unidentifiable ori- gins at a species or genus level. This limitation hampers any in-depth investigations of the community and its unculturable bacterial members. Recently, as an alternative or compensatory approach, genomics tar- geting a single unculturable bacterial species in a complex community has been proposed. In this approach, whole-genome amplification technique using Phi29 DNA polymerase is applied to obtain a sufficient quantity of DNA for genome sequence analysis from only a single to a thousand bacterial cells. It is expected that a combination of the conventional metagenomics and this single-species-targeting genomics provides a great progress in understanding of the ecology, physiology, and evolution of uncul- turable microbial communities. Key words: Whole-genome amplification, Phi29 DNA polymerase, Pyrosequence, Uncultivable, Uncultured, Environmental genomics, Metagenomics, Single-cell genomics, Termite, Symbiosis Culture-independent, molecular approaches have enabled researchers to explore the world of unculturable microorganisms since the 1990s. Molecular tools such as clone analysis and fluo- rescent in situ hybridization analysis, targeting small subunit (SSU) rRNA, have been applied to a wide variety of environmen- tal samples and revealed the existence of an enormous number of largely unknown, uncultured assemblages of microorganisms. 1. Introduction Young Min Kwon and Steven C. Ricke (eds.), High-Throughput Next Generation Sequencing: Methods and Applications, Methods in Molecular Biology, vol. 733, DOI 10.1007/978-1-61779-089-8_2, © Springer Science+Business Media, LLC 2011
26 Hongoh and Toyoda However, their functions have been mostly inaccessible until the emergence of metagenomics. Metagenomics with high-throughput sequencing technolo- gies is a powerful tool to uncover the “black box” of bacterial communities, which generally consist of both culturable and unculturable species. In a conventional metagenomic study, DNA is extracted from a heterogeneous microbial community, frag- mented, and sequenced to generate tens of megabases to several gigabases in total. Metagenomics reveals the functions of a bacte- rial community as a whole and the diversity of various genes within the community, and it is also useful to find novel genes encoding enzymes industrially or medically applicable. However, the function of an individual bacterial species remains largely unknown because the origins of most fragments generated in such metagenomic studies are generally unidentifi- able beyond a class level. Recently, to compensate this limitation in metagenomics, genomics targeting a single species of uncultur- able bacteria in a complex community has been proposed. This novel approach applies whole-genome amplification (WGA) using Phi29 DNA polymerase to prepare sufficient DNA quantities for the genome sequence analysis (1) (Fig. 1). To date, a couple of studies reported draft-genome sequences from single bacterial cells (2, 3), and two studies reported the complete genome sequences from 102 to 103 cells (4, 5), whereas ³1010 cells are required for a conventional genome sequence analysis. Here, we describe a protocol to acquire the complete genome sequence from 102 to 103 cells of a single bacterial species. We use an endosymbiotic bacterial species found inside the cells of pro- tists (single-celled eukaryote) in termite gut as an example. This method is applicable to other samples with certain modifications as long as 102 to 103 cells of a single bacterial species or strain can be collected. In the case that only a single or a few bacterial cells are collectable, the sequencing analysis will result in draft status with numerous contigs remaining (2, 3, 6, 7). Fig. 1. Outline of multiple displacement amplification.The whole genome regions can be amplified by the action of Phi29 DNA polymerase with random hexamers.
27 Whole-Genome Sequencing of Unculturable Bacterium 1. An inverted phase-contrast microscope equipped with two sets of the micromanipulator TransferMan NK2 and CellTram Vario (Eppendorf, Hamburg, Germany) (see Note 1). 2. Glass capillary: 15 mm diameter (Eppendorf) (see Note 2). 3. Glass capillary: 30–100 mm diameter (custom-made, Eppendorf). 4. 1.0% Nonidet P-40 (NP-40) (see Note 3): Sterilize with a 0.22 mm filter and the ultra violet (UV). For UV-sterilization, put the solution in a plastic tube in a UV-crosslinker for 10 min. Store in single-use aliquots at −20°C. 5. Trager’s solution U (sol U) (see Note 4): 37 mM NaCl, 9.2 mM NaHCO3 , 5.1 mM Na3 C6 H8 O7 ⋅2H2 O, 13 mM KH2 PO4 , 0.75 mM CaCl2 , 0.40 mM MgSO4 . Sterilize with a 0.22-mm filter and UV. Store in single-use aliquots at −20°C. 1. GenomiPhi HY DNA amplification kit (GE Healthcare, Hemel Hempstead, UK) (see Note 5). Store the enzyme at −70°C. The other components can be stored at −20°C. 2. Lysis buffer (LB) (2×): 400 mM KOH, 100 mM dithio­ threitol, 10m Methylenediaminetetraacetic acid (EDTA)⋅2Na⋅2H2 O. Sterilize with UV-irradiation and store at −20°C. It can be stored for 2 weeks. 3. Neutralization buffer (NB): 600 mM Tris–HCl, pH 7.5, 400 mM HCl (final pH 6.0). Sterilize with UV-irradiation and store at −20°C. 4. Tris–EDTA (TE) buffer: 10 mM Tris–HCl, pH 8.0, and 1 mM EDTA. 1. Taq DNA polymerase: e.g., EX-Taq polymerase (Takara, Tokyo, Japan). 2. Proof-reading DNA polymerase: e.g., Phusion (Finnzymes, Espoo, Finland). 3. PCR primers: bacteria-specific, 27 F (5¢- AGRGTTT GATYMTGGCTCAG) and 1492R (5¢- GGHTACCTTGTT ACGACTT); Archaea-specific, A25F (5¢- CYGKTTGATC CTGSCRG) and A1385R (5¢- GGTGTGTGCAARGAGCA); Eukarya-specific, E18F (5¢- GATCCMGGTTGATYCTGCC) and E1772R (5¢- CWDCBGCAGGTTCACCTAC). 2. Materials 2.1. Micromanipulation of Microbial Cells 2.2. Cell Lysis and WGA 2.3. Purity Check
28 Hongoh and Toyoda Because WGA can amplify a small amount of contaminant DNA, the handling of samples and reagents should be conducted with extreme caution. Wear disposable gloves, clean up, and bleach the benches and equipments to eliminate DNA contamination sources, use UV-sterilized filter tips and plastic tubes, and per- form experiments under a laminar flow cabinet. 1. Apply 2 ml of 1× LB into a sterile, 0.2-ml PCR tube and incubate on ice or a PCR-cooler. 2. Attach a glass capillary of 30–100 mm diameter to one of the two micromanipulators. The diameter of the capillary depends on the size of the host protist cells harboring the target bacte- rial symbiont. 3. Mark the position corresponding to the depth of a 0.2-ml PCR tube on a glass capillary of 15 mm diameter (Fig. 2), and attach it to the other micromanipulator. 4. Put the lid of a sterile, plastic Petri dish, upside down, on the stage of the inverted microscope. Apply 50 ml of sol U, five to ten times, onto the inner surface of the lid (Fig. 3). 5. Dissect a termite and remove the gut with forceps. 6. Puncture the dilated portion of the hindgut in one of the 50-ml drops of sol U on the lid. 7. Remove the gut from the suspension. 8. Dip the tip of the 30–100-mm diameter capillary and carefully collect several cells of the host protist species. There is no need to eliminate other species of protists and free-swimming bacteria at this step. 3. Methods 3.1. Collection of Bacterial Cells by Micromanipulation Fig. 2. Collection of bacterial cells by micromanipulation into a 0.2-ml PCR tube.
29 Whole-Genome Sequencing of Unculturable Bacterium 9. Release the collected cells into another 50 ml drop of sol U. 10. Collect the host protist cells. 11. Wash the cells by repeating steps 9 and 10 more than four times. 12. Change the capillary to a new one with the same diameter. 13. Apply 50 ml of 1% NP-40 onto the inner side of the lid of a new Petri dish (see Notes 3 and 6). 14. Collect a single cell of the host protist with the capillary and keep it within its tip. 15. Replace the lid of the Petri dish on the stage by the lid with 1% NP40 prepared in step 13. 16. Dip the tip of the 15-mm diameter capillary in the 1% NP-40 drop and adjust the pressure inside the capillary by handling the CellTram Vario. Be careful not to completely expel 1% NP-40 within the capillary. Bubbles make the phase-contrast image unclear. Keep the capillary tip within the eye field of the microscope. 17. Dip the tip of the 30–100-mm diameter capillary near the tip of the 15-mm diameter capillary in the 1% NP-40 drop and carefully release the host protist cell. 18. Within a few minutes, the endosymbiotic and ectosymbiotic bacterial cells will detach or leak out from the host protist cell. 19. Collect the bacterial cells as many as possible with the 15-mm diameter capillary. 20. Release the collected cells into LB in the PCR tube. Use the mark on the capillary in order not to break the fine tip of the glass capillary. 1. Incubate the collected bacterial cells in 1× LB on ice or a PCR-cooler for 10 min (see Note 7). 2. Prepare and perform the negative control reaction in parallel with the sample reaction. 3. Add 1.0 ml NB and mix briefly. 4. Add 22 ml sample buffer and mix briefly. 3.2. Whole-Genome Amplification Fig. 3. Drops of buffer on the inner surface of the lid of a Petri dish.
30 Hongoh and Toyoda 5. Prepare reaction mixture: mix 2.5 ml enzyme solution and 22.5 ml reaction buffer by pipetting. 6. Add the reaction mixture to the sample mixture. 7. Incubate at 30°C for 2.5 h. 8. Stop the reaction by incubating at 65°C for 10 min. 9. Check the amplification by agarose gel electrophoresis (see Note 8). 10. Purify DNA by ethanol precipitation. 11. Dissolve the precipitate in 50 ml TE. 12. Measure the DNA concentration. Before the genome sequence analysis, the purity of the WGA sample must be checked by clone analysis of genes such as SSU rRNA. If amplification of the genes by PCR from the negative control reaction is observed, the sample should not be used for further analyses. 1. Prepare 1:200-fold dilution of the purified WGA sample dis- solved in TE and of the negative control reaction without purification. Use 1/10 volume as the template for the follow- ing PCR. 2. Perform PCR using primer sets specific to eubacterial, archaeal, and eukaryotic SSU rRNA genes, respectively, and also those specific to protein-coding genes such as hsp60 and gyrB. Always perform the negative control experiment for PCR. PCR conditions: 95°C 30 s, 25 cycles of (95°C 10 s, 50°C 30 s, 72°C 2 min), 72°C 4 min. 3. If there is no PCR amplification from the negative control sample either for WGA or PCR, and only PCRs using bacteria- specific primers generate products from the WGA sample, move to the next step. 4. Perform PCR amplification of eubacterial 16S rRNA genes with a proof-reading DNA polymerase. 5. Clone and sequence the PCR products with standard methods. 6. Check whether the genomes of the target bacterial species predominate in the sample and also evaluate within-species variations of the target bacterium. After the purity check of the WGA sample, prepare a library for the pyrosequencer 454 GS FLX, exactly following the protocol distributed by Roche Diagnostics (see Note 9). It includes nebu- lization, end-polishing using T4 DNA polymerase, and adapter ligation. Because WGA generally accompanies amplification bias among the genome regions (Fig. 4), a deeper redundancy is necessary for acquiring a complete genome sequence. First, try 3.3. Checking Purity of Sample 3.4. Genome Sequencing Using 454 GS FLX
31 Whole-Genome Sequencing of Unculturable Bacterium pyrosequencing in a small scale and check the amplification bias and the purity. If the bias appears too large, it may be better to try another sample. Finishing can be done with a standard gap- closing procedure using a Sanger method. 1. It is possible to conduct the whole procedure with a single micromanipulator set, but the risk for making mistakes is much higher. When only a single set is available, carefully dip the tip of the 15-mm diameter capillary, as mentioned in step 16 of Subheading 3.1, at a position distant from the released host protist cell in the 1% NP-40 drop in order not to blow away the cell. 2. If one needs to collect only a single or a few bacterial cells, use a glass capillary of 4 mm diameter, though the handling is more difficult. 3. NP-40 is necessary to rupture the membrane structure of the host protist, and also useful to break the surface tension of the drop on the lid of the Petri dish. This makes the phase- contrast image clearer and is considerably helpful for the col- lection of bacterial cells by micromanipulation. 4. Sol U buffer is specifically adjusted for the protists in termite gut (8). One should use buffer adequate to each type of samples. 5. One can use other kits for WGA such as REPLI-g Midi (Qiagen, Düsseldorf, Germany). In any case, one must first check the purity of the purchased kit in a preliminary experiment; occasionally there are lots containing non-negligible amount 4. Notes Fig. 4. Bias among genome regions caused by whole-genome amplification (WGA).Typical patterns in genome sequence analyses without (above) and with WGA (below).
32 Hongoh and Toyoda of DNA contaminants. Although those lots are available for a standard use recommended by the manufacturers, they should not be used in WGA from less than 104 bacterial cells. 6. There are bacterial species sensitive to detergent (e.g., spiro- chetes). In that case, use buffer or sterile water, instead of NP-40, to collect the bacterial cells, although a very small amount of NP-40 should be added (a touch by a tip is enough) to the drop in order to obtain a clearer phase-contrast image. 7. There are bacterial species of which cells are not degradable under this alkaline condition. It is recommended to confirm the degradability in a preliminary experiment. 8. Possibly, the negative control may also generate considerable WGA products even without exogenous DNA contaminants. This can be caused by the amplification from primer dimers and indigenously contaminated DNA. Unless PCR amplifica- tion of genes from the negative control for WGA is observed, one can use the WGA sample. It is suggested that the background amplification can be suppressed by an addition of trehalose (9). Alternatively, the use of GenomiPhi v2 or REPLI-g UltraFast Mini also dimin- ishes the background amplification. Because these methods generate lesser amounts of WGA products, a second amplifi- cation step using GenomiPhi HY or REPLI-g Midi should be performed to obtain an enough amount of DNA (15–50 mg) for the genome sequence analysis. 9. For the genome sequence analysis, we recommend a hybrid use of 454 GS FLX and Illumina GA and do not recommend mate-pair analysis with a long insert, as suggested in a recent literature (7). WGA generates chimeric sequences (10) and the rate of their formation greatly increases in a traditional library construction for a Sanger method (11). Thus, the handling of data generated with a Sanger method needs cau- tion. If one needs to prepare a library for a Sanger method, a S1 nuclease treatment is recommended, which reportedly decreases the frequency of chimeras (11). In any case, increase of the sequence depth by using high-throughput sequencing technologies is still considered the best way to eliminate chi- meras and other artifacts in the assembling process. Acknowledgment The authors would like to thank Drs. M. Ohkuma, M. Hattori, and other coworkers for supporting our studies.
33 Whole-Genome Sequencing of Unculturable Bacterium References 1. Dean, F. B., Hosono, S., Fang, L., Wu, X., Faruqi, A. F., Bray-Ward, P., et al. (2002) Comprehensive human genome amplification using multiple displacement amplification, Proc. Natl. Acad. Sci. U. S. A. 99, 5261–5266. 2. Marcy, Y., Ouverney, C., Bik, E. M., Losekann, T., Ivanova, N., Martin, H. G., et al. (2007) Dissecting biological “dark matter” with sin- gle-cell genetic analysis of rare and uncultivated TM7 microbes from the human mouth, Proc. Natl. Acad. Sci. U. S. A. 104, 11889–11894. 3. Woyke, T., Xie, G., Copeland, A., Gonzalez, J. M., Han, C., Kiss, H., et al. (2009) Assembling the marine metagenome, one cell at a time, PLoS One 4, e5299. 4. Hongoh, Y., Sharma, V. K., Prakash, T., Noda, S.,Taylor,T.D.,Kudo,T.,etal.(2008)Complete genome of the uncultured Termite Group 1 bac- teria in a single host protist cell, Proc. Natl. Acad. Sci. U. S. A. 105, 5555–5560. 5. Hongoh, Y., Sharma, V. K., Prakash, T., Noda, S., Toh, H., Taylor, T. D., et al. (2008) Genome of an endosymbiont coupling N2 fixation to cellulolysis within protist cells in termite gut, Science 322, 1108–1109. 6. Podar, M., Abulencia, C. B., Walcher, M., Hutchison, D., Zengler, K., Garcia, J. A., et al. (2007) Targeted access to the genomes of low-abundance organisms in complex microbial communities, Appl. Environ. Microbiol. 73, 3205–3214. 7. Rodrigue, S., Malmstrom, R. R., Berlin, A. M., Birren, B. W., Henn, M. R., and Chisholm, S. W. (2009) Whole genome amplification and de novo assembly of single bacterial cells, PLoS One 4, e6864. 8. Trager, W. (1934) The cultivation of a cellu- lose-digesting flagellate, Trichomonas termop- sidis, and of certain other termite protozoa, Biol. Bull. 66, 182–190. 9. Pan, X., Urban, A. E., Palejev, D., Schulz, V., Grubert, F., Hu, Y., et al. (2008) A procedure for highly specific, sensitive, and unbiased whole-genome amplification, Proc. Natl. Acad. Sci. U. S. A. 105, 15499–15504. 10. Lasken, R. S., and Stockwell, T. B. (2007) Mechanism of chimera formation during the Multiple Displacement Amplification reac- tion, BMC Biotechnol. 7, 19. 11. Zhang, K., Martiny, A. C., Reppas, N. B., Barry, K. W., Malek, J., Chisholm, S. W., and Church, G. M. (2006) Sequencing genomes from single cells by polymerase cloning, Nat. Biotechnol. 24, 680–686.
Highthroughput Next Generation Sequencing Methods And Applications 1st Edition Kathleen E Steinmann
Part II Gene Expression Analysis
Highthroughput Next Generation Sequencing Methods And Applications 1st Edition Kathleen E Steinmann
37 Chapter 3 RNA Sequencing and Quantitation Using the Helicos Genetic Analysis System Tal Raz, Marie Causey, Daniel R. Jones, Alix Kieu, Stan Letovsky, Doron Lipson, Edward Thayer, John F. Thompson, and Patrice M. Milos Abstract The recent transition in gene expression analysis technology to ultra high-throughput cDNA sequencing provides a means for higher quantitation sensitivity across a wider dynamic range than previously possible. Sensitivity of detection is mostly a function of the sheer number of sequence reads generated. Typically, RNA is converted to cDNA using random hexamers and the cDNA is subsequently sequenced (RNA-Seq). With this approach, higher read numbers are generated for long transcripts as compared to short ones. This length bias necessitates the generation of very high read numbers to achieve sensitive quantitation of short, low-expressed genes. To eliminate this length bias, we have developed an ultra high-throughput sequencing approach where only a single read is generated for each transcript molecule (single-molecule sequencing Digital Gene Expression (smsDGE)). So, for example, equivalent quantitation accuracy of the yeast transcriptome can be achieved by smsDGE using only 25% of the reads that would be required using RNA-Seq. For sample preparation, RNA is first reverse-transcribed into single-stranded cDNA using oligo-dT as a primer. A poly-A tail is then added to the 3¢ ends of cDNA to facilitate the hybridization of the sample to the Helicos® single-molecule sequencing Flow-Cell to which a poly dT oligo serves as the substrate for subsequent sequencing by synthesis. No PCR, sample-size selection, or ligation steps are required, thus avoiding possible biases that may be introduced by such manipulations. Each tailed cDNA sample is injected into one of 50 flow-cell channels and sequenced on the Helicos® Genetic Analysis System. Thus, 50 samples are sequenced simultaneously generating 10–20 million sequence reads on average for each sample channel. The sequence reads can then be aligned to the refer- ence of choice such as the transcriptome, for quantitation of known transcripts, or the genome for novel transcript discovery. This chapter provides a summary of the methods required for smsDGE. Key words: Single-molecule sequencing, smsDGE, Expression analysis Young Min Kwon and Steven C. Ricke (eds.), High-Throughput Next Generation Sequencing: Methods and Applications, Methods in Molecular Biology, vol. 733, DOI 10.1007/978-1-61779-089-8_3, © Springer Science+Business Media, LLC 2011
Other documents randomly have different content
one of the most successful and lucrative periodicals that history has upon record. 1756. Francois, marquis de Beauharnois, died at Paris. He was a member of the national assembly, and took part in the king's favor; subsequently joined the army under Conde; and was banished by Napoleon in 1807. The heroic wife of Lavalette was his daughter. 1757. The British under Admiral Watson took by assault, Houghley, situated about thirty miles above Calcutta. 1761. Edward Boscawen, the English admiral, died. He was born 1711, and entered the navy at an early age. He acquired honorable distinction under Vernon, and afterwards signalized himself in many important contests with the French, in which he had the singular fortune to take the French commander, M. Hoquait, a prisoner three times, viz. in 1744, 1747 and 1755. On his return to England in 1759, after destroying the Toulon fleet in the Mediterranean, he was rewarded with a pension of £3000 a year. 1763. Casper Abel, a voluminous German historian and antiquary, died. 1765. Stamp Act passed the British Parliament. How little did that body anticipate the consequences that were to follow their decision on that subject. 1776. The New Hampshire convention dissolved itself and assumed legislative powers, chose twelve counselors as an executive branch, and delegates to Congress, which were recognized. 1782. George Costard died. A classical, mathematical and oriental scholar, whose reputation as an author is chiefly derived from a History of Astronomy, highly appreciated in Europe. 1791. Vermont, the last of the thirteen original states which composed the Union, adopted the constitution and took her place in the confederacy. 1795. The French frigate Iphigenie, 32 guns, captured by the Spanish fleet off Catalonia.
1797. French sloop Atalante, 16 guns, captured off Scilly by the British frigate Phœbe, 36 guns, Capt. Barlow. 1800. The first soup establishment for the poor was opened at Spitalfields, London. 1806. The Dutch surrendered the cape of Good Hope to the British. 1808. Phillips Cosby, British admiral of the Red, died aged 78. 1809. Samana taken by the British, together with two privateers, and four vessels laden with coffee. 1812. London involved for several hours in impenetrable darkness. The sky, where any light pervaded it, showed the aspect of bronze. It was the effect of a cloud of smoke, which, from the peculiar state of the atmosphere, did not pass off. Were it not for the peculiar mobility of the atmosphere, this city of a hundred thousand chimneys would be scarcely habitable in winter. 1815. The British under Gen. Lambert having abandoned the enterprise on New Orleans began to re-embark their artillery and munitions, preparatory to a general retreat. 1816. The schooner Eliza cast away near Newport; the captain and crew saved by Com. Perry, who with part of the crew of the frigate Java, went five miles in a boat to their relief. 1824. Thomas Edward Bowditch, the African traveler, died. He went to Africa at the age of 21, and engaged in a series of expeditions into the country. In 1822 he went out from England with a view of devoting himself to the exploration of the African continent. He had only arrived at the mouth of the Gambia when a disease occasioned by fatigue and anxiety of mind put an end to his existence. 1833. Adrien Marie Legendre, so well known as a profound mathematician, died at Paris. His life work on geometry is much used. 1840. The uniform penny postage commenced in England; the number of letters despatched from London on this day being
112,000; the average, for January, 1839, being 30,000. 1840. Battle between the Russian and Khivian cavalry; the latter commanded by the khan in person were completely routed and pursued to the city of Khiva. 1848. Miss Caroline Herschel, member of the Royal astronomical society, London, died at Hanover. 1855. Mary Russel Mitford died, aged 68; a distinguished English authoress. 1856. Thomas H. Perkins, a wealthy and liberal Boston merchant, died aged 89. His was the first American firm engaged in the China trade. JANUARY 11. 395. Theodosius the Great, emperor of Rome, died. He was born about the year 346, and on coming to the throne distinguished himself by his orthodoxy, and his zeal against heresy and paganism. His public and private virtues, which procured him the name of The Great, will scarcely excuse the fierceness of his intolerance, or the barbarity of his anger and revenge. 1569. The first English lottery drawn at London. It continued day and evening four months. The prizes were money, plate and merchandise. It had been advertised two years at the time it took place. 1698. Peter, the czar of Russia, arrived in England and wrought as a mechanic in the dockyard at Deptford, as well as in the workshops of various mechanics, with view of carrying the English arts into his own country. He was well received by William III. 1751. A globular bottle of glass was made at Leith measuring 40 by 42 inches, the largest ever made in Britain. 1753. Sir Hans Sloane, the eminent English naturalist, died, aged 93. He was born at Killileagh in Ireland; studied medicine in London, and
settled there in the practice of his profession. He was the second learned man whom science tempted to America. His museum, composed of the rarest productions of nature, he bequeathed to the public, on condition of the payment of £20,000 annually to his family, and was the foundation of the British Museum. 1775. The first provincial congress of South Carolina met at Charleston. 1778. Charles Linne (or Linnæus), the Swedish botanist, died, aged 71. In his twenty-fourth year he conceived the idea of a new arrangement of plants, or a sexual system of botany. In 1732 the Academy of Sciences at Upsal appropriated 50 Swedish dollars to send him on a tour through Lapland, and with this small sum he made a journey of more than 3500 miles, unaccompanied, traversing the Lapland desert, and enduring many hardships. A series of offices and honors were conferred upon him, till in 1753 he was created a Knight of the Polar Star, an honor never before conferred on a literary man; and in 1761 he was elevated to the rank of nobility. 1778. A collection amounting to £3815 was made for the 924 American prisoners in England. Dr. Franklin, at Paris, applied to the British ambassador for an exchange of prisoners, but his lordship was pleased to return only the following answer: no application received from rebels unless they come to implore his majesty's pardon. 1782. Ostenburg, near Trincomalee, in the island of Ceylon, taken from the Dutch by the British Admiral Hughes. 1795. The French, under Pichegru, crossed the Waal on the ice at different points. 1800. William Newcome, archbishop of Armagh, died, aged 79. He rose gradually in the church to the primacy of Ireland; was a worthy man, and author of a great number of theological works. 1801. Cimarosa, the celebrated Italian musician, died.
