Lecture 7 - 10.12.09 - DNA Recombination.ppt
- 1. Recombination, Phase Variation and Antigenic Variation
- 2. Why Recombination? Two Broad Categories Homologous (or general) Site-specific (e.g. phage genomes into bacterial chromosomes) Mutation happens - without recombination, mutation target would increase from gene to entire chromosome Recombination allows favorable and unfavorable mutations to be separated Provides a means of escape, to generate new combinations of genes, and spreading of favorable alleles
- 3. Homologous Recombination Required for DNA replication, repairs accidents at replication fork Repairs double strand DNA (dsDNA) breaks Occurs at meiosis (cross-overs) Happens at “four strand” stage of meiosis, involves two of four strands Occurs randomly between homologous sequences Double strand break repair (DSBR) model Allelic and non-allelic (ectopic recombination)
- 4. General Recombination often involves a Holliday Junction Proposed by Dr. Holliday (Holliday R. 1964. A mechanisms for gene conversion in fungi. Genet. Res. 5:282-304) Recombination intermediate, also called cross-strand exchange Between two pairs of strands, one crossing and one non- crossing Can resolve in two ways depending on second DNA cut Patch recombinant - Original pair of crossing strands cut Two recombinant chromosomes - Opposite pair of non-crossing strands cut
- 5. Holliday structures (part I) Sister chromotids Sister chromotids e.g. 4 strand during meiosis
- 6. Holliday structures (part II)
- 7. Recombination is initiated by double-strand breaks in DNA
- 8. a a b b A B A B a+ b a +B Mechanisms of Gene Conversion/Recombination 1) Double-strand break (DSB) repair 2) Synthesis-dependent strand annealing (SDSA) Chen J et al. Nature Reviews Genetics. 2007. 8:762-775
- 9. Double-stranded (dsDNA) breaks are not uncommon Meiosis Created by topoisomerase-like enzymes Mitosis Radiation Mutagens (e.g. chemicals) Stalled replication forks Specialized endonucleases (eg site-specific HO endonuclease in switching of yeast matting type (MAT) genes)
- 10. Recombination requires DNA binding proteins Extensively studied in model organisms, E. coli and yeast Bacterial recombination enzymes identified by Rec - mutations At least 25 proteins are involved in homologous recombination in E. coli Remember four; RecBCD and RecA
- 11. 3 member protein complex with endonuclease and helicase activity essential for 99% of recombination events occurring at double-stranded breaks in bacteria binds double stranded break unwinds and degrades DNA Pauses at chi sequence Loads RecA on 3’ ssDNA extensions RecBCD
- 12. Initiation of recombination by the RecBCD enzyme
- 13. RecA Involved in SOS response; required for nearly ALL homologous recombination in bacteria Single-strand DNA binding protein, DNA dependent ATPase Multiple DNA binding sites Initiates the exchange of DNA between two recombining DNA double helixes RecA enables single stranded DNA to invade DNA helix Eukaryotes have multiple homologs of bacterial RecA (Rad51 is best studied)
- 14. Chi site Χ Recombination hotspot Modifies RecBCD enzymatic activity 5’ GCTGGTGG 3’ 1009 chi (Χ) sites in E. coli genome Χ homologs in other bacteria
- 15. Kowalczykowski TIBS. 2000. 25: 156-65
- 16. Targeted gene disruption by homologous recombination Lodish et al. Molecular Cell Biology
- 17. Gene Conversion A special type of homologous recombination Non-reciprocal transfer of genetic material from a ‘donor’ sequence to a highly homologous ‘acceptor’ sequence Initiated by double strand DNA (dsDNA) breaks 5’ > 3’ exonucleases 3’ ssDNA tail strand invasion (RAD51 and others) Outcome: portion of ‘donor’ sequence copied to ‘acceptor’ and original ‘donor’ copy unchanged donor acceptor gene conversion
- 18. Gene Conversion is not uncommon Yeast mating type switch (MAT) genes Human repetitive sequence elements (Alu and LINE-1 sequences)* Human gene families (e.g. MHC alleles, Rh blood group antigens, olfactory receptor genes) Chicken B cells Ig gene diversification Pathogen clonal antigenic variation (e.g. African Trypanosomes and Babesia bovis) * Chen et al. 2007 Gene conversion: mechanisms, evolution and human disease Nature Reviews Genetics. 8: 762-775.