1803. The Hindostan, East Indiaman, lost on the Culvers, off Margate, in a dreadful storm. 1805. Letters of marque and reprisal issued by Great Britain against Spain. 1807. Breig in Silesia surrendered to the French and Bavarians; 3 generals, 1400 Prussians, and considerable magazines were captured. 1810. In the night the mercury in three thermometers froze at Moscow and withdrew into the ball. At Iraish it was observed at -44½° of Fahrenheit immediately before it froze. 1811. Marie Joseph de Chenier, a French poet, died. By flattering the passions of the people he soon gained great popularity, and during the revolution was one of the most violent democrats. 1815. Cumberland island, Georgia, taken possession of by Capt. Barrie of the British ship Dragon. Same day British sloop of war, Barbadoes, Capt. Fleming captured privateer schooner Fox, of 7 guns and 72 men from Wilmington. 1817. Timothy Dwight, president of Yale college, died, aged 65. He entered Yale college at the age of 13, and became a tutor at 19. His health becoming impaired, by the advice of his physicians he traveled, walking 2000 and riding 3000 miles in the course of a year. It had the effect to restore his constitution completely. His published works consist of theology, poetry and travels. His biography is interesting; he was an uncommon character. 1829. Gregorio Funes, a patriot of La Plata, died at Buenos Ayres. He was actively engaged in the South American revolution from its commencement. He was also an author. 1839. Alexander Coffin, the last survivor of the original proprietors who settled the city of Hudson in 1784, died, aged 99. He was highly respected for his talents, integrity and usefulness. 1839. Earthquake at Martinique, which did great damage, particularly at Fort Royal, where only 18 houses were left standing,
of 1700, and 900 hundred sufferers were dug out of the ruins. 1843. Francis S. Key, district attorney of the United States and author of the national song, the Star Spangled Banner, died in Baltimore. 1853. Russia, Austria and Prussia, after considerable delay, finally acknowledge Napoleon III as emperor of France. 1853. The caloric ship Ericsson made her trial trip from New York to the Potomac. JANUARY 12. 400. B. C. Xenophon, with the 10,000, forced a passage through the defiles of Armenia. 1519. Maximilian I, emperor of Germany, died. He was elected king of the Romans 1486, and ascended the imperial throne 1493. Under him the Turks were checked in their enterprises against Germany, and repelled from his hereditary territories. 1598. The Marquis De la Roche received from Henry IV a commission to conquer Canada. He sailed from France with a colony of convicts from the prisons. He landed them on the Isle of Sable, and sailed for Acadie, from whence he returned to France. The survivors of the colony, twelve in number, were taken off seven years afterwards, and presented to the king in their sealskin clothes and long beards. He gave them fifty crowns each and pardoned their offences. 1640. An engagement of four days' duration near the Island Tamaraca, Brazils, between the Dutch and Portuguese, in which the latter were defeated and the Dutch admiral killed. 1678. A remarkable darkness at noon in England. 1777. General Mercer died of the wounds of the battle of Princeton. 1781. The states general of Holland issued letters of marque and reprisal against England.
1793. Arthur Lee, a distinguished American statesman, died at Urbana, Va. The long and faithful services which he rendered his country during his arduous struggles for independence, in the alternate character of ambassador and statesman, are universally known and acknowledged. 1794. John George Adam Forster died, aged 40. He was of Scotch descent, born in Prussia, studied at St. Petersburg, taught German and French in England, accompanied Cook in his voyage round the world, accepted the professorship of natural history at Hesse Cassel, was appointed historiographer of a Russian expedition round the world; this project being frustrated by the Turkish war, he went to Germany, and residing at Mentz when the French took that city 1792, was sent by the republicans to request a union of that city with France. During his absence the Prussians retook the city, by which he lost all his property, including his books and papers, and died soon after. The Germans number him among their classical writers. 1795. In consequence of a great thaw, the communication of the main army of the French under Pichegru and the four divisions that crossed the Waal the day before on the ice, was totally interrupted during two days. 1795. Mr. Pitt recommended in the British parliament that a premium be given by government to large families. 1805. British frigate Doris, Capt. Campbell, lost on the Diamond rock, Quiberon bay. The crew saved themselves and blew up the frigate. 1805. The thermometer at Danbury, Ct., stood at 19° below zero; being the coldest weather known there since 1780. 1807. A fatal explosion at Leyden, in Holland. A vessel containing 40,000 pounds of powder, moored before the house of Prof. Rau, exploded with a tremendous crash. Upwards of 200 houses were overthrown, besides churches and public buildings, 150 persons killed and 2000 wounded.
1809. Cayenne surrendered by the French, to the British and the Portuguese under Capt. Yeo. 1815. National fast in the United States. JANUARY 13. 857. Ethelwulf, son of Egbert, sometimes styled the first king of England, died. In his reign the tax called Peter's pence was levied. 1399. The Tartars, under Tamerlane, pillaged the imperial city of Delhi, and two days after wantonly massacred the entire Indian population. 1400. Richard II of England murdered. He came to the throne at the age of 11, and after a turbulent reign of 22 years, was deposed and imprisoned. 1404. It was enacted at this short parliament of Henry's that no chemist shall use his craft to multiply gold or silver. 1560. John de Lasci, a learned Pole, died. 1618. Galileo discovered the fourth satellite of Jupiter. 1669. John Bochius, a Dutch poet, died. He excelled in Latin, and is called the Virgil of the Low Countries. 1691. George Fox, founder of the sect of quakers, died, aged 67. His father was a poor weaver, and George was apprenticed to a shoemaker; but he left his employment and wandered about the country in a leather doublet, and finally set up as a teacher. He visited different countries, and had the satisfaction to see his tenets taking deep root in his life time. 1705. A house in London where fireworks were manufactured, blew up, and destroyed 120 houses, and killed 50 persons. 1711. The last No. of the Tatler appeared (No. 271). 1715. Great fire in Thames street, London; many lives lost.
1716. Elizabeth Patch died at Salem; the first female born in the old colony of Massachusetts. 1717. Maria Sybilla Merian, the distinguished painter, and writer on entomology, died at Amsterdam. 1738. The famous convention of Pardo signed. 1759. Execution of the conspirators against the life of the king of Portugal. The whole family of the Marquis Tavora was executed, and the name suppressed for ever. 1797. British ships Indefatigable, 44 guns, and Amazon, 42 guns, had a night action of six hours, in the bay of Audierne, with the French 74 gun ship Les Droits des Hommes, 1600 men; the latter was driven on shore, and the crew made prisoners; Gen. Renier and 750 men were lost in the action. The Amazon was also lost in the action. 1798. Lieut. Lord Camelford shot Lieut. Charles Peterson, at English harbor, Antigua, for disobedience of orders, was afterwards tried and acquitted. 1798. The Swiss cantons armed against France. 1809. The French under Marshal Victor defeated the Spanish under Castanos at Cuenca. 1811. The British merchant ship Cumberland, Captain Barrat, beat off 4 French privateers, and took 170 men who had boarded her. 1814. British and Prussians repulsed in an attack on Antwerp; part of the suburbs were burnt. 1814. The emperor of Russia and king of Prussia crossed the Rhine to invade France; the emperor of Austria, who had arrived the evening before at Cassel, went out to meet them, and they entered Basil, in Switzerland. 1814. General thanksgiving throughout Great Britain for the successes gained over Bonaparte.
1814. Capt. Barrie of the British ship Dragon, took the fort on Point Peter and the tower of St. Mary's, in Georgia; they afterwards destroyed the fort. 1817. The ship Georgianna, of Norfolk, experienced a tremendous shock in the Gulf stream supposed to be by earthquake; the day was calm. 1822. Johann Gottlieb Schneider, a German philologist and naturalist, died, aged 72; a voluminous author. 1836. Karl Chr. Traug. Tauchnitz, an eminent German printer, died, aged 75. At the age of 35 he commenced business for himself with a single press; but his establishment soon became very extensive, including a letter foundry and book store. He was most indefatigable in improving and perfecting whatever he undertook, as his publications attest. His founts of oriental type were unsurpassed in Germany. 1838. Chancellor Eldon died. 1840. Steam boat Lexington burnt, on her passage from New York to Stonington. Of 145 persons on board, only four escaped with their lives. Among the sufferers were many highly esteemed and valuable members of society. 1848. A severe battle took place at Chillianwallah between the British and Sikh forces without decisive results. 1854 An earthquake at Finana in Spain, crumbling down the Alcazaba, an ancient Moorish castle, prostrating houses and causing chasms in the streets, and loss of lives. JANUARY 14. 1526. Treaty of Madrid between the emperor Charles V, and Francis I of France, by which the latter obtained his liberty.
1604. The episcopal divines and puritans held a conference at Hampton court in the presence of King James. 1611. Edward Bruce, a Scottish statesman, died. He occupied some of the highest offices under the government, and his services were important in establishing the peaceable accession of James to the English throne. 1622. Pietro Sarpi, better known as Father Paul of Venice, died, aged 90. He employed the latter part of his life in writing a history of the council of Trent, in which he has developed the intrigues connected with the transactions of that famous assembly, with a degree of boldness and veracity, which renders the work one of the most interesting and important productions of the class to which it belongs. 1634. Of seven sailors left at Spitzbergen in the fall of 1633, by the Dutch fishermen, for the purpose of wintering there, the first of the number died. The journal which they kept relates that they sought in vain for green herbs, bears and foxes, in that desolate region. In November the scurvy appeared among them. Their journal ended February 26, and they were all found dead on the return of their countrymen in spring. (See April 16.) 1696. Marie de Rabutin Sevigne, a French woman of quality, died, aged 70. Her Letters (11 vols. 8vo.) are models of epistolary style, and have been translated into English. 1738. The famous convention of Pardo signed. 1739. The pope issued an edict against the assemblies of freemasons, under penalty of the rack and condemnation to the galleys. 1742. Edmund Halley the astronomer, died, aged 86. He devoted himself to mathematics with great success, and spent much time abroad in astronomical observations and experiments. His astronomical pursuits tended greatly by their results to improve the art of navigation.
1753. George Berkley, bishop of Cloyne in Ireland, died, aged 85. He appeared as an author before his twentieth year. He devoted seven years and a considerable part of his fortune in an effort to establish a college at Bermuda, for the education of Indian preachers, which miscarried. He published several philosophical, mathematical and theological works, and is said to have been acquainted with almost every branch of human knowledge. 1781. French took the island of Nevis. 1783. Cervetto, an Italian of extraordinary musical genius, died at London, aged 103. He was a member of the orchestra of Drury lane theatre. 1784. Congress ratified the definitive treaty of peace. 1792. Joseph Jackson, a celebrated English type founder, died. While an apprentice his master had carefully kept from his view the mode of making punches, but by boring a hole through the door he got an occasional glimpse of the art, and succeeded. 1795. Intense frost in Holland, which enabled the remainder of the French army to cross the Waal. 1795. The French were repulsed in an attack on all the posts of the allies, from Arnhem to Amerongen. In the night the allies retreated to Amersfoort, leaving 300 sick behind them. 1797. Battle of Rivoli in Italy. The contest was continued three days, and decided the fate of Mantua. The French under Joubert were victorious over the Austrians. 1798. Five English gentlemen who had been sent to investigate the title of Vizier Ally, were by his orders assassinated at Benares in India. 1801. Robert Orme died, aged 73; historiographer to the East India company. 1801. An embargo laid in England on all Russian, Swedish and Danish ships. More than 100 Swedish and Danish vessels were
immediately seized. 1809. Formal treaty of peace, friendship and alliance between Great Britain and Spain. 1813. An engagement off Pernambuco between the United States privateer schooner Comet, Capt. Boyle, 14 guns and 120 men, and three British vessels of 24 guns, convoyed by a Portuguese ship of 32 guns and 165 men. The Portuguese were beaten off, and the British vessels captured. She also captured three other vessels on the passage. 1814. Treaty of peace signed at Kiel between Denmark and England. 1814. Charles Bossut, a French mathematician, died, aged 84. He studied under D'Alembert, and rose to eminence. On the breaking out of the French revolution he lost the offices he had acquired, and subsisted by his writings. He was a contributer to the Encyclopedie. 1815. Com. Decatur, sailed from New York in the frigate President. 1822. The Grand Duke Constantine declined, by letter to his brother Alexander, the succession to the throne of all the Russias. 1831. Henry Mackenzie, the novelist, died, aged 86. He studied the law, at the same time cultivating elegant literature. His first effort was a tragedy, which was favorably received; his first novel appeared in 1771, in which he was eminently successful. Scott entitles him the Scottish Addison. 1834. William Polk, a revolutionary officer, died. He held the rank of colonel at the close of the war, and was the last surviving field officer of the North Carolina line. He was among the small band of patriots who declared independence in Mecklenburg county, N. C., May 20th, 1775. 1838. Navy island evacuated by the Canadians, c., under Mackenzie and Van Rensselaer, 510 in number. The arms belonging to the United States were surrendered, as also the cannon belonging to the state of New York.
1852. T. Hudson Turner died, aged 37; one of the ablest of the British archæologists. 1854. Joshua Bates, a distinguished New England clergyman, died, aged 77. He was twenty-three years president of Middlebury college. JANUARY 15. 69. Sergius Galba, the Roman emperor, assassinated, at the age of 72. He was the successor of Nero, and reigned but three months. 936. Rodolph, king of France, died, in the 14th year of his reign, and was succeeded by Lewis the Stranger. 1549. The liturgy of the English church established by parliament. All the divine offices were to be performed according to the new liturgy, and infringements were to be punished by forfeitures and imprisonments, and for the third offence imprisonment for life. Visitors were appointed to see that it was received throughout England. From this time we may date the era of the Puritans. 1655. Daniel Heinsius, a Dutch philologist, died. He made great progress as a student, under Scaliger, and was appointed to a professorship at Leyden. He was also successful as a Greek and Latin poet. 1559. Queen Elizabeth, crowned at Westminster, by the bishop of Carlisle, who was the only person that could be prevailed upon to perform the ceremony. 1672. John Cosin, bishop of Durham, died; a lover of literature and prodigal in his expenditures on book-binding. He ordered that all his books should be rubbed once a fortnight to prevent their moulding. 1693. An army of six or seven hundred French and Indians set out from Montreal to invade the Mohawk castles. (See Feb. 6.) 1730. Gov. Montgomerie granted the city of New York a new charter. Although that city had been put under the government of a mayor in
1665, it was not regularly incorporated until 1686. 1773. At Duff house, the residence of the countess dowager of Fife, the first masquerade ever seen in Scotland was exhibited. 1777. Vermont declared itself a free and independent state. It had been settled as a part of New Hampshire, but was claimed as a part of New York, and so decided to be by the British crown. But by the dissolution of the bonds which had held America in subjection to the crown of Britain, they considered themselves free from New York, to which the most of them had never voluntarily submitted; and being, as they said, reduced to a state of nature, they assumed the right to form such connections as were agreeable to themselves. Accordingly they formed a plan of government and a code of laws, and petitioned congress to receive them into the Union. 1778. Nootka sound and the Sandwich islands discovered by Captain Cook. 1780. First exportation of woolen goods from Ireland to a foreign market. 1780. Unsuccessful attack by the Americans under Lord Stirling on the British at Long island. 1781. The traitor Arnold succeeded in burning some stores at Smithfield. 1783. William Alexander, Lord Stirling, an officer in the revolutionary army, died at Albany, aged 57. He was of Scotch descent, and from early youth a mathematician. Throughout the war he acted an important part, and was warmly attached to Washington. He left behind him the reputation of a brave, discerning and intrepid officer, and an honest and learned man. He was generally styled Lord Stirling, and was considered the rightful heir to the title and estates of that earldom in Scotland. 1794. A desperate engagement off the island of Corsica between three Sardinian ships and two Barbary xebecs. One of the xebecs was captured, but the other, rather than surrender, was blown up;
upon which the prisoners taken, Turks and Algerines, 92 in number, were put to death. 1795. The French attacked the British outposts at Rhenen. 1795. The French national convention liberated Gen. Miranda and Capt. Lacrosse from prison. 1799. A revolution at Lucca in Italy, without bloodshed. Titles and exclusive privileges were abolished, the sovereignty of the people proclaimed, and a contribution of two millions of livres levied on the nobility alone, which was immediately presented to the French general Serrurier. 1805. Abraham Hyacinthe Anquetil Du Perron, the French orientalist, died, aged 74. He studied theology, but afterwards devoted himself with ardor to the study of the eastern languages. In 1754 he embarked for India, and with difficulty succeeded in finding some priests to instruct him in the sacred language of the Parsees. He returned to Paris in 1762 with a number of manuscripts, and proceeded to arrange them for publication. During the revolution he shut himself up with his books; but continued labors and an abstemious diet exhausted his constitution. He was a learned and excellent man. 1807. Battle between the forces under Christophe and Petion for the governorship of Hayti, which had been assumed by Christophe as the oldest general, on the death of Dessalines; but Petion had been subsequently duly elected. Christophe was defeated after a fierce encounter. A separation of the republic followed. Petion instituted a pure republic, while Christophe founded a monarchy. 1810. Masquerades and masked balls prohibited in the city of New York. 1815. The United States frigate President, Com. Decatur, captured by four British vessels, after a sharp action, and a chase of 18 hours. Loss of the Americans 22 killed, 59 wounded; British loss 11 killed, 14 wounded.
1825. Robert Goodloe Harper, an American statesman, died. He was born in Virginia, of poor parentage; acquired the rudiments of a classical education; served a campaign in the revolutionary army; after which he entered Princeton college. He subsequently settled in South Carolina, in the practice of the law, and acquired great reputation as a professional man and a politician. 1827. Jean Denis Lanjuinais died. He was a staunch defender of liberal principles, and opposed first the arrogant pretensions of the privileged class, although himself one of their number: afterwards he arrayed himself against the intrigues of Mirabeau, the violence of the mountain party, and the usurpations of Bonaparte, in the face of destruction. The object of his wishes was constitutional liberty. He escaped the axe of the revolution, and was even promoted to office by Napoleon. 1834. The city of Leira, in Portugal, taken by Count de Saldanha, and the garrison, of Miguelites about 1500 in number, made prisoners. 1836. Charles Lewis, one of the most eminent book binders in Europe, died. The splendidly bound books in the duke of Sussex's library are of his workmanship. 1842. Joseph Hopkinson died. His speeches in congress on the Seminole war were much admired. He was author of the song, Hail Columbia. 1844. The Fontaine Moliere, a monument to the great French dramatist, at Paris, inaugurated. It combines a public fountain with a monument, and stands opposite the house in which Moliere died. 1849. Reporters excluded from an adjourned meeting of a convention of the southern states. JANUARY 16. 1543. An act of the English parliament was passed forbidding women, apprentices, c., c., to read the New Testament in English.
1556. Charles V of Germany, (Don Carlos I of Spain) resigned the crown of Spain to his son Philip, after a reign of 40 years. Of all his vast possessions he only reserved to himself an annual pension. It was under him that Cortez conquered Mexico. 1580. An act of the English parliament inflicting a penalty of 20 pounds for absenting from church. 1599. Edmund Spencer, the English poet, died, aged 46. His first poem, the Shepherd's Calendar, appeared in 1576. He went to Ireland as private secretary to the lord lieutenant, and commenced the Faery Queen while in that country. The rebellion took place with such fury that he was obliged to leave the country in so great confusion, that an infant child was left behind, and burnt with his house. The unfortunate poet died soon after his arrival in England, in consequence of these misfortunes. 1643. Parliament of England forbid free commerce, and ordered no wagon or carriage to go to Oxford without a license. 1668. The earl of Shrewsbury slain in a duel by the duke of Buckingham, who had lived in open adultery with Shrewsbury's wife. It is said that she, in the habit of a page, held Buckingham's horse when he was fighting with her husband. 1706. Articles of union between England and Scotland ratified by the Scottish parliament 110 to 69. 1715. Robert Nelson died, an English gentleman of fortune, which he employed in works of benevolence and charity. Few works on devotional subjects were more popular than his. 1748. The bottle conjuror imposed on a great multitude at the Haymarket theatre, by announcing that he would jump into a quart bottle. 1760. Pondicherry, defended by the French under General Lally, taken by the English under Colonel Coote. 1772. A revolution in Denmark which terminated in the imprisonment of the royal family, and finally the banishment of the
queen, sister to George III of England. 1780. The Spanish fleet of 11 sail, under Langara, destroyed off St. Vincent by the British fleet of 19 sail, under Rodney. Langara was dangerously wounded and taken prisoner. One of the Spanish ships with 600 men on board was blown up, and all perished. The British lost 32 killed and 102 wounded. 1790. The bean-fed friars ejected from their convents by an augean labor of the French revolution. 1794. Edward Gibbon, the historian, died, aged 57. During his visit to Rome in 1764, he formed the plan of writing the Decline and Fall of the Roman Empire. In 1774 he obtained a seat in parliament, and two years after appeared the first quarto volume of his history. A disorder which he had endured twenty three years terminated in a mortification. 1795. Retreat of the British from Utrecht, in Holland, upon which the inhabitants capitulated to the French. 1796. The first theatre at Botany bay opened by the convicts at Sydney cove. 1809. Battle of Corunna in Spain, between the French and English, and death of Sir John Moore, who fell mortally wounded by a cannon shot, at the moment of victory achieved by the troops under his command. His men buried him in his cloak, and the French, in testimony of his gallantry, erected a monument over his remains. He was unmarried and in his 47th year. 1812. The king of Sicily, on account of ill-health, abdicated the throne in favor of his son, until he should recover. It is remarkable that Great Britain, Spain, Portugal and Sweden were governed by regents or viceroys at the same time. 1813. Lewis Barney died at Champlain, New York, aged 105. He had 24 children by one wife. 1815. Henry Thornton, founder of the Sierra Leone company, and a writer on the credit of Great Britain, died.
1816. The bridge at the falls of the Schuylkill fell with the great body of snow upon it. 1816. John Wright, the first constable of Cumberland county, Virginia, died, aged 107. 1817. Alexander James Dallas, an eminent lawyer of Philadelphia, died. He filled the office of secretary of state in Pennsylvania many years; and also that of secretary of the treasury of the United States a short time previous to his death. 1838. Dorothy Torrey died at Windsor, Conn., aged 107. 1843. State lunatic asylum, at Utica, New York, went into operation. 1854. Alden Partridge died at Norwich, Vt.; nearly fifty years engaged in military instruction, and some time principal of West Point academy. JANUARY 17. 86. B. C. Caius Marius, the Roman consul, died. He was the son of a farmer in indigent circumstances; but by his talents and energy raised himself to the highest dignity of the greatest state in the world. 395. The Emperor Theodosius died at Milan, soliciting his heirs faithfully to execute his will. 1009. Abd-el-Malek, a Moorish prince, crucified by his conqueror. 1380. An act of parliament passed, by which foreign ecclesiastics were incapacitated from holding benefices in England. 1467. John Castriotto, (or Scanderbeg) prince of Albania, died. His father placed him as a hostage with the sultan of Turkey, by whom he was educated in the Mohammedan faith, and at the age of 18 placed at the head of a body of troops. He afterwards deserted to the Christians, and on ascending the throne of his fathers renounced the Mohammedan faith. He obtained repeated victories over the
Welcome to our website – the perfect destination for book lovers and knowledge seekers. We believe that every book holds a new world, offering opportunities for learning, discovery, and personal growth. That’s why we are dedicated to bringing you a diverse collection of books, ranging from classic literature and specialized publications to self-development guides and children's books. More than just a book-buying platform, we strive to be a bridge connecting you with timeless cultural and intellectual values. With an elegant, user-friendly interface and a smart search system, you can quickly find the books that best suit your interests. Additionally, our special promotions and home delivery services help you save time and fully enjoy the joy of reading. Join us on a journey of knowledge exploration, passion nurturing, and personal growth every day! ebookbell.com

More Related Content

PDF
Microbial Systems Biology Methods And Protocols 2nd Ed 2022 Ali Navid
bayurchard
 
PDF
Pcr Protocols Methods In Molecular Biology 687 3rd Ed 2011 Daniel J Park
miekotelcel63
 
PDF
Microbial Functional Genomics Zhou J Et Al
chimsozolit
 
PDF
Next Generation Sequencing Methods And Protocols 1st Edition Steven R Head
xbhamef758
 
PDF
Deep learning methods in metagenomics: a review
ssuser6fc73c
 
PDF
Advances In Applied Microbiology 83 Sima Sariaslani And Geoffrey M Gadd Eds
orxjjymaxx9021
 
PDF
Bacterial Pangenomics Methods And Protocols 1st Edition Alessio Mengoni
fofinuti
 
PDF
Microbiome Analysis Methods and Protocols Robert G. Beiko
cpkbqudtvf3315
 
Microbial Systems Biology Methods And Protocols 2nd Ed 2022 Ali Navid
bayurchard
 
Pcr Protocols Methods In Molecular Biology 687 3rd Ed 2011 Daniel J Park
miekotelcel63
 
Microbial Functional Genomics Zhou J Et Al
chimsozolit
 
Next Generation Sequencing Methods And Protocols 1st Edition Steven R Head
xbhamef758
 
Deep learning methods in metagenomics: a review
ssuser6fc73c
 
Advances In Applied Microbiology 83 Sima Sariaslani And Geoffrey M Gadd Eds
orxjjymaxx9021
 
Bacterial Pangenomics Methods And Protocols 1st Edition Alessio Mengoni
fofinuti
 
Microbiome Analysis Methods and Protocols Robert G. Beiko
cpkbqudtvf3315
 

Similar to Highthroughput Next Generation Sequencing Methods And Applications 1st Edition Kathleen E Steinmann (20)

PDF
Microbiome Analysis Methods and Protocols Robert G. Beiko
slaisihrig0w
 
PDF
Protein Networks Generation Structural Analysis And Exploitation Natale
bunchepple4e
 
PPTX
Teresa Coque Hospital Universitario Ramón y Cajal.
Fundación Ramón Areces
 
PDF
Metagenomics Methods and Protocols 1st Edition José M. Vieites
sorgichssin
 
PPTX
Big Data Field Museum
Adina Chuang Howe
 
PPTX
HTS,Community metabolism and comparative genomics
r6vr54fknr
 
PDF
New Technologies at the Center for Bioinformatics & Functional Genomics at Mi...
Andor Kiss
 
PDF
Yeast Functional Genomics Methods And Protocols Frdric Devaux
wlhsedraa
 
PDF
Yeast Functional Genomics Methods And Protocols Frdric Devaux
wlhsedraa
 
PDF
In Vitro Mutagenesis Protocols Third Edition Miguel Alcalde (Auth.)
freinsazrin
 
PDF
Microarrays for an Integrative Genomics 3rd edition Computational Molecular B...
mbiziozanne
 
PPTX
Metagenomics
berciyalgolda1
 
PPT
Sequencing Genomics: The New Big Data Driver
Larry Smarr
 
PDF
NGS Applications II (UEB-UAT Bioinformatics Course - Session 2.1.3 - VHIR, Ba...
VHIR Vall d’Hebron Institut de Recerca
 
PDF
In Vitro Mutagenesis Protocols Third Edition Miguel Alcalde (Auth.)
katotibascon
 
PPTX
GLBIO/CCBC Metagenomics Workshop
Morgan Langille
 
PDF
Diversity Diversity Diversity Diversity ....
Jonathan Eisen
 
PDF
In Vitro Mutagenesis Protocols Third Edition 3rd Edition Miguel Alcalde Auth
imbroncisko
 
PPTX
Big data nebraska
Adina Chuang Howe
 
PPTX
Microbial sequencing
Dynah Perry
 
Microbiome Analysis Methods and Protocols Robert G. Beiko
slaisihrig0w
 
Protein Networks Generation Structural Analysis And Exploitation Natale
bunchepple4e
 
Teresa Coque Hospital Universitario Ramón y Cajal.
Fundación Ramón Areces
 
Metagenomics Methods and Protocols 1st Edition José M. Vieites
sorgichssin
 
Big Data Field Museum
Adina Chuang Howe
 
HTS,Community metabolism and comparative genomics
r6vr54fknr
 
New Technologies at the Center for Bioinformatics & Functional Genomics at Mi...
Andor Kiss
 
Yeast Functional Genomics Methods And Protocols Frdric Devaux
wlhsedraa
 
Yeast Functional Genomics Methods And Protocols Frdric Devaux
wlhsedraa
 
In Vitro Mutagenesis Protocols Third Edition Miguel Alcalde (Auth.)
freinsazrin
 
Microarrays for an Integrative Genomics 3rd edition Computational Molecular B...
mbiziozanne
 
Metagenomics
berciyalgolda1
 
Sequencing Genomics: The New Big Data Driver
Larry Smarr
 
NGS Applications II (UEB-UAT Bioinformatics Course - Session 2.1.3 - VHIR, Ba...
VHIR Vall d’Hebron Institut de Recerca
 
In Vitro Mutagenesis Protocols Third Edition Miguel Alcalde (Auth.)
katotibascon
 
GLBIO/CCBC Metagenomics Workshop
Morgan Langille
 
Diversity Diversity Diversity Diversity ....
Jonathan Eisen
 
In Vitro Mutagenesis Protocols Third Edition 3rd Edition Miguel Alcalde Auth
imbroncisko
 
Big data nebraska
Adina Chuang Howe
 
Microbial sequencing
Dynah Perry
 
Ad

Recently uploaded (20)

PDF
VCE English Exam - Section C Student Revision Booklet
jpinnuck
 
PDF
Basic Mud Logging Guide for educational purpose
wdandworks
 
PPTX
Cell Structure & Organelles in detailed.
DHANASHREESIVAKUMAR
 
PPTX
Pharma ospi slides which help in ospi learning
rameetkumar304
 
PPTX
Pharmacology of Heart Failure /Pharmacotherapy of CHF
Rajshri Ghogare
 
PDF
Chapter 2 Heredity, Prenatal Development, and Birth.pdf
MarjorieLopezTiu
 
PPTX
Institutional Correction lecture only . . .
limvtheghins
 
PDF
Module 4: Burden of Disease Tutorial Slides S2 2025
Jonathan Hallett
 
PDF
The Lost Whites of Pakistan by Jahanzaib Mughal.pdf
jahanzaibmughal6
 
PPTX
Renaissance Architecture: A Journey from Faith to Humanism
DrMonicaSharma
 
PDF
Computing-Curriculum for Schools in Ghana
abigailanane203
 
PDF
FourierSeries-QuestionsWithAnswers(Part-A).pdf
Raji Murugan
 
PPTX
GDM (1) (1).pptx small presentation for students
shrawanbpkihs
 
PDF
Complications of Minimal Access Surgery at WLH
mohitsuren827
 
PPTX
PPT- ENG7_QUARTER1_LESSON1_WEEK1. IMAGERY -DESCRIPTIONS pptx.pptx
KMDee
 
PDF
Insiders guide to clinical Medicine.pdf
AbhishekPatil315128
 
PDF
RMMM.pdf make it easy to upload and study
sajedul2
 
PPTX
Lesson notes of climatology university.
sgladness67
 
PDF
TR - Agricultural Crops Production NC III.pdf
avgilmegino3
 
PDF
STATICS OF THE RIGID BODIES Hibbelers.pdf
pascualasturiaskaye4
 
VCE English Exam - Section C Student Revision Booklet
jpinnuck
 
Basic Mud Logging Guide for educational purpose
wdandworks
 
Cell Structure & Organelles in detailed.
DHANASHREESIVAKUMAR
 
Pharma ospi slides which help in ospi learning
rameetkumar304
 
Pharmacology of Heart Failure /Pharmacotherapy of CHF
Rajshri Ghogare
 
Chapter 2 Heredity, Prenatal Development, and Birth.pdf
MarjorieLopezTiu
 
Institutional Correction lecture only . . .
limvtheghins
 
Module 4: Burden of Disease Tutorial Slides S2 2025
Jonathan Hallett
 
The Lost Whites of Pakistan by Jahanzaib Mughal.pdf
jahanzaibmughal6
 
Renaissance Architecture: A Journey from Faith to Humanism
DrMonicaSharma
 
Computing-Curriculum for Schools in Ghana
abigailanane203
 
FourierSeries-QuestionsWithAnswers(Part-A).pdf
Raji Murugan
 
GDM (1) (1).pptx small presentation for students
shrawanbpkihs
 
Complications of Minimal Access Surgery at WLH
mohitsuren827
 
PPT- ENG7_QUARTER1_LESSON1_WEEK1. IMAGERY -DESCRIPTIONS pptx.pptx
KMDee
 
Insiders guide to clinical Medicine.pdf
AbhishekPatil315128
 
RMMM.pdf make it easy to upload and study
sajedul2
 
Lesson notes of climatology university.
sgladness67
 
TR - Agricultural Crops Production NC III.pdf
avgilmegino3
 
STATICS OF THE RIGID BODIES Hibbelers.pdf
pascualasturiaskaye4
 
Ad

Highthroughput Next Generation Sequencing Methods And Applications 1st Edition Kathleen E Steinmann

  • 1. Highthroughput Next Generation Sequencing Methods And Applications 1st Edition Kathleen E Steinmann download https://ebookbell.com/product/highthroughput-next-generation- sequencing-methods-and-applications-1st-edition-kathleen-e- steinmann-2120052 Explore and download more ebooks at ebookbell.com
  • 2. Here are some recommended products that we believe you will be interested in. You can click the link to download. Highthroughput Mass Spectrometry In Drug Discovery 1 Chang Liu https://ebookbell.com/product/highthroughput-mass-spectrometry-in- drug-discovery-1-chang-liu-50753706 High Throughput Mass Spectrometry In Drug Discovery Chang Liu https://ebookbell.com/product/high-throughput-mass-spectrometry-in- drug-discovery-chang-liu-51310884 Highthroughput Image Reconstruction And Analysis Rao Ar Cecchi Ga Eds https://ebookbell.com/product/highthroughput-image-reconstruction-and- analysis-rao-ar-cecchi-ga-eds-2046986 Highthroughput Screening In Drug Discovery Methods And Principles In Medicinal Chemistry 1st Edition Jrg Hser Editor https://ebookbell.com/product/highthroughput-screening-in-drug- discovery-methods-and-principles-in-medicinal-chemistry-1st-edition- jrg-hser-editor-2164066
  • 3. High Throughput Analysis For Early Drug Discovery 1st Edition James Kyranos Editor https://ebookbell.com/product/high-throughput-analysis-for-early-drug- discovery-1st-edition-james-kyranos-editor-2164632 Highthroughput Screening Methods In Toxicity Testing Steinberg https://ebookbell.com/product/highthroughput-screening-methods-in- toxicity-testing-steinberg-4171180 Highthroughput Phenotyping In Plants Methods And Protocols 1st Edition Benjamin J Cole https://ebookbell.com/product/highthroughput-phenotyping-in-plants- methods-and-protocols-1st-edition-benjamin-j-cole-4177116 Highthroughput Analysis A Tool For Combinatorial Materials Science 1st Edition Radislav A Potyrailo https://ebookbell.com/product/highthroughput-analysis-a-tool-for- combinatorial-materials-science-1st-edition-radislav-a- potyrailo-4204378 Highthroughput Screening Assays In Toxicology 2nd Ed 2022 Hao Zhu Menghang Xia https://ebookbell.com/product/highthroughput-screening-assays-in- toxicology-2nd-ed-2022-hao-zhu-menghang-xia-42200192
  • 6. Me t h o d s i n Mo l e c u l a r Bi o l o g y ™ Series Editor John M. Walker School of Life Sciences University of Hertfordshire Hatfield, Hertfordshire, AL10 9AB, UK For other titles published in this series, go to www.springer.com/series/7651
  • 8. High-Throughput Next Generation Sequencing Methods and Applications Edited by Young Min Kwon DepartmentofPoultryScience,andCellandMolecularBiologyProgram, UniversityofArkansas,Fayetteville,AR,USA Steven C. Ricke CenterforFoodSafety&DepartmentofFoodScienceandtheCellandMolecular BiologyProgram,UniversityofArkansas,Fayetteville,AR,USA
  • 9. Editors Young Min Kwon, Ph.D. Department of Poultry Science and Cell and Molecular Biology Program University of Arkansas Fayetteville, AR USA ykwon@uark.edu Steven C. Ricke, Ph.D. Center for Food Safety & Department of Food Science and the Cell and Molecular Biology Program University of Arkansas Fayetteville, AR USA sricke@uark.edu ISSN 1064-3745 e-ISSN 1940-6029 ISBN 978-1-61779-088-1 e-ISBN 978-1-61779-089-8 DOI 10.1007/978-1-61779-089-8 Springer New York Dordrecht Heidelberg London Library of Congress Control Number: 2011923657 © Springer Science+Business Media, LLC 2011 All rights reserved. This work may not be translated or copied in whole or in part without the written permission of the publisher (Humana Press, c/o Springer Science+Business Media, LLC, 233 Spring Street, New York, NY 10013, USA), except for brief excerpts in connection with reviews or scholarly analysis. Use in connection with any form of information storage and retrieval, electronic adaptation, computer software, or by similar or ­ dissimilar methodology now known or hereafter developed is forbidden. The use in this publication of trade names, trademarks, service marks, and similar terms, even if they are not identified as such, is not to be taken as an expression of opinion as to whether or not they are subject to proprietary rights. While the advice and information in this book are believed to be true and accurate at the date of going to press, neither the authors nor the editors nor the publisher can accept any legal responsibility for any errors or omissions that may be made. The publisher makes no warranty, express or implied, with respect to the material contained herein. Printed on acid-free paper Humana Press is part of Springer Science+Business Media (www.springer.com)
  • 10. v Preface The increasing demand for more cost-effective high-throughput DNA sequencing in this postgenome era has triggered the advent of the “next generation sequencing” methods. Due to their novel concepts and extraordinary high-throughput sequencing capacity, these methods allow researchers to grasp system-wide landscapes of the complex molecu- lar events taking place in various biological systems, including microorganisms and micro- bial communities. These methods are now being recognized as an essential tool for more comprehensive and deeper understanding of the mechanisms underlying many biological processes. With realistic expectation that these methods will continue to improve at a rapid pace, biological scientists are excited about the growing possibilities for new research approaches that can be offered by these technologies. In High-Throughput Next Generation Sequencing: Methods and Applications, expert researchers explore the most recent advances in the applications of next generation sequencing technologies with emphasis on microor- ganisms and their community. However, the methods described in this book will also find general applications on the study of any living organisms. As part of the highly successful Methods in Molecular BiologyTM series, the chapters compile step-by-step readily reproduc- ible laboratory protocols, lists of the necessary materials and reagents, and tips on trouble- shooting and avoiding known pitfalls. Comprehensive and cutting-edge, High-Throughput Next Generation Sequencing: Methods and Applications is an excellent collection of chapters to aid all scientists who wish to apply this innovative research tools to enhance their own pursuits in microbiology and also biology in general. Fayetteville, AR Young Min Kwon Steven C. Ricke
  • 12. vii Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix Part I Genome Sequencing 1 Helicos Single-Molecule Sequencing of Bacterial Genomes . . . . . . . . . . . . . . . . . 3 Kathleen E. Steinmann, Christopher E. Hart, John F. Thompson, and Patrice M. Milos 2 Whole-Genome Sequencing of Unculturable Bacterium Using Whole-Genome Amplification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25 Yuichi Hongoh and Atsushi Toyoda Part II Gene Expression Analysis 3 RNA Sequencing and Quantitation Using the Helicos Genetic Analysis System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37 Tal Raz, Marie Causey, Daniel R. Jones, Alix Kieu, Stan Letovsky, Doron Lipson, Edward Thayer, John F. Thompson, and Patrice M. Milos 4 Transcriptome Profiling Using Single-Molecule Direct RNA Sequencing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51 Fatih Ozsolak and Patrice M. Milos 5 Discovery of Bacterial sRNAs by High-Throughput Sequencing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63 Jane M. Liu and Andrew Camilli 6 Identification of Virus Encoding MicroRNAs Using 454 FLX Sequencing Platform . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81 Byung-Whi Kong 7 Ribosomal RNA Depletion for Massively Parallel Bacterial RNA-Sequencing Applications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93 Zhoutao Chen and Xiaoping Duan Part III Microbial Diversity 8 Integrating High-Throughput Pyrosequencing and Quantitative Real-Time PCR to Analyze Complex Microbial Communities . . . . . . . . . . . . . . . 107 Husen Zhang, Prathap Parameswaran, Jonathan Badalamenti, Bruce E. Rittmann, and Rosa Krajmalnik-Brown 9 Tag-Encoded FLX Amplicon Pyrosequencing for the Elucidation of Microbial and Functional Gene Diversity in Any Environment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129 Yan Sun, Randall D. Wolcott, and Scot E. Dowd
  • 13. viii Contents 10 Pyrosequencing of Chaperonin-60 (cpn60) Amplicons as a Means of Determining Microbial Community Composition . . . . . . . . . . . . . . . . . . . . . . 143 John Schellenberg, Matthew G. Links, Janet E. Hill, Sean M. Hemmingsen, Geoffrey A. Peters, and Tim J. Dumonceaux 11 Prescreening of Microbial Populations for the Assessment of Sequencing Potential . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 159 Irene B. Hanning and Steven C. Ricke Part IV Metagenomics 12 Metagenomics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 173 Jack A. Gilbert, Bonnie Laverock, Ben Temperton, Simon Thomas, Martin Muhling, and Margaret Hughes 13 Metagenomic Analysis of Intestinal Microbiomes in Chickens . . . . . . . . . . . . . . . 185 Taejoong Kim and Egbert Mundt 14 Gene Expression Profiling: Metatranscriptomics . . . . . . . . . . . . . . . . . . . . . . . . . . 195 Jack A. Gilbert and Margaret Hughes Part V  Sequence Profiling for Functional Analysis 15 High-Throughput Insertion Tracking by Deep Sequencing for the Analysis of Bacterial Pathogens . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 209 Sandy M.S. Wong, Jeffrey D. Gawronski, David Lapointe, and Brian J. Akerley 16 Determining DNA Methylation Profiles Using Sequencing . . . . . . . . . . . . . . . . . 223 Suhua Feng, Liudmilla Rubbi, Steven E. Jacobsen, and Matteo Pellegrini Part VI Sequencing Library Preparation 17 Preparation of Next-Generation Sequencing Libraries Using Nextera™ Technology: Simultaneous DNA Fragmentation and Adaptor Tagging by In Vitro Transposition . . . . . . . . . . . . . . . . . . . . . . . . . . 241 Nicholas Caruccio 18 Amplification-Free Library Preparation for Paired-End Illumina Sequencing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 257 Iwanka Kozarewa and Daniel J. Turner 19 Target-Enrichment Through Amplification of Hairpin-Ligated Universal Targets for Next-Generation Sequencing Analysis . . . . . . . . . . . . . . . . . 267 Pallavi Singh, Rajesh Nayak, and Young Min Kwon 20 96-Plex Molecular Barcoding for the Illumina Genome Analyzer . . . . . . . . . . . . . 279 Iwanka Kozarewa and Daniel J. Turner Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 299
  • 14. ix Contributors Brian J. Akerley • Department of Molecular Genetics and Microbiology, University of Massachusetts Medical School, Worcester, MA, USA Jonathan Badalamenti • Center for Environmental Biotechnology, Biodesign Institute, Arizona State University, Tempe, AZ, USA Andrew Camilli • Howard Hughes Medical Institute and Tufts University School of Medicine, Boston, MA, USA Nicholas Caruccio • Epicentre Biotechnologies, Madison, WI, USA Marie Causey • Helicos BioSciences Corporation, Cambridge, MA, USA Zhoutao Chen • Life Technologies, Carlsbad, CA, USA Scot E. Dowd • Research and Testing Laboratory, Lubbock, TX, USA Xiaoping Duan • Life Technologies, Carlsbad, CA, USA Tim J. Dumonceaux • Agriculture and Agri-Food Canada Saskatoon Research Centre, Saskatoon, SK, Canada Suhua Feng • Department of Molecular, Cell and Developmental Biology, University of California, Los Angeles, CA, USA Jeffrey D. Gawronski • Department of Molecular Genetics and Microbiology, University of Massachusetts Medical School, Worcester, MA, USA Jack A. Gilbert • Plymouth Marine Laboratory, The Hoe, Plymouth, UK Irene B. Hanning • University of Tennessee, Department of Food Science and Technology, Knoxville, TN, USA Christopher E. Hart • Helicos BioSciences Corporation, Cambridge, MA, USA Sean M. Hemmingsen • National Research Council Plant Biotechnology Institute, Saskatoon, SK, Canada Janet E. Hill • Department of Veterinary Microbiology, University of Saskatchewan, Saskatoon, SK, Canada Yuichi Hongoh • Department of Biological Sciences, Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Tokyo, Japan Margaret Hughes • School of Biological Sciences, University of Liverpool, Liverpool, UK Steven E. Jacobsen • Department of Molecular, Cell and Developmental Biology, University of California, Los Angeles, CA, USA Daniel R. Jones • Helicos BioSciences Corporation, Cambridge, MA, USA Alix Kieu • Helicos BioSciences Corporation, Cambridge, MA, USA Taejoong Kim • Department of Population Health, College of Veterinary Medicine, University of Georgia, Athens, GA, USA Byung-Whi Kong • Department of Poultry Science, and Cell and Molecular Biology Program, University of Arkansas, Fayetteville, AR, USA Iwanka Kozarewa • The Wellcome Trust Sanger Institute, Hinxton, Cambridge, UK Rosa Krajmalnik-Brown • Center for Environmental Biotechnology,
  • 15. x Contributors Biodesign Institute, Arizona State University, Tempe, AZ, USA Young Min Kwon • Department of Poultry Science, and Cell and Molecular Biology Program, University of Arkansas, Fayetteville, AR, USA David Lapointe • Information Services, University of Massachusetts Medical School, Worcester, MA, USA Bonnie Laverock • Plymouth Marine Laboratory, The Hoe, Plymouth, UK Stan Letovsky • Helicos BioSciences Corporation, Cambridge, MA, USA Matthew G. Links • Agriculture and Agri-Food Canada Saskatoon Research Centre, Saskatoon, SK, Canada; Department of Veterinary Microbiology, University of Saskatchewan, Saskatoon, SK, Canada Doron Lipson • Helicos BioSciences Corporation, Cambridge, MA, USA Jane M. Liu • Department of Chemistry, Drew University, Madison, NJ, USA Patrice M. Milos • Helicos BioSciences Corporation, Cambridge, MA, USA Martin Muhling • TU Bergakademie Freiberg, IÖZ – Interdisciplinary Centre for Ecology, Freiberg, Germany Egbert Mundt • Department of Population Health, College of Veterinary Medicine, University of Georgia, Athens, GA, USA Rajesh Nayak • U.S. Food and Drug Administration, National Center for Toxicological Research, Jefferson, AR, USA Fatih Ozsolak • Helicos BioSciences Corporation, Cambridge, MA, USA Prathap Parameswaran • Center for Environmental Biotechnology, Biodesign Institute, Arizona State University, Tempe, AZ, USA Matteo Pellegrini • Department of Molecular, Cell and Developmental Biology, University of California, Los Angeles, CA, USA Geoffrey A. Peters • National Microbiology Laboratory, Public Health Agency of Canada, Winnipeg, MB, Canada Tal Raz • Helicos BioSciences Corporation, Cambridge, MA, USA Steven C. Ricke • Center for Food Safety Department of Food Science and the Cell and Molecular Biology Program, University of Arkansas, Fayetteville, AR, USA Bruce E. Rittmann • Center for Environmental Biotechnology, Biodesign Institute, Arizona State University, Tempe, AZ, USA Liudmilla Rubbi • Department of Molecular, Cell and Developmental Biology, University of California, Los Angeles, CA, USA John Schellenberg • Department of Medical Microbiology, University of Manitoba, Winnipeg, MB, Canada Kathleen E. Steinmann • Helicos BioSciences Corporation, Cambridge, MA, USA Pallavi Singh • Cell and Molecular Biology Program, University of Arkansas, Fayetteville, AR, USA Yan Sun • Research and Testing Laboratory, Lubbock, TX, USA Ben Temperton • Plymouth Marine Laboratory, The Hoe, Plymouth, UK Edward Thayer • Helicos BioSciences Corporation, Cambridge, MA, USA Simon Thomas • Plymouth Marine Laboratory, The Hoe, Plymouth, UK John F. Thompson • Helicos BioSciences Corporation, Cambridge, MA, USA Atsushi Toyoda • Comparative Genomics laboratory, National Institute of Genetics,
  • 16. xi Contributors Shizuoka, Japan Daniel J. Turner • The Wellcome Trust Sanger Institute, Hinxton, Cambridge, UK Randall D. Wolcott • Southwest Regional Wound Care Center, Lubbock, TX, USA Sandy M.S. Wong • Department of Molecular Genetics and Microbiology, University of Massachusetts Medical School, Worcester, MA, USA Husen Zhang • Department of Civil, Environmental, and Construction ­ Engineering, University of Central Florida, Orlando, FL, USA
  • 20. 3 Young Min Kwon and Steven C. Ricke (eds.), High-Throughput Next Generation Sequencing: Methods and Applications, Methods in Molecular Biology, vol. 733, DOI 10.1007/978-1-61779-089-8_1, © Springer Science+Business Media, LLC 2011 Chapter 1 Helicos Single-Molecule Sequencing of Bacterial Genomes Kathleen E. Steinmann, Christopher E. Hart, John F. Thompson, and Patrice M. Milos Abstract With the advent of high-throughput sequencing technologies, multiple bacterial genomes can be sequenced in days. While the ultimate goal of de novo assembly of bacterial genomes is progressing, changes in the genomic sequence of closely related bacterial strains and isolates are now easily monitored by comparison of their sequences to those of a reference genome. Such studies can be applied to the fields of bacterial evolution, epidemiology, and diagnostics. We present a protocol for single-molecule sequenc- ing of bacterial DNA whose end result is the identification of single nucleotide variants, and various size insertions and deletions relative to a reference genome. The protocol is characterized by the simplicity of sample preparation and the lack of amplification-related sequencing bias. Key words: Bacterial genome, Single-molecule sequencing, Sequencing bias, SNV, PolyA tail, HeliScopeTM sequencer Sequencing of multiple bacterial genomes at a depth sufficient to allow their alignment to a reference genome can now be achieved in a single channel of a HeliscopeTM Genetic Analysis System (1) and other high-throughput sequencing platforms (2). The ability to determine differences between closely associated bacterial strains and isolates through alignment to a reference genome has contrib- uted greatly to an understanding of bacterial evolution (3, 4). This method of bacterial genome resequencing can be used to track the acquisition of virulence factors and antibiotic resistance through sequencing of multiple isolates (5–7). The genetic changes underlying mutant phenotypes can now be found more easily and at less cost by sequencing than by traditional genetic mapping (8). 1. Introduction
  • 21. 4 Steinmann et al. The DNA sample preparation technique used for single-molecule sequencing that is described below is unique in that no amplification or ligation is required. The DNA is fragmented. A polyA tail, added with terminal transferase and dATP, allows hybridization of the DNA to an oligodT-coated flow cell. Minimal sample manipulation results in the lack of GC bias associated with ampli- fication-based technologies (9, 10). Helicos BioSciences demon- strated this lack of bias by showing even coverage for three bacterial genomes with differing GC contents (1). The mean sequencing coverage within 200-bp sliding windows across the Escherichia coli K12 MG1655 (50.8% GC), Staphylococcus aureus USA 3000 (37.7% GC), and Rhodobacter sphaeroides 2.4.1 (68.8% GC) genomes was plotted against the GC content in the same window (Fig. 1). These data demonstrated flat coverage and sequencing accuracy of sequence contexts ranging from 20 to 80% GC. The overall sequence coverage required for accurate SNP calling is related to the evenness of coverage (11). The lack of bias observed with single-molecule sequencing on the HeliScopeTM Genetic Analysis System points to its use as a cost- effective and accurate method for bacterial genome resequencing. At present, a single HeliScopeTM Sequencer channel provides over 80-fold coverage for a single bacterial genome, far exceeding the 20× to 25× coverage needed for variant detection. When amplifi- cation-free barcoding methods are employed, three or more bac- terial genomes (depending on the genome size) can be resequenced per lane while retaining the lack of amplification bias. 1. Qiagen DNA purification Kit (Qiagen, Valencia, CA) (see Note 1). 2. S2 instrument (Covaris, Inc., Woburn, MA) (see Note 2). 3. Preparation station (Covaris, Inc., Woburn, MA). 4. MicroTube holder (single tube). (Covaris, Inc., Woburn, MA). 5. Snap-Cap microTube with AFA fiber and Pre-split Teflon/ silicone/Teflon septa (Covaris, Inc., Woburn, MA). 6. Distilled water (Invitrogen, Carlsbad, CA). 7. 10× TE, pH 8.0 (Invitrogen, Carlsbad, CA). 8. 1.5 mL MAXYMum recovery tubes (Axygen Scientific, Union City, CA) (see Note 3). 1. Agencourt® AMPure® XP Kit (Agencourt Bioscience Corp., Beverly, MA). 2. 100% Ethanol (Sigma, St Louis, MO). 2. Materials 2.1. DNA Isolation and Ultrasonic Shearing of DNA 2.2. Size Selection Using Solid Phase Reversible Immobilization
  • 22. 5 Helicos Single-Molecule Sequencing of Bacterial Genomes 3. Distilled water (Invitrogen, Carlsbad, CA). 4. Dynal® Magnet: DynaMag® -2 Magnet (Invitrogen, Carlsbad, CA) or similar. 5. Heatblock equipped with block milled for 1.5 mL tubes (VWR, Batavia, IL). Fig. 1. Single-molecule DNA sequencing provides minimal sequence bias across diverse genomic content. The local GC content and observed mean sequencing coverage were tabulated using a 200-bp sliding window.Windows were then aggregated into GC-content bins ranging from 0 to 1 with a step size of 0.1. Plotted is the mean coverage (GRAY; Right Y-axis) for each window within each of the aggregated GC-content bins (BLACK; Left Y-axis, Log scale). (a) E. coli. (b) Staphylococcus aureus. (c) Rhodobacter sphaeroides. (Reproduced from ref. 1 with permission from Helicos BioSciences Corporation.). 7 a b c 6 5 4 3 2 6 7 6 5 4 3 2 1 0 5 4 3 2 1 0 0.0 0.0 0.2 0.4 0.6 0.8 1.0 0.2 0.4 0.5 0.8 1.0 –1 1 0 0.0 0.2 0.4 Fraction GC Fraction GC Fraction GC Number of Windows Number of Windows Number of Windows Mean Coverage Mean Coverage Mean Coverage 0.6 0.8 1.0 90 80 70 60 50 40 30 20 10 60 50 40 30 20 10 0 120 140 100 80 60 40 20 0
  • 23. 6 Steinmann et al. 1. 4–20% TBE gel, 1.0 mM, 12 well or similar (Invitrogen, Carlsbad, CA) (see Note 4). 2. Ultrapure 10× TBE buffer (Invitrogen, Carlsbad, CA). 3. Para-film. 4. 10× BlueJuiceTM gel loading buffer (Invitrogen, Carlsbad, CA). 5. 25 bp DNA ladder (Invitrogen, Carlsbad, CA). 6. 1 kB DNA ladder (Invitrogen, Carlsbad, CA). 7. SYBR® Gold nucleic acid gel stain (Invitrogen, Carlsbad, CA). 8. Photodocumentation system compatible with a SYBR® Gold photographic filter. 9. SYBR® Gold Nucleic photographic filter (Invitrogen, Carlsbad, CA). 10. XCell SurelockTM Mini-cell (Invitrogen, Carlsbad, CA). 11. NanodropTM 1000, 2000, 2000c, or 8000 spectrophotome- ter (Thermo Fisher Scientific, Waltham, MA). 1. Terminal transferase kit: includes terminal transferase enzyme (20,000 U/mL), CoCl2 at 2.5 mM, 10× terminal transferase buffer (New England BioLabs, Ipswich, MA). 2. HelicosTM DNA sample preparation reagents kit: includes HelicosTM PolyA tailing control oligonucleotide TR and HelicosTM PolyA tailing dATP. (Helicos BioSciences Corpora­ tion, Cambridge, MA). Store Kit at −80°C (see Note 5). 3. Distilled water (Invitrogen, Carlsbad, CA). 4. 0.2 mL MAXYMum recovery thin wall PCR tubes and 1.5 mL MAXYMum recovery tubes (Axygen Scientific, Union City, CA) (see Note 3). 5. Aluminum block milled for 0.2 mL tubes (VWR, Batavia, IL). 6. DNA engine thermal cycler (BioRad Laboratories, Hercules, CA). 1. 4–20% TBE gel, 1.0 mM, 12 well or similar (Invitrogen, Carlsbad, CA) (see Note 4). 2. Ultrapure 10× TBE buffer (Invitrogen, Carlsbad, CA). 3. 10× BlueJuiceTM gel loading buffer (Invitrogen, Carlsbad, CA). 4. 100 bp DNA ladder (Invitrogen, Carlsbad, CA). 5. SYBR® Gold nucleic acid gel stain (Invitrogen, Carlsbad, CA). 6. Photodocumentation system compatible with a SYBR® Gold photographic filter. 7. SYBR® Gold nucleic photographic filter (Invitrogen, Carlsbad, CA). 8. XCell SurelockTM Mini-cell (Invitrogen, Carlsbad, CA). 2.3. Calculating the Approximate Concentration of 3¢ Ends 2.4. PolyA Tailing Reaction 2.5. Determining the Success of Tailing Reaction
  • 24. 7 Helicos Single-Molecule Sequencing of Bacterial Genomes 1. Terminal transferase enzyme (20,000 U/mL) (New England BioLabs, Ipswich, MA). 2. HelicosTM PolyA tailing dATP (Helicos BioSciences Corporation, Cambridge, MA). 3. Aluminum block milled for 0.2 mL tubes (VWR, Batavia, IL). 4. DNA engine thermal cycler (BioRad Laboratories, Hercules, CA). 1. Terminal transferase enzyme (20,000 U/mL) (New England BioLabs, Ipswich, MA). 2. 1 mM Biotin-11-ddATP (PerkinElmer, Waltham, MA). 3. Aluminum block milled for 0.2 mL tubes (VWR, Batavia, IL). 4. DNA engine thermal cycler (BioRad Laboratories, Hercules, CA). The major steps in preparing bacterial DNA for single-molecule sequencing on the HeliScopeTM Sequencer consist of shearing the DNA to 200–300 bp, adding a polyA tail to allow hybridization to the oligonucleotide-coated HelicosTM Flow Cell and blocking the 3¢ end of the DNA with ddATP to prevent that end of the DNA from acting as a substrate for the sequencing-by-synthesis reaction. A bead-based size-selection step after the shearing step removes salts and small nucleic acids that would be tailed, but are not sufficiently long to yield meaningful sequence information. A quality control step ensures that samples are sheared to the appropriate size. A second quality control step uses a control reac- tion to monitor the tail length of a PolyA tailing control oligo- nucleotide TR spike to insure sample polyA tail lengths of between 90 and 200 dA. Sequencing of the resultant sample and subse- quent data analysis using Helicos variant detection software results in the enumeration of single nucleotide variants (SNVs), and insertions and deletions (indels) of up to 4 bp in length between the sequenced bacteria and a reference using alignment-based methods. Alternative approaches for detecting much longer variants using assembly-based methods are under development. The method used for bacterial DNA isolation is dependent upon the bacterial source. The Qiagen DNA Purification Kit has been used successfully for bacterial DNA isolation following manufac- turer’s instructions (see Note 1). 1. Prepare the Covaris S2 instrument for ultrasonic shearing of DNA by filling the tank on the Covaris S2 instrument with 2.6. Short Tail Correction 2.7. 3¢ Blocking Reaction 3. Methods 3.1. DNA Isolation and Ultrasonic Shearing of DNA
  • 25. 8 Steinmann et al. deionized water to level 12 on the fill line label. The water should cover the visible parts of the microTube when it is in the microTube holder (i.e., to the bottom of the snap cap). 2. Set the chiller to 4°C and turn it on. 3. Turn on the S2 unit by depressing the red switch located at the upper right corner of the instrument. 4. After the instrument is on, open the software. Click the ON button on the control panel under the word DEGAS to begin the degassing procedure. The instrument is ready to use when the water has been degassed for 30 min and the temperature software display is between 6°C and 8°C. 5. Prepare 500 ng to 3 mg of DNA in 120 ml of TE, pH 8.0. If the DNA is not in 120 mL of TE, add the appropriate amount 10× TE, pH 8.0 to make the overall concentration of TE in the solution 1× (see Note 6). 6. Place an unfilled Covaris microTube into the preparation sta- tion holder. 7. Keeping the cap on the tube, use a p200 pipette and 200-mL aerosol-free tip to transfer the 120 mL of DNA sample by inserting the tip through the pre-split septa. Place the tip along the interior wall of the tube. Slowly discharge the fluid into the tube, moving the pipette tip up along the interior wall as the tube fills. Be careful not to introduce a bubble into the bottom of the tube. If a bubble appears, remove the bub- ble by briefly (1–2 s) centrifuging the tube in a low-speed tabletop centrifuge equipped with appropriate adaptors. 8. Slide the tube into the microTube holder while keeping the tube vertical. Make sure the tube is centered in the holder. Carefully insert the holder into the machine. Take care not to introduce bubbles into the bottom of the tube during this process. 9. Click on Configure. On the Method Configuration Screen, set the Mode to Frequency Sweeping and the Bath Temperature Limit to 20°C. In the Treatment 1 box, set the Duty Cycle to 10%, the Intensity to 5 and the Cycles/Burst to 200. Set the time to 60 s and the Number of Cycles to 3. Click on Return to Main Panel. Click Start and Start again when the second screen appears. 10. After shearing is complete, remove the tube from the S2 holder and place it into the preparation station. Remove the snap cap with the tool supplied with the preparation station. Use a p200 pipette to transfer the sheared DNA to a new, clean 1.5-mL tube. A brief centrifugation may be used to col- lect any DNA remaining in the microTube. 11. Samples may be stored at −20°C after this step.
  • 26. 9 Helicos Single-Molecule Sequencing of Bacterial Genomes 12. When the shearing is completed, click the OFF button under DEGAS, empty the water tank, turn off the chiller, close the software, and power down the instrument. 1. Warm the AMPure XP bead solution to room temperature and vortex thoroughly to resuspend all beads. 2. Prepare 70% ethanol. Prepare fresh by diluting 7 mL of abso- lute ethanol into 3 mL of distilled water. Do not use a stock 70% ethanol. 3. Vortex the AMPure XP beads and add 360 mL of the AMPure XP bead slurry to each tube of sheared DNA. Pipette up and down ten times to mix. 4. Incubate the sample slurry for 5–10 min at room temperature. 5. Capture the AMPure XP beads by placing the tube(s) on the DynalTM magnet until the beads are separated from the solu- tion (approximately 5 min). 6. Carefully aspirate the supernatant keeping the tube(s) on the magnet. Do not disturb the beads adhering to the side of the tube. Take care not to remove any AMPure XP beads (see Note 7). 7. Add 700 ml of 70% EtOH to each tube on the DynalTM mag- net. Wait for 30 s. 8. Keep the tubes on the magnet and carefully aspirate the supernatant (see Note 7). 9. Repeat steps 7 and 8. 10. Briefly centrifuge the tubes to collect any remaining 70% EtOH to the bottom of the tube. Place the tubes back on the magnet and remove the last drops of 70% EtOH with a p10 pipette. 11. Dry the pellet at 37°C in a heat block milled for 1.5 mL tubes. Pellets should be dried until cracks appear in them (approxi- mately 1–5 min). Take care not to over dry the pellets as they will be difficult to resuspend. This step can be performed at room temperature with the drying time being extended to a minimum of 10 min before cracks appear. 12. Elute the sheared DNA sample from the AMPure beads by adding 20 mL of distilled water to each tube. A brief (1–2 s) centrifugation may be necessary to collect all the beads at the bottom of the tube. 13. Pipette the entire volume of each tube up and down 20 times so that the beads are completely resuspended. 14. Place the tube back on the magnet. After the beads are sepa- rated from the solution, collect the 20 mL of solution and 3.2. Size Selection Using Solid Phase Reversible Immobilization
  • 27. 10 Steinmann et al. place it into a new 1.5-mL tube. This supernatant contains the sheared, size-selected DNA (see Note 8). 15. Add another 20 mL of water to the tube. Repeat steps 13 and 14, this time adding the supernatant to the first elute. The final sheared, size-selected DNA volume should be 40 mL. 16. The DNA can be stored at −20°C after this step. 1. These instructions assume the use of an XCell SureLockTM Mini-cell and Invitrogen 4–20% gradient gels. An equivalent electrophoresis apparatus compatible with 10×10 cm gel ­ cassettes can also be used. Non-gradient gels are not recommended. 2. Remove the 4–20% TBE gel from its storage pouch. Remove the comb, rinse the wells with water two to three times and remove the plastic strip at the bottom of the gel. Complete the assembly of the gel unit. 3. Prepare 1× TBE running buffer by diluting 100 mL of 10× TBE with 900 mL of water in a graduated cylinder. Cover with para-film and invert to mix. Running buffer may be stored at room temperature. 4. Add running buffer to the center reservoir of the gel appara- tus. Check for leaks and reassemble if necessary. Add 1–2 in. of buffer to the bottom reservoir. 5. Load 2 ml aliquots of the samples in 1× BlueJuiceTM buffer in a total volume of 10 ml. Make a 1:10 dilution of the 1 kB and 25-bp ladders in distilled water. Load 1 ml of the diluted markers in 1× BlueJuiceTM buffer in a total volume of 10 ml. 6. Run the gel at 180 V for 45 minutes. 7. After removing the gel from the cassette, using the tool pro- vided with the XCell SureLockTM Mini-cell, stain the gel for 10 min in freshly prepared SYBR® Gold nucleic acid gel stain diluted 1:100,000 in water (see Note 9). 8. Destain the gel in water for 10–15 min, changing the water every 2 min. 9. Image with a photodocumentation system compatible with a SYBR® Gold photographic filter. 10. Determine the average size of your sample by comparing the size of the middle of the sample smear to the size standards (see Note 10). 11. Determine the double-stranded DNA concentration in ng DNA/mL at this step using a NanodropTM 1000, 2000, 2000c, or 8000 spectrophotometer. 3.3. Calculating the Approximate Concentration of 3¢ Ends
  • 28. 11 Helicos Single-Molecule Sequencing of Bacterial Genomes 12. Calculate the pmoles of ends in the sample using the following formula: pmoles ends/mL=(X ng DNA/mL)×(1,000 pg/ng)× (pmole/660 pg)×(1/average # bp as determined from the gel photo)×2 ends/molecule. 1. Based on the calculations in step 12 of Subheading 3.3, pre- pare a Sample DNA tube for each DNA to be tailed by deter- mining the volume of DNA that would give 3 pmoles of ends. Put that volume of DNA into a 0.2-mL PCR tube along with distilled water to bring the final volume to 26 mL. 2. Prepare a Control DNA tube for each DNA to be tailed by determining the volume of DNA that would give 0.8 pmoles of ends. Put that volume of DNA into a 0.2-mL PCR tube along with 1 mL of HelicosTM PolyA Tailing Control Oligo TR and distilled water to bring the final volume to 26 mL. 3. Prepare a separate Oligo TR Control DNA tube (without DNA sample) by putting 4 mL of HelicosTM PolyA Tailing Control Oligo TR in a tube containing 22 mL of distilled water. 4. Prepare a sample master mix by adding 4.4 mL of 10× termi- nal transferase buffer, 4.4 mL of CoCl2 (2.5 mM), 4.2 mL of HelicosTM PolyA Tailing dATP, and 2.2 mL terminal trans- ferase enzyme (20 U/mL) per sample (see Note 11). The master mix volume includes a 10% scale-up. Mix thoroughly by pipetting the entire mix up and down several times (see Note 12). Keep on ice. 5. Prepare a control master mix by adding 4.4 mL of 10× termi- nal transferase buffer, 4.4 mL of CoCl2 (2.5 mM), 3 mL of distilled water, 1.4 mL of HelicosTM PolyA Tailing dATP, and 2.2 mL terminal transferase enzyme (20 U/mL) per control reaction (see Note 13). The master mix includes a 10% scale- up. Mix thoroughly by pipetting the entire mix up and down several times (see Note 12). Keep on ice. 6. Heat the Sample and Control Tubes DNA tubes to 95°C for 5 min in a thermocycler. Immediately remove the DNA tubes from the thermocycler and snap cool for a minimum of 2 min by placing the tubes in an aluminum block milled for 0.2 mL tubes that has been prechilled in ice water (see Note 14). 7. Add 14 mL of sample master mix to the sample DNA tubes and 14 mL of control master mix to the control DNA tubes. Mix thoroughly by pipetting up and down ten times (see Note 12). 8. Collect the contents of the tubes into the bottom by briefly centrifuging. 3.4. PolyA Tailing Reaction
  • 29. 12 Steinmann et al. 9. Place the tubes in the thermocycler and incubate at 37°C for 60 min, 70°C for 10 min followed by a 4°C hold. 10. The tailed DNA can be stored at −20°C after this step. 1. Gel type and running instructions are identical to those in Subheading 3.3. Instructions here will be limited to how to prepare samples for loading and how to interpret results. 2. Load 20 ml aliquots of the control reactions in 1× BlueJuiceTM buffer (18 mL of the control reaction and 2 mL of 10× BlueJuiceTM ). 3. Make a 1:10 dilution of the 100-bp ladder in distilled water. Load 1 ml of the diluted markers in 1× BlueJuiceTM buffer in a total volume of 20 ml. 4. The sample itself is difficult to visualize. The band corre- sponding to the TR oligo spike is visible in the control lanes and monitors the tail length of the sample. All control reac- tions should migrate at the size of the Oligo TR Control Sample. A longer polyA tail may be indicative of a sample with a reduced number of strands ending in a 3¢OH. Only strands having a 3¢OH can be tailed. Tailed oligos with 90–200 dA are expected to migrate below the 600-bp band to midway between the 200- and 300-bp bands on the 100- bp ladder (see Note 15 and Fig. 2). If the TR oligo band in the Control reaction lane migrates anywhere between 250 bp and 600 bp, you may proceed to steps in Subheading 3.7. 5. In the rare instances where the band in the Control reaction lane migrates below 250 bp, the sample has a polyA tail shorter than 90 nucleotides. Proceed to steps in Subheading 3.6. 6. If the band in the Control reaction lane migrates above 600 bp, the polyA tail contains more than 200 dA. In this case, the sample could be run on the HelicosTM Genetic Analysis System. However, if sample is not limiting, we recommend repeating the PolyA tailing reaction on another sheared DNA aliquot using twice the amount of input DNA. 1. Both the control and sample reactions undergo the ­ correc­ tion. The denaturation step and thermocycler incubation ­ conditions are as for the PolyA tailing reactions in Subheading 3.4. 2. After snap cooling the tubes, the following reagents are added. For the 3 pmole sample reactions, add 3.9 mL of dATP and 2 mL of terminal transferase. For the 0.8 pmole control reactions, prepare a 1:2 dilution of the dATP stock in water. Add 1.3 mL of diluted dATP and 1 mL of terminal trans- ferase. Mix by pipetting up and down thoroughly ten times. 3.5. Determining the Success of the Tailing Reaction 3.6. Short Tail Correction
  • 30. 13 Helicos Single-Molecule Sequencing of Bacterial Genomes 3. Steps in Subheading 3.5 maybe performed on the control reaction to determine if the polyA tail length is greater than 90 dA. 1. The 3¢ Blocking reaction is performed only on the Sample reac- tions. The denaturation step and thermocycler ­ incubation con- ditions are as for the PolyA tailing reactions in Subheading 3.4. The reagents to be added to the tubes are outlined below. 2. Dilute the 1-mM Biotin-11-ddATP 1:6 in water. After snap cooling the sample tubes, add 1 mL of the diluted Biotin-11- ddATP and 2 mL of terminal transferase to each tube. 3. After the blocking reaction is completed, add 1 mL of 500 mM EDTA to the samples. Samples should be stored at −20°C. Sample quantification and sample loading are typically performed by the operator of the HeliscopeTM Single Molecule Sequencer, and will therefore be outlined only briefly here. Sample concentration is determined using the HelicosTM OptihybTM assay. For the assay, a 1:50 dilution of a DNA sample 3.7. 3¢ Blocking Reaction 3.8. Sample Quantification and Sequencing Fig. 2. Migration pattern of tailed TR oligonucleotide in control reactions with optimal dA tail lengths. Tailed TR oligos with 90–200 dA are expected to migrate below the 600-bp and to midway between the 200- and 300-bp bands on the 100-bp ladder. PolyA tailed samples do not migrate normally in the gel. Lane 1: 100-bp DNA ladder. Lane 2: A con- trol reaction with 200 dA. Lane 3: A control reaction with 90 dA. Lane 4: Tailing Control Oligo TR with 90 dA. Lane 5: 25-bp DNA ladder.
  • 31. 14 Steinmann et al. is prepared by adding 2 mL of a DNA sample to 98 mL of hybridization buffer. A standard curve is generated by serially diluting HelicosTM Control Oligonucleotides at concentrations from 500 to 20 pM. The PolyA tailed and biotin-ddATP blocked control oligonucleotides and DNA samples are captured in a 96-well plate. After washing and blocking, the plates are incu- bated with an HRP (horseradish peroxidase) conjugate. The streptavidin–biotin complexes that are formed are washed to remove excess HRP. TMB, a chromogenic substrate for the HRP, is added to the plate. The reaction is stopped by the addition of 1 N HCl and read on a plate reader at 450 nm. The concentration of the DNA sample is determined by comparison of the signal generated by the DNA sample to the standard curve generated with the HelicosTM Control Oligonucleotides. The HeliScopeTM Sequencer obtains sequence from one or two 25 channel flow cells, making it possible to sequence 50 bac- terial genomes per run. DNA Samples are loaded onto the HeliscopeTM Flow Cell at a recommended concentration of 200 pM using the HeliscopeTM Sample Loader. The samples hybridize to the oligo dT primers on the flow cell surface and are locked into place by a procedure that ensures that sequencing-by- synthesis starts immediately after the first nonA base on the DNA samples. 120 nucleotide cycle additions are performed in an 8-day run, though the timing is adjustable based on user throughput needs. The HeliScopeTM analysis engine on the instrument creates .srf files that correlate template position images with nucleotide addition images to generate sequence information. After the run is completed, .srf files are converted to .sms files which are used for subsequent data analysis. HeliScopeTM data analysis can be done using a Unix system with at least 5 GB per CPU core. The HeliSphereTM data analysis pipeline is an open-source software written in the Python pro- gramming language. It is available for download at: http:/ /open. helicosbio.com/mwiki/index.php/Releases. Download both the HeliSphereTM package and the examples. Follow the HeliSphereTM User’s Guide documentation available at http:/ /open.helicosbio. com/helisphere_user_guide/index.html after installation. The resequencing pipline uses the raw sequence input file (.sms) to generate reads aligned to a reference genome and to report SNVs and short insertions and deletions (indels) between the sequenced material and the reference. The current version of the resequencing pipeline analyzes data from a single channel. Reliable SNV calling requires roughly 20× depth. With current machine performance of roughly 12–16 M reads per channel and an aver- age read length of 35 bp, we would then recommend this single channel pipeline for resequencing applications where the genome is less than 25 Mb. 3.9. Data Analysis 3.10. Running the Resequencing Pipeline
  • 32. 15 Helicos Single-Molecule Sequencing of Bacterial Genomes In order to run the pipeline, you must specify certain analysis parameters. A detailed description of all analysis parameters and how to apply them under more complex situations (e.g., for a barcoded sample) can be found in the HelisphereTM Users Guide. Default values for most analysis parameters are appropriate for running the pipeline on a single bacterial genome in a single chan- nel. The following example outlines what must be specified for each analysis, how to set up the corresponding run configuration file, and how to launch the analysis. 1. Determine the input file directory and the .sms file name of the file to be processed. For example: /ifs/bioinf/workspace/ bacreseq/smsDirectory/file.sms 2. Determine the flow cell and channel to be processed. For example: the flow cell is 1 and the channel is 5. 3. Chose an output directory. For the example: /ifs/bioinf/ workspace/bacreseq/outputDir. 4. A reference fasta file has to be chosen and placed in the refer- ence data directory. This directory is defined as the refer- enceDir variable inside the file (helicos installation root)/ pypeline/config/pypeline-site.conf. If an indexDPgenomic database does not exist for this reference it needs to be cre- ated with preprocessDB and placed in the same directory. In the example, the reference is human.fasta and the indexD- Pgenomic data base prefix is human.seed18 5. For accurate mutation detection using SNPSniffer, consider- ation should be given only to mutations for which the allele with maximum p-Value is 1e-10 or less. Such data can be gen- erated automatically by running the tool with the flag --pvalue_ threshold 1e-10. 6. The above information is incorporated into a config file for the run. For example: [Global] channels=1:5 input=/ifs/bioinf/workspace/bacreseq/smsDirectory/file. sms outdir=/ifs/bioinf/workspace/bacreseq/outputDir referenceName=human [snpSniffer] p-valueThreshold=1e-10 It is saved in a .conf file. For example, this file is named run. resequencing.conf. 7. To incorporate the parameters used in the example, the pipe- line should be launched with the following command: pypeline -p resequencing -c run.resequencing.conf
  • 33. 16 Steinmann et al. The resequencing pipeline generates various reports. The Resequencing summary report (reseq.summary.txt) can be used to assess the quality of a run. The table generated contains the following information: 1. Group: flow cell and channel of the processed data. 2. Reference: reference used to align the data. 3. Raw: number of unfiltered reads in the input file. 4. Filtered: number of reads remaining after a filtering step for read length and some sequence contexts. To accurately detect indels of longer lengths (up to 4) during bacterial genome resequencing, filtering out reads shorter than 25 is recommended. 5. Aligned: number of reads aligning to the given reference at a minAlignScore threshold of 1.3 or higher. This score takes into account length of the read, the number of matched nucleotides, and penalties for misalignments using a scoring scheme unique to the resequencing pipeline. 6. %filtered: filtered reads/raw reads. 7. %aligned: aligned reads/filtered reads. 8. MeanLen: mean length of aligned read. Mean length is around 35. 9. Del, Ins, Sub, Error: assessed per-base deletion, insertion, substitution, and total error rates, respectively based on align- ments reference. 10. NumSNPs: number of sequence variants detected by SNPSniffer. SNPSniffer generates a table of SNPs named: out_prefix_SNP. txt. The Mutation Analysis report has the following fields (see Table 1): 1. Num: mutation number 2. RefName: reference name 3. Start: start position of mutation 4. End: end position of mutation 5. Ref: reference nucleotide/s 6. Type: type of mutation SUB (substitution), INS (insertion), DEL (deletion) or LEN (homopolymer deletion) 7. ModelScore: defined only for LEN mutation. Deletions in homopolymers are indicated by the LEN mutation type. This type of mutation is determined by matching the observed dis- tribution of HP (homopolymer) length in the reads to a set of possible models. Two alleles will be present in the output table when the best matching model is the mixture of the 3.11. Resequencing Summary Report 3.12. The Mutation Analysis Report
  • 34. 17 Helicos Single-Molecule Sequencing of Bacterial Genomes Table 1 Mutation Table resulting from an alignment of the sequence generated from Escherichia coli K12 MG1655 to the E. coli EDL933 reference sequence Part A Num RefName Start End Ref Type Model score Shift Allele 1 Allele2 Depth Count 1 Count 2 14722 gi|56384585|gb|AE005174.2| 1671091 1671091 A SUB 0 G 252 233 14718 gi|56384585|gb|AE005174.2| 1670442 1670442 C SUB 0 G 232 225 14719 gi|56384585|gb|AE005174.2| 1670606 1670606 T SUB 0 C 230 228 14720 gi|56384585|gb|AE005174.2| 1670736 1670736 G SUB 0 T 223 218 14717 gi|56384585|gb|AE005174.2| 1670224 1670224 T SUB 0 C 179 170 14721 gi|56384585|gb|AE005174.2| 1670843 1670843 A SUB 0 G 173 168 29003 gi|56384585|gb|AE005174.2| 3109283 3109283 G SUB 0 A G 172 56 112 14723 gi|56384585|gb|AE005174.2| 1671310 1671310 C SUB 0 T 164 162 4359 gi|56384585|gb|AE005174.2| 406325 406325 C SUB 0 T C 157 41 114 29002 gi|56384585|gb|AE005174.2| 3109275 3109275 T SUB 0 C T 151 70 78 9367 gi|56384585|gb|AE005174.2| 867170 867170 A SUB 0 G 122 120 53715 gi|56384585|gb|AE005174.2| 5210721 5210721 G SUB 0 T G 111 41 66 51180 gi|56384585|gb|AE005174.2| 5013503 5013503 T SUB 0 G T 109 28 79 40900 gi|56384585|gb|AE005174.2| 4076594 4076594 T SUB 0 C T 108 41 67 51432 gi|56384585|gb|AE005174.2| 5029061 5029061 T SUB 0 C T 101 42 59 42574 gi|56384585|gb|AE005174.2| 4225504 4225504 N SUB 0 C 100 98 34786 gi|56384585|gb|AE005174.2| 3572816 3572816 A SUB 0 A C 98 41 55 (continued)
  • 35. 18 Steinmann et al. Part B Num Freq1 Freq2 p-Value1 p-Value2 Freq A Freq C Freq G Freq T Freq - 14722 0.924603 0 0.0238095 0 0.924603 0 0.0515873 14718 0.969828 0 0.0043103 0 0.969828 0 0.0258621 14719 0.991304 0 0 0.991304 0 0 0.0086957 14720 0.977578 0 0 0 0 0.977578 0.0224215 14717 0.949721 0 0.0055866 0.949721 0 0 0.0446927 14721 0.971098 0 0 0 0.971098 0 0.0289017 29003 0.325581 0.651163 7.48E-90 1.79E-223 0.325581 0 0.651163 0 0.0232558 14723 0.987805 0 0.0060976 0 0 0.987805 0.0060976 4359 0.261146 0.726115 1.18E-61 1.71E-236 0 0.726115 0 0.261146 0.0127389 29002 0.463576 0.516556 2.29E-125 1.74E-144 0 0.463576 0 0.516556 0.0198676 9367 0.983607 6.87E-286 0.0081967 0 0.983607 0 0.0081967 53715 0.369369 0.594595 5.97E-69 2.47E-128 0 0.009009 0.594595 0.369369 0.027027 51180 0.256881 0.724771 2.19E-42 2.87E-164 0.0091743 0 0.256881 0.724771 0.0091743 40900 0.37963 0.62037 1.49E-69 3.92E-132 0 0.37963 0 0.62037 0 51432 0.415842 0.584158 2.67E-73 3.23E-114 0 0.415842 0 0.584158 0 42574 0.98 4.49E-233 0 0.98 0 0 0.02 34786 0.418367 0.561224 9.92E-72 3.52E-105 0.418367 0.561224 0 0.0102041 0.0102041 Table 1 (continued)
  • 36. 19 Helicos Single-Molecule Sequencing of Bacterial Genomes Part C Num p-Value A p-Value C p-Value G p-Value T p-Value - Flanking 14722 0.00052 0 0.000336 GCGACAGCAGTAAGACTTCCTTCCTAGTATTGCTTACGCCAGAG AAATAAC 14718 0.59641 0 0.186581 TTTCACTGTTGAAGCCGCCGGTAGTCACCGCCCAGTGCAGTGCC TCACGAT 14719 0 0.893853 TGTGCCCGTTTCGATGGCGGTACAGTAGGTTTTCGCTCAAGCAAC AGCGCA 14720 0 0.307612 CCCATACCCGACGATAACCATACGTGGGCAGCTCTCCGATAACAT GGTGTA 14717 0.50345 0 0.010203 GTCACGCTTTATCGTTTTCACGAAGTTCTCTGCTATTCCGTTACT CTCCGG 14721 0 0.15894 TCATCGGTTCGTCTGAGAATGACGTACAACTGCGCACGCGACAC CCGGAGA 29003 7.48E-90 1.79E-223 0.315601 ACGCCGCATCCGACATCTAACGCCCGAGCCGGTTGCCTGATGCG ACGCTGG 14723 0.47345 0 0.934513 AAGACTATCACTTATTTAAGTGATACTGGTTGTCTGGAGATTCAGG GGGCC 4359 1.71E-236 1.18E-61 0.73285 ACCGATGCCTGATGCGCCGCTGACGCGACTTATCAGGCCTACGG GGTGAAC 29002 2.29E-125 1.74E-144 0.454427 AAGCGGTCACGCCGCATCCGACATCTAACGCCCGAGCCGGTTGC CTGATGC 9367 0.37944 6.87E-286 0.868376 TTGCGTCAGCAACGGCCCGTAGGGCAAGCGAAGCGAGTCATCCT GCACGAC 53715 0.352165 2.47E-128 5.97E-69 0.276962 GTAAACGCCTTATCCGGCCTACGGAGGGTGCGGGAATTTGTAGG CCTGATA (continued)
  • 37. 20 Steinmann et al. Table 1 (continued) Part C Num p-Value A p-Value C p-Value G p-Value T p-Value - Flanking 51180 0.34708 2.19E-42 2.87E-164 0.836628 CGCAAATTCAATATATTGCAGAGATTGCGTAGGCCTGATAAGCGT AGCGCA 40900 1.49E-69 3.92E-132 ATAAGCCGCTTTCTTTTGGGTATAGTGTCGTGGACAGTCATTCAT CTTTCT 51432 2.67E-73 3.23E-114 TTGCGGCACTGGAGTTTGGCAACAGTGCCGGATGCGGCGCAAG CGCCTTAT 42574 4.49E-233 0.492269 TGTNTGGCAGTTTATGGCGGGCGTCNTGCCCGCCACCCTCCGG GCCGTTGC 34786 9.92E-72 3.52E-105 0.318375 0.803853 GGTAACCCTGAGCACGCAGTTCTTCAGTCAGGCGTGGTGCACC GTAACGCT The complete table was sorted for descending depth and then for ascending p-values for allele 1. Only the first 17 lines of the table are presented. It is divided into three parts for ease of viewing
  • 38. 21 Helicos Single-Molecule Sequencing of Bacterial Genomes distributions corresponding to the two lengths. The score with which the best matching model matches the data is the model score. The closer it is to one the better the match. A score above .98 is a good score. A score of .99 and above is an excellent score. A score below .95 is not particularly good. In order to be confident of a length mutation, it is necessary to both have a good model score and a low p-value. 8. Shift: 0 for substitutions and deletions negative for insertions. A shift of −1 indicates that the insertion is immediately to the left of the position indicated. A shift of −2 indicates that the insertion is to the left of the first insertion at −1. 9. Allele1/Allele2: this indicates the nucleotide composition of each allele. 10. Depth: the number of reads that span the mutation. A mini- mum depth of 20 is acceptable for mutation calling for any diploid organism when there are no mixtures of strains. The table can be filtered to exclude SNPS in locations with depths less than 20. 11. Count1/Count2: the number of reads that have each one of the alleles. 12. Freq1/Freq2: frequency of each allele that is Count i/Freq i where i=1 or 2. 13. p-Value1/p-Value2: each variation has a p-value associated with it. This is the probability that the mutation observed was generated by chance due to sequencing errors. It is recom- mended to consider only mutations for which the allele with maximum p-value is 1e-10 or less. Such data is generated automatically by including p-valueThreshold=1e-10 in the config file. 14. Freq A/C/G/T/-: counts/depth for each nucleotide type. 15. p-Value A/C/G/T/-: p-values for each of the nucleotides. 16. Flanking: flanking region for mutation with an additional 25 nucleotides on each side. 1. The method used for bacterial DNA isolation is dependent upon the bacterial source. The Qiagen kit has been used suc- cessfully for bacterial DNA isolation. It can be used for Gram-negative and some Gram-positive bacteria. Various phenol–chloroform extraction and isopro- panol precipitation methods have also successfully been used to purify bacterial DNA for sequencing. We discourage the 4. Notes
  • 39. 22 Steinmann et al. use of any protocol that involves bead-beating, as it has been shown to reduce the yield of DNA in the correct size range for sequencing. 2. For higher throughput applications, the Covaris E210 Instrument uses the same shearing parameters as the S2 instrument, but is capable of shearing up to 96 samples unat- tended. Higher throughput enzymatic methods for obtaining fragment sizes between 200 and 300 bp (New England Biolabs, Ipswich, MA; Epicentre® Biotechnologies, Madison, WI) that are compatible with this protocol can also be used. 3. Axygen MAXYMum Recovery tubes have been shown to increase sample yield and reduce variability in the polyA tailing reaction. MAXYMum Recovery tubes should be used through- out the sample preparation process and for sample storage. 4. 4–20% Gradient gels should be used in these steps. They opti- mize both the ability to determine that there is no detectable DNA less than 50 bp after size selection and the ability to visualize the TR oligo in the control tailing reaction. 5. The TR oligo and dATP should be purchased from Helicos BioSciences Corporation. The reagents have been optimized to produce correct tail lengths and stabilized to permit long- term storage. 6. Smaller quantities of DNA can be sheared. If the sample reac- tion is modified to use 0.5–1 pmole of DNA (see Note 11) and the control reaction is modified to use 0.5 pmoles of DNA (see Note 13), as little as 100 ng of high quality DNA can be used at this step. 7. If you notice you are removing beads during aspiration, do not attempt to remove all the beads with a p1000 pipette. Rather, remove the last 20–50 mL with a p200 pipette. 8. If 100 ng of DNA has been sheared, the elution volumes should be reduced to 10 mL in both steps 12 and 15. In all cases, care should be taken to avoid getting beads in the supernatant. This can be achieved more easily by using a p10 pipette to aspirate the supernatant and by leaving the last microliter behind. 9. Care should be taken to avoid touching the gel. Clean containers and clean gloves should be used. 10. This gel step is largely a QC step. If you are processing many similar samples and find through initial gel studies that they shear to approximately the same size, this gel step can be omitted and an average size be used in subsequent calcula- tions. Portions of the sheared samples may be retained to run on a gel for troubleshooting purposes if the tailing reaction does not succeed.
  • 40. 23 Helicos Single-Molecule Sequencing of Bacterial Genomes 11. If sample is limiting, as little as 1 pmole of DNA can be put in a 40-mL sample reaction. For quantities of DNA less than 3 pmoles, the amount of dATP added must be scaled down in proportion to the amount of DNA added (e.g., for 2 pmoles of DNA, add 2.8 mL of dATP to the sample master mix; for 1 pmole, add 1.4 mL dATP). For quantities less than 1 pmole, the volume of the entire reaction should be scaled down (e.g., for 0.5 pmoles of DNA, the DNA should be in a final volume of 13 mL. The sample master mix should contain 2.2 mL of 10× terminal transferase buffer, 2.2 mL of CoCl2 (2.5 mM), 1.4 mL of a 1:2 dilution of HelicosTM PolyA Tailing dATP in water, 0.8 mL distilled water and 1.1 mL terminal transferase enzyme (20 U/mL) per sample. Seven microliters of sample master mix should be added to each 0.5 pmole DNA tube). 12. The mixing step is crucial to the success of the tailing reaction. 13. If sample is limiting, the control reaction can be scaled down to use 0.4 pmoles of DNA. The DNA should be in a final volume of 12 mL and 1 mL of a 1:2 dilution of the HelicosTM PolyA Tailing Control Oligo TR in water should be added. Two microliter of TR oligo should be used in the Oligo TR Control. The control master mix should contain 2.2 mL of 10× terminal transferase buffer, 2.2 mL of CoCl2 (2.5 mM), 1.4 mL of a 1:2 dilution of HelicosTM PolyA Tailing dATP in water, 0.8 mL of distilled water and 1.1 mL terminal trans- ferase enzyme (20 U/mL) per sample. Seven microliters of control master mix should be added to each tube. Scaling this reaction down does preclude verifying the outcome of a short tail correction reaction (steps in Subheading 3.6). 14. It is essential to chill the block to 0°C in an ice and water slurry, and cool the DNA as quickly as possible to 0°C to prevent re-annealing of the denatured, single-stranded DNA products. 15. The size of the single-stranded polyA tailed samples cannot be determined by direct comparison to the double-stranded DNA ladders. The migration patterns of TR oligos contain- ing dA90 and dA200 were determined experimentally. Acknowledgments The authors would like to acknowledge the valuable contribu- tions of Katica Ilic, Kristen Kerouac, and Eldar Giladi.
  • 41. 24 Steinmann et al. References 1. Eliminating amplification bias from genome analysis. Helicos BioSciences Corporation Tech Note, Available for download at: http:/ /helicosbio.com/HeliSphereCenter/ PublicationsLibrary/HelicosMarketing Collateral/tabid/168/Default.aspx. 2. MacLean, D., Jones, J. D. G., and Studholme, D. J. (2009) Application of ‘next-generation’ sequencing technologies to microbial genet- ics. Nat Rev Microbiol 7, 287–296. 3. Holt, K. E., Parkhill, J., Mazzoni, C. J., Roumagnac, P., Weill, F. -X., Goodhead, I., Rance, R., Baker, S., Maskell, D. J., Wain, J., Dolecek, C., Achtman, M., and Dougan, G. (2008) High-throughput sequencing pro- vides insights into genome variation and evo- lution in Salmonella Typhi. Nat Genet 40, 987–993. 4. Harris, S. R., Feil, E.J., Holden, M. T. G., Quail, M. A., Nickerson, E. K., Chantratita, N., Gardete, S., Tavares, A., Day, N., Lindsay, J. A., Edgeworth, J. D., de Lencastre, H., Parkhill, J., Peacock, S. J., and Bentley, S. D. (2010) Evolution of MRSA during hospital and inter- continental spread. Science 327, 469–474. 5. Smith, E. E., Buckley, D. G., Wu, Z., Saenphimmachak, C., Hoffman, L. R., D’Argenio, D. A., Miller, S. I., Ramsey, B. W., Speert, D. P., Moskowitz, S. M., Burns, J. L., Kaul, R. and Olson, M. V. (2006) Genetic adaptation by Pseudomonas aeruginosa to the airways of cystic fibrosis patients. Proc Natl Acad Sci USA 103, 8487–8492. 6. Mwangi, M. M., Wu, S. W., Zhou, Y., Sieradzki, K. de Lencastre, H., Richardson, P., Bruce, D., Rubin, E., Myers, E., Siggia, E. D., and Tomasz, A. (2007) Tracking the in vivo evolution of multidrug resistance in Staphylococcus aureus by whole-genome sequencing. Proc Natl Acad Sci USA 104, 9451–9456. 7. La Scola, B., Elkarkouri, K., Li, W., Wahab, T., Fournous, G., Rolain, J. -M., Biswas, S., Drancourt, M., Robert, C., Audic, S., Lofdahl, S., and Raoult, D. (2010) Rapid comparative genomic analysis for clinical microbiology: the Francisella tularensis paradigm. Genome Res 18, 742–750. 8. Srivatsan, A., Han, Y., Peng, J., Tehranchi, A. K., Gibbs, R. Wang, J. D. and Chen, R. (2008) High-precision, whole-genome sequencing of laboratory strains facilitates genetic studies. PLoS Genet 4, e1000139. 9. Dohm, J. C., Lottaz, C., Borodina, T. and Himmelbauer, H. (2008) Substantial biases in ultra-short read data sets from high-through- put DNA sequencing. Nucleic Acids Res 36, e105. 10. Hillier, L. W., Marth, G. T., Quinlan, A. R., Dooling, D., Fewell, G., Barnett, D., Fox, P., Glasscock, J. I., Hickenbotham, M., Huang, W., Magrini, V. J., Richt, R. J., Sander, S. N., Stewart, D. A., Stromberg, M., Tsung, E. F., Wylie, T., Schedl, T., Wilson, R. K., and Mardis, E. R. (2008) Whole-genome sequenc- ing and variant discovery in C. elegans. Nat Methods 5, 183–188. 11. Harismendy, O., Ng, P. C., Strausberg, R., L., Wang, X., Stockwell, T. B., Beeson, K. Y., Schork, N. J., Murray, S. S., Topol, E. J., Levy, S. and Frazer, K. A. (2009) Evaluation of next generation sequencing platforms for population targeted sequencing studies. Genome Biol 10, R32.
  • 42. 25 Chapter 2 Whole-Genome Sequencing of Unculturable Bacterium Using Whole-Genome Amplification Yuichi Hongoh and Atsushi Toyoda Abstract More than 99% of microorganisms on the earth are unculturable with known culturing techniques. The emergence of metagenomics with high-throughput sequencing technologies has enabled researchers to capture a comprehensive view of a complex bacterial community which comprises both culturable and unculturable species. However, the function of an individual species remains difficult to elucidate in a conventional metagenomic study, which generates numerous genomic fragments of unidentifiable ori- gins at a species or genus level. This limitation hampers any in-depth investigations of the community and its unculturable bacterial members. Recently, as an alternative or compensatory approach, genomics tar- geting a single unculturable bacterial species in a complex community has been proposed. In this approach, whole-genome amplification technique using Phi29 DNA polymerase is applied to obtain a sufficient quantity of DNA for genome sequence analysis from only a single to a thousand bacterial cells. It is expected that a combination of the conventional metagenomics and this single-species-targeting genomics provides a great progress in understanding of the ecology, physiology, and evolution of uncul- turable microbial communities. Key words: Whole-genome amplification, Phi29 DNA polymerase, Pyrosequence, Uncultivable, Uncultured, Environmental genomics, Metagenomics, Single-cell genomics, Termite, Symbiosis Culture-independent, molecular approaches have enabled researchers to explore the world of unculturable microorganisms since the 1990s. Molecular tools such as clone analysis and fluo- rescent in situ hybridization analysis, targeting small subunit (SSU) rRNA, have been applied to a wide variety of environmen- tal samples and revealed the existence of an enormous number of largely unknown, uncultured assemblages of microorganisms. 1. Introduction Young Min Kwon and Steven C. Ricke (eds.), High-Throughput Next Generation Sequencing: Methods and Applications, Methods in Molecular Biology, vol. 733, DOI 10.1007/978-1-61779-089-8_2, © Springer Science+Business Media, LLC 2011
  • 43. 26 Hongoh and Toyoda However, their functions have been mostly inaccessible until the emergence of metagenomics. Metagenomics with high-throughput sequencing technolo- gies is a powerful tool to uncover the “black box” of bacterial communities, which generally consist of both culturable and unculturable species. In a conventional metagenomic study, DNA is extracted from a heterogeneous microbial community, frag- mented, and sequenced to generate tens of megabases to several gigabases in total. Metagenomics reveals the functions of a bacte- rial community as a whole and the diversity of various genes within the community, and it is also useful to find novel genes encoding enzymes industrially or medically applicable. However, the function of an individual bacterial species remains largely unknown because the origins of most fragments generated in such metagenomic studies are generally unidentifi- able beyond a class level. Recently, to compensate this limitation in metagenomics, genomics targeting a single species of uncultur- able bacteria in a complex community has been proposed. This novel approach applies whole-genome amplification (WGA) using Phi29 DNA polymerase to prepare sufficient DNA quantities for the genome sequence analysis (1) (Fig. 1). To date, a couple of studies reported draft-genome sequences from single bacterial cells (2, 3), and two studies reported the complete genome sequences from 102 to 103 cells (4, 5), whereas ³1010 cells are required for a conventional genome sequence analysis. Here, we describe a protocol to acquire the complete genome sequence from 102 to 103 cells of a single bacterial species. We use an endosymbiotic bacterial species found inside the cells of pro- tists (single-celled eukaryote) in termite gut as an example. This method is applicable to other samples with certain modifications as long as 102 to 103 cells of a single bacterial species or strain can be collected. In the case that only a single or a few bacterial cells are collectable, the sequencing analysis will result in draft status with numerous contigs remaining (2, 3, 6, 7). Fig. 1. Outline of multiple displacement amplification.The whole genome regions can be amplified by the action of Phi29 DNA polymerase with random hexamers.
  • 44. 27 Whole-Genome Sequencing of Unculturable Bacterium 1. An inverted phase-contrast microscope equipped with two sets of the micromanipulator TransferMan NK2 and CellTram Vario (Eppendorf, Hamburg, Germany) (see Note 1). 2. Glass capillary: 15 mm diameter (Eppendorf) (see Note 2). 3. Glass capillary: 30–100 mm diameter (custom-made, Eppendorf). 4. 1.0% Nonidet P-40 (NP-40) (see Note 3): Sterilize with a 0.22 mm filter and the ultra violet (UV). For UV-sterilization, put the solution in a plastic tube in a UV-crosslinker for 10 min. Store in single-use aliquots at −20°C. 5. Trager’s solution U (sol U) (see Note 4): 37 mM NaCl, 9.2 mM NaHCO3 , 5.1 mM Na3 C6 H8 O7 ⋅2H2 O, 13 mM KH2 PO4 , 0.75 mM CaCl2 , 0.40 mM MgSO4 . Sterilize with a 0.22-mm filter and UV. Store in single-use aliquots at −20°C. 1. GenomiPhi HY DNA amplification kit (GE Healthcare, Hemel Hempstead, UK) (see Note 5). Store the enzyme at −70°C. The other components can be stored at −20°C. 2. Lysis buffer (LB) (2×): 400 mM KOH, 100 mM dithio­ threitol, 10m Methylenediaminetetraacetic acid (EDTA)⋅2Na⋅2H2 O. Sterilize with UV-irradiation and store at −20°C. It can be stored for 2 weeks. 3. Neutralization buffer (NB): 600 mM Tris–HCl, pH 7.5, 400 mM HCl (final pH 6.0). Sterilize with UV-irradiation and store at −20°C. 4. Tris–EDTA (TE) buffer: 10 mM Tris–HCl, pH 8.0, and 1 mM EDTA. 1. Taq DNA polymerase: e.g., EX-Taq polymerase (Takara, Tokyo, Japan). 2. Proof-reading DNA polymerase: e.g., Phusion (Finnzymes, Espoo, Finland). 3. PCR primers: bacteria-specific, 27 F (5¢- AGRGTTT GATYMTGGCTCAG) and 1492R (5¢- GGHTACCTTGTT ACGACTT); Archaea-specific, A25F (5¢- CYGKTTGATC CTGSCRG) and A1385R (5¢- GGTGTGTGCAARGAGCA); Eukarya-specific, E18F (5¢- GATCCMGGTTGATYCTGCC) and E1772R (5¢- CWDCBGCAGGTTCACCTAC). 2. Materials 2.1. Micromanipulation of Microbial Cells 2.2. Cell Lysis and WGA 2.3. Purity Check
  • 45. 28 Hongoh and Toyoda Because WGA can amplify a small amount of contaminant DNA, the handling of samples and reagents should be conducted with extreme caution. Wear disposable gloves, clean up, and bleach the benches and equipments to eliminate DNA contamination sources, use UV-sterilized filter tips and plastic tubes, and per- form experiments under a laminar flow cabinet. 1. Apply 2 ml of 1× LB into a sterile, 0.2-ml PCR tube and incubate on ice or a PCR-cooler. 2. Attach a glass capillary of 30–100 mm diameter to one of the two micromanipulators. The diameter of the capillary depends on the size of the host protist cells harboring the target bacte- rial symbiont. 3. Mark the position corresponding to the depth of a 0.2-ml PCR tube on a glass capillary of 15 mm diameter (Fig. 2), and attach it to the other micromanipulator. 4. Put the lid of a sterile, plastic Petri dish, upside down, on the stage of the inverted microscope. Apply 50 ml of sol U, five to ten times, onto the inner surface of the lid (Fig. 3). 5. Dissect a termite and remove the gut with forceps. 6. Puncture the dilated portion of the hindgut in one of the 50-ml drops of sol U on the lid. 7. Remove the gut from the suspension. 8. Dip the tip of the 30–100-mm diameter capillary and carefully collect several cells of the host protist species. There is no need to eliminate other species of protists and free-swimming bacteria at this step. 3. Methods 3.1. Collection of Bacterial Cells by Micromanipulation Fig. 2. Collection of bacterial cells by micromanipulation into a 0.2-ml PCR tube.
  • 46. 29 Whole-Genome Sequencing of Unculturable Bacterium 9. Release the collected cells into another 50 ml drop of sol U. 10. Collect the host protist cells. 11. Wash the cells by repeating steps 9 and 10 more than four times. 12. Change the capillary to a new one with the same diameter. 13. Apply 50 ml of 1% NP-40 onto the inner side of the lid of a new Petri dish (see Notes 3 and 6). 14. Collect a single cell of the host protist with the capillary and keep it within its tip. 15. Replace the lid of the Petri dish on the stage by the lid with 1% NP40 prepared in step 13. 16. Dip the tip of the 15-mm diameter capillary in the 1% NP-40 drop and adjust the pressure inside the capillary by handling the CellTram Vario. Be careful not to completely expel 1% NP-40 within the capillary. Bubbles make the phase-contrast image unclear. Keep the capillary tip within the eye field of the microscope. 17. Dip the tip of the 30–100-mm diameter capillary near the tip of the 15-mm diameter capillary in the 1% NP-40 drop and carefully release the host protist cell. 18. Within a few minutes, the endosymbiotic and ectosymbiotic bacterial cells will detach or leak out from the host protist cell. 19. Collect the bacterial cells as many as possible with the 15-mm diameter capillary. 20. Release the collected cells into LB in the PCR tube. Use the mark on the capillary in order not to break the fine tip of the glass capillary. 1. Incubate the collected bacterial cells in 1× LB on ice or a PCR-cooler for 10 min (see Note 7). 2. Prepare and perform the negative control reaction in parallel with the sample reaction. 3. Add 1.0 ml NB and mix briefly. 4. Add 22 ml sample buffer and mix briefly. 3.2. Whole-Genome Amplification Fig. 3. Drops of buffer on the inner surface of the lid of a Petri dish.
  • 47. 30 Hongoh and Toyoda 5. Prepare reaction mixture: mix 2.5 ml enzyme solution and 22.5 ml reaction buffer by pipetting. 6. Add the reaction mixture to the sample mixture. 7. Incubate at 30°C for 2.5 h. 8. Stop the reaction by incubating at 65°C for 10 min. 9. Check the amplification by agarose gel electrophoresis (see Note 8). 10. Purify DNA by ethanol precipitation. 11. Dissolve the precipitate in 50 ml TE. 12. Measure the DNA concentration. Before the genome sequence analysis, the purity of the WGA sample must be checked by clone analysis of genes such as SSU rRNA. If amplification of the genes by PCR from the negative control reaction is observed, the sample should not be used for further analyses. 1. Prepare 1:200-fold dilution of the purified WGA sample dis- solved in TE and of the negative control reaction without purification. Use 1/10 volume as the template for the follow- ing PCR. 2. Perform PCR using primer sets specific to eubacterial, archaeal, and eukaryotic SSU rRNA genes, respectively, and also those specific to protein-coding genes such as hsp60 and gyrB. Always perform the negative control experiment for PCR. PCR conditions: 95°C 30 s, 25 cycles of (95°C 10 s, 50°C 30 s, 72°C 2 min), 72°C 4 min. 3. If there is no PCR amplification from the negative control sample either for WGA or PCR, and only PCRs using bacteria- specific primers generate products from the WGA sample, move to the next step. 4. Perform PCR amplification of eubacterial 16S rRNA genes with a proof-reading DNA polymerase. 5. Clone and sequence the PCR products with standard methods. 6. Check whether the genomes of the target bacterial species predominate in the sample and also evaluate within-species variations of the target bacterium. After the purity check of the WGA sample, prepare a library for the pyrosequencer 454 GS FLX, exactly following the protocol distributed by Roche Diagnostics (see Note 9). It includes nebu- lization, end-polishing using T4 DNA polymerase, and adapter ligation. Because WGA generally accompanies amplification bias among the genome regions (Fig. 4), a deeper redundancy is necessary for acquiring a complete genome sequence. First, try 3.3. Checking Purity of Sample 3.4. Genome Sequencing Using 454 GS FLX
  • 48. 31 Whole-Genome Sequencing of Unculturable Bacterium pyrosequencing in a small scale and check the amplification bias and the purity. If the bias appears too large, it may be better to try another sample. Finishing can be done with a standard gap- closing procedure using a Sanger method. 1. It is possible to conduct the whole procedure with a single micromanipulator set, but the risk for making mistakes is much higher. When only a single set is available, carefully dip the tip of the 15-mm diameter capillary, as mentioned in step 16 of Subheading 3.1, at a position distant from the released host protist cell in the 1% NP-40 drop in order not to blow away the cell. 2. If one needs to collect only a single or a few bacterial cells, use a glass capillary of 4 mm diameter, though the handling is more difficult. 3. NP-40 is necessary to rupture the membrane structure of the host protist, and also useful to break the surface tension of the drop on the lid of the Petri dish. This makes the phase- contrast image clearer and is considerably helpful for the col- lection of bacterial cells by micromanipulation. 4. Sol U buffer is specifically adjusted for the protists in termite gut (8). One should use buffer adequate to each type of samples. 5. One can use other kits for WGA such as REPLI-g Midi (Qiagen, Düsseldorf, Germany). In any case, one must first check the purity of the purchased kit in a preliminary experiment; occasionally there are lots containing non-negligible amount 4. Notes Fig. 4. Bias among genome regions caused by whole-genome amplification (WGA).Typical patterns in genome sequence analyses without (above) and with WGA (below).
  • 49. 32 Hongoh and Toyoda of DNA contaminants. Although those lots are available for a standard use recommended by the manufacturers, they should not be used in WGA from less than 104 bacterial cells. 6. There are bacterial species sensitive to detergent (e.g., spiro- chetes). In that case, use buffer or sterile water, instead of NP-40, to collect the bacterial cells, although a very small amount of NP-40 should be added (a touch by a tip is enough) to the drop in order to obtain a clearer phase-contrast image. 7. There are bacterial species of which cells are not degradable under this alkaline condition. It is recommended to confirm the degradability in a preliminary experiment. 8. Possibly, the negative control may also generate considerable WGA products even without exogenous DNA contaminants. This can be caused by the amplification from primer dimers and indigenously contaminated DNA. Unless PCR amplifica- tion of genes from the negative control for WGA is observed, one can use the WGA sample. It is suggested that the background amplification can be suppressed by an addition of trehalose (9). Alternatively, the use of GenomiPhi v2 or REPLI-g UltraFast Mini also dimin- ishes the background amplification. Because these methods generate lesser amounts of WGA products, a second amplifi- cation step using GenomiPhi HY or REPLI-g Midi should be performed to obtain an enough amount of DNA (15–50 mg) for the genome sequence analysis. 9. For the genome sequence analysis, we recommend a hybrid use of 454 GS FLX and Illumina GA and do not recommend mate-pair analysis with a long insert, as suggested in a recent literature (7). WGA generates chimeric sequences (10) and the rate of their formation greatly increases in a traditional library construction for a Sanger method (11). Thus, the handling of data generated with a Sanger method needs cau- tion. If one needs to prepare a library for a Sanger method, a S1 nuclease treatment is recommended, which reportedly decreases the frequency of chimeras (11). In any case, increase of the sequence depth by using high-throughput sequencing technologies is still considered the best way to eliminate chi- meras and other artifacts in the assembling process. Acknowledgment The authors would like to thank Drs. M. Ohkuma, M. Hattori, and other coworkers for supporting our studies.
  • 50. 33 Whole-Genome Sequencing of Unculturable Bacterium References 1. Dean, F. B., Hosono, S., Fang, L., Wu, X., Faruqi, A. F., Bray-Ward, P., et al. (2002) Comprehensive human genome amplification using multiple displacement amplification, Proc. Natl. Acad. Sci. U. S. A. 99, 5261–5266. 2. Marcy, Y., Ouverney, C., Bik, E. M., Losekann, T., Ivanova, N., Martin, H. G., et al. (2007) Dissecting biological “dark matter” with sin- gle-cell genetic analysis of rare and uncultivated TM7 microbes from the human mouth, Proc. Natl. Acad. Sci. U. S. A. 104, 11889–11894. 3. Woyke, T., Xie, G., Copeland, A., Gonzalez, J. M., Han, C., Kiss, H., et al. (2009) Assembling the marine metagenome, one cell at a time, PLoS One 4, e5299. 4. Hongoh, Y., Sharma, V. K., Prakash, T., Noda, S.,Taylor,T.D.,Kudo,T.,etal.(2008)Complete genome of the uncultured Termite Group 1 bac- teria in a single host protist cell, Proc. Natl. Acad. Sci. U. S. A. 105, 5555–5560. 5. Hongoh, Y., Sharma, V. K., Prakash, T., Noda, S., Toh, H., Taylor, T. D., et al. (2008) Genome of an endosymbiont coupling N2 fixation to cellulolysis within protist cells in termite gut, Science 322, 1108–1109. 6. Podar, M., Abulencia, C. B., Walcher, M., Hutchison, D., Zengler, K., Garcia, J. A., et al. (2007) Targeted access to the genomes of low-abundance organisms in complex microbial communities, Appl. Environ. Microbiol. 73, 3205–3214. 7. Rodrigue, S., Malmstrom, R. R., Berlin, A. M., Birren, B. W., Henn, M. R., and Chisholm, S. W. (2009) Whole genome amplification and de novo assembly of single bacterial cells, PLoS One 4, e6864. 8. Trager, W. (1934) The cultivation of a cellu- lose-digesting flagellate, Trichomonas termop- sidis, and of certain other termite protozoa, Biol. Bull. 66, 182–190. 9. Pan, X., Urban, A. E., Palejev, D., Schulz, V., Grubert, F., Hu, Y., et al. (2008) A procedure for highly specific, sensitive, and unbiased whole-genome amplification, Proc. Natl. Acad. Sci. U. S. A. 105, 15499–15504. 10. Lasken, R. S., and Stockwell, T. B. (2007) Mechanism of chimera formation during the Multiple Displacement Amplification reac- tion, BMC Biotechnol. 7, 19. 11. Zhang, K., Martiny, A. C., Reppas, N. B., Barry, K. W., Malek, J., Chisholm, S. W., and Church, G. M. (2006) Sequencing genomes from single cells by polymerase cloning, Nat. Biotechnol. 24, 680–686.
  • 54. 37 Chapter 3 RNA Sequencing and Quantitation Using the Helicos Genetic Analysis System Tal Raz, Marie Causey, Daniel R. Jones, Alix Kieu, Stan Letovsky, Doron Lipson, Edward Thayer, John F. Thompson, and Patrice M. Milos Abstract The recent transition in gene expression analysis technology to ultra high-throughput cDNA sequencing provides a means for higher quantitation sensitivity across a wider dynamic range than previously possible. Sensitivity of detection is mostly a function of the sheer number of sequence reads generated. Typically, RNA is converted to cDNA using random hexamers and the cDNA is subsequently sequenced (RNA-Seq). With this approach, higher read numbers are generated for long transcripts as compared to short ones. This length bias necessitates the generation of very high read numbers to achieve sensitive quantitation of short, low-expressed genes. To eliminate this length bias, we have developed an ultra high-throughput sequencing approach where only a single read is generated for each transcript molecule (single-molecule sequencing Digital Gene Expression (smsDGE)). So, for example, equivalent quantitation accuracy of the yeast transcriptome can be achieved by smsDGE using only 25% of the reads that would be required using RNA-Seq. For sample preparation, RNA is first reverse-transcribed into single-stranded cDNA using oligo-dT as a primer. A poly-A tail is then added to the 3¢ ends of cDNA to facilitate the hybridization of the sample to the Helicos® single-molecule sequencing Flow-Cell to which a poly dT oligo serves as the substrate for subsequent sequencing by synthesis. No PCR, sample-size selection, or ligation steps are required, thus avoiding possible biases that may be introduced by such manipulations. Each tailed cDNA sample is injected into one of 50 flow-cell channels and sequenced on the Helicos® Genetic Analysis System. Thus, 50 samples are sequenced simultaneously generating 10–20 million sequence reads on average for each sample channel. The sequence reads can then be aligned to the refer- ence of choice such as the transcriptome, for quantitation of known transcripts, or the genome for novel transcript discovery. This chapter provides a summary of the methods required for smsDGE. Key words: Single-molecule sequencing, smsDGE, Expression analysis Young Min Kwon and Steven C. Ricke (eds.), High-Throughput Next Generation Sequencing: Methods and Applications, Methods in Molecular Biology, vol. 733, DOI 10.1007/978-1-61779-089-8_3, © Springer Science+Business Media, LLC 2011
  • 55. Other documents randomly have different content
  • 56. one of the most successful and lucrative periodicals that history has upon record. 1756. Francois, marquis de Beauharnois, died at Paris. He was a member of the national assembly, and took part in the king's favor; subsequently joined the army under Conde; and was banished by Napoleon in 1807. The heroic wife of Lavalette was his daughter. 1757. The British under Admiral Watson took by assault, Houghley, situated about thirty miles above Calcutta. 1761. Edward Boscawen, the English admiral, died. He was born 1711, and entered the navy at an early age. He acquired honorable distinction under Vernon, and afterwards signalized himself in many important contests with the French, in which he had the singular fortune to take the French commander, M. Hoquait, a prisoner three times, viz. in 1744, 1747 and 1755. On his return to England in 1759, after destroying the Toulon fleet in the Mediterranean, he was rewarded with a pension of £3000 a year. 1763. Casper Abel, a voluminous German historian and antiquary, died. 1765. Stamp Act passed the British Parliament. How little did that body anticipate the consequences that were to follow their decision on that subject. 1776. The New Hampshire convention dissolved itself and assumed legislative powers, chose twelve counselors as an executive branch, and delegates to Congress, which were recognized. 1782. George Costard died. A classical, mathematical and oriental scholar, whose reputation as an author is chiefly derived from a History of Astronomy, highly appreciated in Europe. 1791. Vermont, the last of the thirteen original states which composed the Union, adopted the constitution and took her place in the confederacy. 1795. The French frigate Iphigenie, 32 guns, captured by the Spanish fleet off Catalonia.
  • 57. 1797. French sloop Atalante, 16 guns, captured off Scilly by the British frigate Phœbe, 36 guns, Capt. Barlow. 1800. The first soup establishment for the poor was opened at Spitalfields, London. 1806. The Dutch surrendered the cape of Good Hope to the British. 1808. Phillips Cosby, British admiral of the Red, died aged 78. 1809. Samana taken by the British, together with two privateers, and four vessels laden with coffee. 1812. London involved for several hours in impenetrable darkness. The sky, where any light pervaded it, showed the aspect of bronze. It was the effect of a cloud of smoke, which, from the peculiar state of the atmosphere, did not pass off. Were it not for the peculiar mobility of the atmosphere, this city of a hundred thousand chimneys would be scarcely habitable in winter. 1815. The British under Gen. Lambert having abandoned the enterprise on New Orleans began to re-embark their artillery and munitions, preparatory to a general retreat. 1816. The schooner Eliza cast away near Newport; the captain and crew saved by Com. Perry, who with part of the crew of the frigate Java, went five miles in a boat to their relief. 1824. Thomas Edward Bowditch, the African traveler, died. He went to Africa at the age of 21, and engaged in a series of expeditions into the country. In 1822 he went out from England with a view of devoting himself to the exploration of the African continent. He had only arrived at the mouth of the Gambia when a disease occasioned by fatigue and anxiety of mind put an end to his existence. 1833. Adrien Marie Legendre, so well known as a profound mathematician, died at Paris. His life work on geometry is much used. 1840. The uniform penny postage commenced in England; the number of letters despatched from London on this day being
  • 58. 112,000; the average, for January, 1839, being 30,000. 1840. Battle between the Russian and Khivian cavalry; the latter commanded by the khan in person were completely routed and pursued to the city of Khiva. 1848. Miss Caroline Herschel, member of the Royal astronomical society, London, died at Hanover. 1855. Mary Russel Mitford died, aged 68; a distinguished English authoress. 1856. Thomas H. Perkins, a wealthy and liberal Boston merchant, died aged 89. His was the first American firm engaged in the China trade. JANUARY 11. 395. Theodosius the Great, emperor of Rome, died. He was born about the year 346, and on coming to the throne distinguished himself by his orthodoxy, and his zeal against heresy and paganism. His public and private virtues, which procured him the name of The Great, will scarcely excuse the fierceness of his intolerance, or the barbarity of his anger and revenge. 1569. The first English lottery drawn at London. It continued day and evening four months. The prizes were money, plate and merchandise. It had been advertised two years at the time it took place. 1698. Peter, the czar of Russia, arrived in England and wrought as a mechanic in the dockyard at Deptford, as well as in the workshops of various mechanics, with view of carrying the English arts into his own country. He was well received by William III. 1751. A globular bottle of glass was made at Leith measuring 40 by 42 inches, the largest ever made in Britain. 1753. Sir Hans Sloane, the eminent English naturalist, died, aged 93. He was born at Killileagh in Ireland; studied medicine in London, and
  • 59. settled there in the practice of his profession. He was the second learned man whom science tempted to America. His museum, composed of the rarest productions of nature, he bequeathed to the public, on condition of the payment of £20,000 annually to his family, and was the foundation of the British Museum. 1775. The first provincial congress of South Carolina met at Charleston. 1778. Charles Linne (or Linnæus), the Swedish botanist, died, aged 71. In his twenty-fourth year he conceived the idea of a new arrangement of plants, or a sexual system of botany. In 1732 the Academy of Sciences at Upsal appropriated 50 Swedish dollars to send him on a tour through Lapland, and with this small sum he made a journey of more than 3500 miles, unaccompanied, traversing the Lapland desert, and enduring many hardships. A series of offices and honors were conferred upon him, till in 1753 he was created a Knight of the Polar Star, an honor never before conferred on a literary man; and in 1761 he was elevated to the rank of nobility. 1778. A collection amounting to £3815 was made for the 924 American prisoners in England. Dr. Franklin, at Paris, applied to the British ambassador for an exchange of prisoners, but his lordship was pleased to return only the following answer: no application received from rebels unless they come to implore his majesty's pardon. 1782. Ostenburg, near Trincomalee, in the island of Ceylon, taken from the Dutch by the British Admiral Hughes. 1795. The French, under Pichegru, crossed the Waal on the ice at different points. 1800. William Newcome, archbishop of Armagh, died, aged 79. He rose gradually in the church to the primacy of Ireland; was a worthy man, and author of a great number of theological works. 1801. Cimarosa, the celebrated Italian musician, died.
  • 60. 1803. The Hindostan, East Indiaman, lost on the Culvers, off Margate, in a dreadful storm. 1805. Letters of marque and reprisal issued by Great Britain against Spain. 1807. Breig in Silesia surrendered to the French and Bavarians; 3 generals, 1400 Prussians, and considerable magazines were captured. 1810. In the night the mercury in three thermometers froze at Moscow and withdrew into the ball. At Iraish it was observed at -44½° of Fahrenheit immediately before it froze. 1811. Marie Joseph de Chenier, a French poet, died. By flattering the passions of the people he soon gained great popularity, and during the revolution was one of the most violent democrats. 1815. Cumberland island, Georgia, taken possession of by Capt. Barrie of the British ship Dragon. Same day British sloop of war, Barbadoes, Capt. Fleming captured privateer schooner Fox, of 7 guns and 72 men from Wilmington. 1817. Timothy Dwight, president of Yale college, died, aged 65. He entered Yale college at the age of 13, and became a tutor at 19. His health becoming impaired, by the advice of his physicians he traveled, walking 2000 and riding 3000 miles in the course of a year. It had the effect to restore his constitution completely. His published works consist of theology, poetry and travels. His biography is interesting; he was an uncommon character. 1829. Gregorio Funes, a patriot of La Plata, died at Buenos Ayres. He was actively engaged in the South American revolution from its commencement. He was also an author. 1839. Alexander Coffin, the last survivor of the original proprietors who settled the city of Hudson in 1784, died, aged 99. He was highly respected for his talents, integrity and usefulness. 1839. Earthquake at Martinique, which did great damage, particularly at Fort Royal, where only 18 houses were left standing,
  • 61. of 1700, and 900 hundred sufferers were dug out of the ruins. 1843. Francis S. Key, district attorney of the United States and author of the national song, the Star Spangled Banner, died in Baltimore. 1853. Russia, Austria and Prussia, after considerable delay, finally acknowledge Napoleon III as emperor of France. 1853. The caloric ship Ericsson made her trial trip from New York to the Potomac. JANUARY 12. 400. B. C. Xenophon, with the 10,000, forced a passage through the defiles of Armenia. 1519. Maximilian I, emperor of Germany, died. He was elected king of the Romans 1486, and ascended the imperial throne 1493. Under him the Turks were checked in their enterprises against Germany, and repelled from his hereditary territories. 1598. The Marquis De la Roche received from Henry IV a commission to conquer Canada. He sailed from France with a colony of convicts from the prisons. He landed them on the Isle of Sable, and sailed for Acadie, from whence he returned to France. The survivors of the colony, twelve in number, were taken off seven years afterwards, and presented to the king in their sealskin clothes and long beards. He gave them fifty crowns each and pardoned their offences. 1640. An engagement of four days' duration near the Island Tamaraca, Brazils, between the Dutch and Portuguese, in which the latter were defeated and the Dutch admiral killed. 1678. A remarkable darkness at noon in England. 1777. General Mercer died of the wounds of the battle of Princeton. 1781. The states general of Holland issued letters of marque and reprisal against England.
  • 62. 1793. Arthur Lee, a distinguished American statesman, died at Urbana, Va. The long and faithful services which he rendered his country during his arduous struggles for independence, in the alternate character of ambassador and statesman, are universally known and acknowledged. 1794. John George Adam Forster died, aged 40. He was of Scotch descent, born in Prussia, studied at St. Petersburg, taught German and French in England, accompanied Cook in his voyage round the world, accepted the professorship of natural history at Hesse Cassel, was appointed historiographer of a Russian expedition round the world; this project being frustrated by the Turkish war, he went to Germany, and residing at Mentz when the French took that city 1792, was sent by the republicans to request a union of that city with France. During his absence the Prussians retook the city, by which he lost all his property, including his books and papers, and died soon after. The Germans number him among their classical writers. 1795. In consequence of a great thaw, the communication of the main army of the French under Pichegru and the four divisions that crossed the Waal the day before on the ice, was totally interrupted during two days. 1795. Mr. Pitt recommended in the British parliament that a premium be given by government to large families. 1805. British frigate Doris, Capt. Campbell, lost on the Diamond rock, Quiberon bay. The crew saved themselves and blew up the frigate. 1805. The thermometer at Danbury, Ct., stood at 19° below zero; being the coldest weather known there since 1780. 1807. A fatal explosion at Leyden, in Holland. A vessel containing 40,000 pounds of powder, moored before the house of Prof. Rau, exploded with a tremendous crash. Upwards of 200 houses were overthrown, besides churches and public buildings, 150 persons killed and 2000 wounded.
  • 63. 1809. Cayenne surrendered by the French, to the British and the Portuguese under Capt. Yeo. 1815. National fast in the United States. JANUARY 13. 857. Ethelwulf, son of Egbert, sometimes styled the first king of England, died. In his reign the tax called Peter's pence was levied. 1399. The Tartars, under Tamerlane, pillaged the imperial city of Delhi, and two days after wantonly massacred the entire Indian population. 1400. Richard II of England murdered. He came to the throne at the age of 11, and after a turbulent reign of 22 years, was deposed and imprisoned. 1404. It was enacted at this short parliament of Henry's that no chemist shall use his craft to multiply gold or silver. 1560. John de Lasci, a learned Pole, died. 1618. Galileo discovered the fourth satellite of Jupiter. 1669. John Bochius, a Dutch poet, died. He excelled in Latin, and is called the Virgil of the Low Countries. 1691. George Fox, founder of the sect of quakers, died, aged 67. His father was a poor weaver, and George was apprenticed to a shoemaker; but he left his employment and wandered about the country in a leather doublet, and finally set up as a teacher. He visited different countries, and had the satisfaction to see his tenets taking deep root in his life time. 1705. A house in London where fireworks were manufactured, blew up, and destroyed 120 houses, and killed 50 persons. 1711. The last No. of the Tatler appeared (No. 271). 1715. Great fire in Thames street, London; many lives lost.
  • 64. 1716. Elizabeth Patch died at Salem; the first female born in the old colony of Massachusetts. 1717. Maria Sybilla Merian, the distinguished painter, and writer on entomology, died at Amsterdam. 1738. The famous convention of Pardo signed. 1759. Execution of the conspirators against the life of the king of Portugal. The whole family of the Marquis Tavora was executed, and the name suppressed for ever. 1797. British ships Indefatigable, 44 guns, and Amazon, 42 guns, had a night action of six hours, in the bay of Audierne, with the French 74 gun ship Les Droits des Hommes, 1600 men; the latter was driven on shore, and the crew made prisoners; Gen. Renier and 750 men were lost in the action. The Amazon was also lost in the action. 1798. Lieut. Lord Camelford shot Lieut. Charles Peterson, at English harbor, Antigua, for disobedience of orders, was afterwards tried and acquitted. 1798. The Swiss cantons armed against France. 1809. The French under Marshal Victor defeated the Spanish under Castanos at Cuenca. 1811. The British merchant ship Cumberland, Captain Barrat, beat off 4 French privateers, and took 170 men who had boarded her. 1814. British and Prussians repulsed in an attack on Antwerp; part of the suburbs were burnt. 1814. The emperor of Russia and king of Prussia crossed the Rhine to invade France; the emperor of Austria, who had arrived the evening before at Cassel, went out to meet them, and they entered Basil, in Switzerland. 1814. General thanksgiving throughout Great Britain for the successes gained over Bonaparte.
  • 65. 1814. Capt. Barrie of the British ship Dragon, took the fort on Point Peter and the tower of St. Mary's, in Georgia; they afterwards destroyed the fort. 1817. The ship Georgianna, of Norfolk, experienced a tremendous shock in the Gulf stream supposed to be by earthquake; the day was calm. 1822. Johann Gottlieb Schneider, a German philologist and naturalist, died, aged 72; a voluminous author. 1836. Karl Chr. Traug. Tauchnitz, an eminent German printer, died, aged 75. At the age of 35 he commenced business for himself with a single press; but his establishment soon became very extensive, including a letter foundry and book store. He was most indefatigable in improving and perfecting whatever he undertook, as his publications attest. His founts of oriental type were unsurpassed in Germany. 1838. Chancellor Eldon died. 1840. Steam boat Lexington burnt, on her passage from New York to Stonington. Of 145 persons on board, only four escaped with their lives. Among the sufferers were many highly esteemed and valuable members of society. 1848. A severe battle took place at Chillianwallah between the British and Sikh forces without decisive results. 1854 An earthquake at Finana in Spain, crumbling down the Alcazaba, an ancient Moorish castle, prostrating houses and causing chasms in the streets, and loss of lives. JANUARY 14. 1526. Treaty of Madrid between the emperor Charles V, and Francis I of France, by which the latter obtained his liberty.
  • 66. 1604. The episcopal divines and puritans held a conference at Hampton court in the presence of King James. 1611. Edward Bruce, a Scottish statesman, died. He occupied some of the highest offices under the government, and his services were important in establishing the peaceable accession of James to the English throne. 1622. Pietro Sarpi, better known as Father Paul of Venice, died, aged 90. He employed the latter part of his life in writing a history of the council of Trent, in which he has developed the intrigues connected with the transactions of that famous assembly, with a degree of boldness and veracity, which renders the work one of the most interesting and important productions of the class to which it belongs. 1634. Of seven sailors left at Spitzbergen in the fall of 1633, by the Dutch fishermen, for the purpose of wintering there, the first of the number died. The journal which they kept relates that they sought in vain for green herbs, bears and foxes, in that desolate region. In November the scurvy appeared among them. Their journal ended February 26, and they were all found dead on the return of their countrymen in spring. (See April 16.) 1696. Marie de Rabutin Sevigne, a French woman of quality, died, aged 70. Her Letters (11 vols. 8vo.) are models of epistolary style, and have been translated into English. 1738. The famous convention of Pardo signed. 1739. The pope issued an edict against the assemblies of freemasons, under penalty of the rack and condemnation to the galleys. 1742. Edmund Halley the astronomer, died, aged 86. He devoted himself to mathematics with great success, and spent much time abroad in astronomical observations and experiments. His astronomical pursuits tended greatly by their results to improve the art of navigation.
  • 67. 1753. George Berkley, bishop of Cloyne in Ireland, died, aged 85. He appeared as an author before his twentieth year. He devoted seven years and a considerable part of his fortune in an effort to establish a college at Bermuda, for the education of Indian preachers, which miscarried. He published several philosophical, mathematical and theological works, and is said to have been acquainted with almost every branch of human knowledge. 1781. French took the island of Nevis. 1783. Cervetto, an Italian of extraordinary musical genius, died at London, aged 103. He was a member of the orchestra of Drury lane theatre. 1784. Congress ratified the definitive treaty of peace. 1792. Joseph Jackson, a celebrated English type founder, died. While an apprentice his master had carefully kept from his view the mode of making punches, but by boring a hole through the door he got an occasional glimpse of the art, and succeeded. 1795. Intense frost in Holland, which enabled the remainder of the French army to cross the Waal. 1795. The French were repulsed in an attack on all the posts of the allies, from Arnhem to Amerongen. In the night the allies retreated to Amersfoort, leaving 300 sick behind them. 1797. Battle of Rivoli in Italy. The contest was continued three days, and decided the fate of Mantua. The French under Joubert were victorious over the Austrians. 1798. Five English gentlemen who had been sent to investigate the title of Vizier Ally, were by his orders assassinated at Benares in India. 1801. Robert Orme died, aged 73; historiographer to the East India company. 1801. An embargo laid in England on all Russian, Swedish and Danish ships. More than 100 Swedish and Danish vessels were
  • 68. immediately seized. 1809. Formal treaty of peace, friendship and alliance between Great Britain and Spain. 1813. An engagement off Pernambuco between the United States privateer schooner Comet, Capt. Boyle, 14 guns and 120 men, and three British vessels of 24 guns, convoyed by a Portuguese ship of 32 guns and 165 men. The Portuguese were beaten off, and the British vessels captured. She also captured three other vessels on the passage. 1814. Treaty of peace signed at Kiel between Denmark and England. 1814. Charles Bossut, a French mathematician, died, aged 84. He studied under D'Alembert, and rose to eminence. On the breaking out of the French revolution he lost the offices he had acquired, and subsisted by his writings. He was a contributer to the Encyclopedie. 1815. Com. Decatur, sailed from New York in the frigate President. 1822. The Grand Duke Constantine declined, by letter to his brother Alexander, the succession to the throne of all the Russias. 1831. Henry Mackenzie, the novelist, died, aged 86. He studied the law, at the same time cultivating elegant literature. His first effort was a tragedy, which was favorably received; his first novel appeared in 1771, in which he was eminently successful. Scott entitles him the Scottish Addison. 1834. William Polk, a revolutionary officer, died. He held the rank of colonel at the close of the war, and was the last surviving field officer of the North Carolina line. He was among the small band of patriots who declared independence in Mecklenburg county, N. C., May 20th, 1775. 1838. Navy island evacuated by the Canadians, c., under Mackenzie and Van Rensselaer, 510 in number. The arms belonging to the United States were surrendered, as also the cannon belonging to the state of New York.
  • 69. 1852. T. Hudson Turner died, aged 37; one of the ablest of the British archæologists. 1854. Joshua Bates, a distinguished New England clergyman, died, aged 77. He was twenty-three years president of Middlebury college. JANUARY 15. 69. Sergius Galba, the Roman emperor, assassinated, at the age of 72. He was the successor of Nero, and reigned but three months. 936. Rodolph, king of France, died, in the 14th year of his reign, and was succeeded by Lewis the Stranger. 1549. The liturgy of the English church established by parliament. All the divine offices were to be performed according to the new liturgy, and infringements were to be punished by forfeitures and imprisonments, and for the third offence imprisonment for life. Visitors were appointed to see that it was received throughout England. From this time we may date the era of the Puritans. 1655. Daniel Heinsius, a Dutch philologist, died. He made great progress as a student, under Scaliger, and was appointed to a professorship at Leyden. He was also successful as a Greek and Latin poet. 1559. Queen Elizabeth, crowned at Westminster, by the bishop of Carlisle, who was the only person that could be prevailed upon to perform the ceremony. 1672. John Cosin, bishop of Durham, died; a lover of literature and prodigal in his expenditures on book-binding. He ordered that all his books should be rubbed once a fortnight to prevent their moulding. 1693. An army of six or seven hundred French and Indians set out from Montreal to invade the Mohawk castles. (See Feb. 6.) 1730. Gov. Montgomerie granted the city of New York a new charter. Although that city had been put under the government of a mayor in
  • 70. 1665, it was not regularly incorporated until 1686. 1773. At Duff house, the residence of the countess dowager of Fife, the first masquerade ever seen in Scotland was exhibited. 1777. Vermont declared itself a free and independent state. It had been settled as a part of New Hampshire, but was claimed as a part of New York, and so decided to be by the British crown. But by the dissolution of the bonds which had held America in subjection to the crown of Britain, they considered themselves free from New York, to which the most of them had never voluntarily submitted; and being, as they said, reduced to a state of nature, they assumed the right to form such connections as were agreeable to themselves. Accordingly they formed a plan of government and a code of laws, and petitioned congress to receive them into the Union. 1778. Nootka sound and the Sandwich islands discovered by Captain Cook. 1780. First exportation of woolen goods from Ireland to a foreign market. 1780. Unsuccessful attack by the Americans under Lord Stirling on the British at Long island. 1781. The traitor Arnold succeeded in burning some stores at Smithfield. 1783. William Alexander, Lord Stirling, an officer in the revolutionary army, died at Albany, aged 57. He was of Scotch descent, and from early youth a mathematician. Throughout the war he acted an important part, and was warmly attached to Washington. He left behind him the reputation of a brave, discerning and intrepid officer, and an honest and learned man. He was generally styled Lord Stirling, and was considered the rightful heir to the title and estates of that earldom in Scotland. 1794. A desperate engagement off the island of Corsica between three Sardinian ships and two Barbary xebecs. One of the xebecs was captured, but the other, rather than surrender, was blown up;
  • 71. upon which the prisoners taken, Turks and Algerines, 92 in number, were put to death. 1795. The French attacked the British outposts at Rhenen. 1795. The French national convention liberated Gen. Miranda and Capt. Lacrosse from prison. 1799. A revolution at Lucca in Italy, without bloodshed. Titles and exclusive privileges were abolished, the sovereignty of the people proclaimed, and a contribution of two millions of livres levied on the nobility alone, which was immediately presented to the French general Serrurier. 1805. Abraham Hyacinthe Anquetil Du Perron, the French orientalist, died, aged 74. He studied theology, but afterwards devoted himself with ardor to the study of the eastern languages. In 1754 he embarked for India, and with difficulty succeeded in finding some priests to instruct him in the sacred language of the Parsees. He returned to Paris in 1762 with a number of manuscripts, and proceeded to arrange them for publication. During the revolution he shut himself up with his books; but continued labors and an abstemious diet exhausted his constitution. He was a learned and excellent man. 1807. Battle between the forces under Christophe and Petion for the governorship of Hayti, which had been assumed by Christophe as the oldest general, on the death of Dessalines; but Petion had been subsequently duly elected. Christophe was defeated after a fierce encounter. A separation of the republic followed. Petion instituted a pure republic, while Christophe founded a monarchy. 1810. Masquerades and masked balls prohibited in the city of New York. 1815. The United States frigate President, Com. Decatur, captured by four British vessels, after a sharp action, and a chase of 18 hours. Loss of the Americans 22 killed, 59 wounded; British loss 11 killed, 14 wounded.
  • 72. 1825. Robert Goodloe Harper, an American statesman, died. He was born in Virginia, of poor parentage; acquired the rudiments of a classical education; served a campaign in the revolutionary army; after which he entered Princeton college. He subsequently settled in South Carolina, in the practice of the law, and acquired great reputation as a professional man and a politician. 1827. Jean Denis Lanjuinais died. He was a staunch defender of liberal principles, and opposed first the arrogant pretensions of the privileged class, although himself one of their number: afterwards he arrayed himself against the intrigues of Mirabeau, the violence of the mountain party, and the usurpations of Bonaparte, in the face of destruction. The object of his wishes was constitutional liberty. He escaped the axe of the revolution, and was even promoted to office by Napoleon. 1834. The city of Leira, in Portugal, taken by Count de Saldanha, and the garrison, of Miguelites about 1500 in number, made prisoners. 1836. Charles Lewis, one of the most eminent book binders in Europe, died. The splendidly bound books in the duke of Sussex's library are of his workmanship. 1842. Joseph Hopkinson died. His speeches in congress on the Seminole war were much admired. He was author of the song, Hail Columbia. 1844. The Fontaine Moliere, a monument to the great French dramatist, at Paris, inaugurated. It combines a public fountain with a monument, and stands opposite the house in which Moliere died. 1849. Reporters excluded from an adjourned meeting of a convention of the southern states. JANUARY 16. 1543. An act of the English parliament was passed forbidding women, apprentices, c., c., to read the New Testament in English.
  • 73. 1556. Charles V of Germany, (Don Carlos I of Spain) resigned the crown of Spain to his son Philip, after a reign of 40 years. Of all his vast possessions he only reserved to himself an annual pension. It was under him that Cortez conquered Mexico. 1580. An act of the English parliament inflicting a penalty of 20 pounds for absenting from church. 1599. Edmund Spencer, the English poet, died, aged 46. His first poem, the Shepherd's Calendar, appeared in 1576. He went to Ireland as private secretary to the lord lieutenant, and commenced the Faery Queen while in that country. The rebellion took place with such fury that he was obliged to leave the country in so great confusion, that an infant child was left behind, and burnt with his house. The unfortunate poet died soon after his arrival in England, in consequence of these misfortunes. 1643. Parliament of England forbid free commerce, and ordered no wagon or carriage to go to Oxford without a license. 1668. The earl of Shrewsbury slain in a duel by the duke of Buckingham, who had lived in open adultery with Shrewsbury's wife. It is said that she, in the habit of a page, held Buckingham's horse when he was fighting with her husband. 1706. Articles of union between England and Scotland ratified by the Scottish parliament 110 to 69. 1715. Robert Nelson died, an English gentleman of fortune, which he employed in works of benevolence and charity. Few works on devotional subjects were more popular than his. 1748. The bottle conjuror imposed on a great multitude at the Haymarket theatre, by announcing that he would jump into a quart bottle. 1760. Pondicherry, defended by the French under General Lally, taken by the English under Colonel Coote. 1772. A revolution in Denmark which terminated in the imprisonment of the royal family, and finally the banishment of the
  • 74. queen, sister to George III of England. 1780. The Spanish fleet of 11 sail, under Langara, destroyed off St. Vincent by the British fleet of 19 sail, under Rodney. Langara was dangerously wounded and taken prisoner. One of the Spanish ships with 600 men on board was blown up, and all perished. The British lost 32 killed and 102 wounded. 1790. The bean-fed friars ejected from their convents by an augean labor of the French revolution. 1794. Edward Gibbon, the historian, died, aged 57. During his visit to Rome in 1764, he formed the plan of writing the Decline and Fall of the Roman Empire. In 1774 he obtained a seat in parliament, and two years after appeared the first quarto volume of his history. A disorder which he had endured twenty three years terminated in a mortification. 1795. Retreat of the British from Utrecht, in Holland, upon which the inhabitants capitulated to the French. 1796. The first theatre at Botany bay opened by the convicts at Sydney cove. 1809. Battle of Corunna in Spain, between the French and English, and death of Sir John Moore, who fell mortally wounded by a cannon shot, at the moment of victory achieved by the troops under his command. His men buried him in his cloak, and the French, in testimony of his gallantry, erected a monument over his remains. He was unmarried and in his 47th year. 1812. The king of Sicily, on account of ill-health, abdicated the throne in favor of his son, until he should recover. It is remarkable that Great Britain, Spain, Portugal and Sweden were governed by regents or viceroys at the same time. 1813. Lewis Barney died at Champlain, New York, aged 105. He had 24 children by one wife. 1815. Henry Thornton, founder of the Sierra Leone company, and a writer on the credit of Great Britain, died.
  • 75. 1816. The bridge at the falls of the Schuylkill fell with the great body of snow upon it. 1816. John Wright, the first constable of Cumberland county, Virginia, died, aged 107. 1817. Alexander James Dallas, an eminent lawyer of Philadelphia, died. He filled the office of secretary of state in Pennsylvania many years; and also that of secretary of the treasury of the United States a short time previous to his death. 1838. Dorothy Torrey died at Windsor, Conn., aged 107. 1843. State lunatic asylum, at Utica, New York, went into operation. 1854. Alden Partridge died at Norwich, Vt.; nearly fifty years engaged in military instruction, and some time principal of West Point academy. JANUARY 17. 86. B. C. Caius Marius, the Roman consul, died. He was the son of a farmer in indigent circumstances; but by his talents and energy raised himself to the highest dignity of the greatest state in the world. 395. The Emperor Theodosius died at Milan, soliciting his heirs faithfully to execute his will. 1009. Abd-el-Malek, a Moorish prince, crucified by his conqueror. 1380. An act of parliament passed, by which foreign ecclesiastics were incapacitated from holding benefices in England. 1467. John Castriotto, (or Scanderbeg) prince of Albania, died. His father placed him as a hostage with the sultan of Turkey, by whom he was educated in the Mohammedan faith, and at the age of 18 placed at the head of a body of troops. He afterwards deserted to the Christians, and on ascending the throne of his fathers renounced the Mohammedan faith. He obtained repeated victories over the
  • 76. Welcome to our website – the perfect destination for book lovers and knowledge seekers. We believe that every book holds a new world, offering opportunities for learning, discovery, and personal growth. That’s why we are dedicated to bringing you a diverse collection of books, ranging from classic literature and specialized publications to self-development guides and children's books. More than just a book-buying platform, we strive to be a bridge connecting you with timeless cultural and intellectual values. With an elegant, user-friendly interface and a smart search system, you can quickly find the books that best suit your interests. Additionally, our special promotions and home delivery services help you save time and fully enjoy the joy of reading. Join us on a journey of knowledge exploration, passion nurturing, and personal growth every day! ebookbell.com