- 19. Clonal Antigenic Variation in Pathogenic Protozoa
- 20. Variable Surface Antigens of Pathogenic Protozoa Organism Causative Agent Variable Antigen Structural Features Functions Plasmodium falciparum Malaria PfEMP1 (var gene product) 200-350 kDA transmembrane protein at the surface of IRBC Infected erythrocyte surface, adherence to host surface molecules African Trypanosom es African Sleeping sickness VSG ~60 kDa protein anchored by GPI- linkage at the parasite surface Densely packed, variable surface coat, immune evasion Two Pathogens: Two Approaches
- 21. Large families of non-allelic genes (one gene ON, others OFF) Antigens are highly immunogenic but poorly cross-reactive Switching occurs at high but variable rate Switching is frequently accomplished by duplicative gene conversion into an expression site or DNA rearrangement Recombination generates diversity in gene families Means for survival and transmission Common Themes of Clonally Variant Antigens Kyes S. et al. Annu Rev. Microbiol. 2001. 55:673-707
- 22. African Trypanosomes 1000s of VSG gene/gene fragments dedicated expression site recombination mediated switching (RAD51-associated) Plasmodium falciparum ~60 var genes in situ expression (no dedicated expression site) primarily non-recombinational switching Variations on a Theme
- 23. Clonal Antigenic Variation in Trypanosoma brucei Ab surface labeling of VSGs from a mixed population
- 24. Trypanosome antigen switching At each wave, different VSGs are expressed Switch rates - 10-2 to 10-6 per cell in blood >100 VSGs expressed sequentially in one rabbit Switch not induced by the immune system Semi-programmed -- early VSGs are always early
- 25. Variant surface glycoproteins Completely cover the blood-stage tryp in a tight coat (107 /cell) except the flagellar pocket Glycolipid anchor (released by phospholipase C) VSG protein -- ~450 amino acids C-term is more conserved (not exposed) N-term highly variable sequence 3-D structures are very similar
- 26. VSG Proteins Have Diverse Sequence but Related Structure Blum M et al. Nature. 1993. 362: 603-9 • The crystal structure was compared between two VSGs • Despite low sequence similarity the structures were remarkably similar Conclusion: Antigenic variation in trypanosomes is accomplished by sequence variation and not by gross structural alteration.
- 27. 7 6 5 4 8 3 2 1 VSG 70-bp repeat Telomeric repeats ESAGs a-amanitin resistant Pol I promoter VSG Expression Occurs From Unique Telomeric Expression Sites • VSG are expressed in long polycistronic messages (>40kb) • Expression site encodes multiple “expression site associated genes” • There are approximately 20 bloodstream expression sites, only one is active at a time • There are two distinct types of expression sites 1. Bloodstream (above) 2. metacyclic
- 28. VSG ESAGs VSG ESAGs One VSG Expression Site is Active at a Time Active Site (one) Inactive ‘silent’ site (many) Full-length transcript, high level Partial transcripts, low level 70-bp repeat 70-bp repeat Unable to “force” two expression sites to be simultaneously active Chaves et al 1999. EMBO J 18:4846-55
- 29. Active VSG locus tagged with Lac operator and Visualized with Tagged lac Repressor LacI-GFP Nucleolus and “Expression Site Body (ESB)” Labeled by PolI antibody ESB ESB Nucleolus Active VSG is Located in Subnuclear Compartment “Expression Site Body” Navarro M & Gull K. 2001. Nature 414:759-763.
- 30. Three Distinct Mechanisms of VSG switching Duplicative Gene Conversion A 221 A A in situ switch 221 221 C C Telomere exchange B 221 221 B
- 31. Location VSG Size VSG pool Silent subtelomeric VSG arrays Telomeric VSGs VSGs in bloodstream expression sites 1250-1400 150-250 20 Megachromosomes and intermediate chromosomes Minichromosomes ~50-100kb VSG Genome Organization Taylor & Rudenko. Trends Genet 2006. 22:614-20
- 32. Gene conversion is likely to be a primary mechanism to generate vsg gene diversity Most vsg are pseudogenes Limited number of functional genes, ~7% of 806 vsg genes A ‘reservoir’ of potential genetic change contained in non- functional vsg pseudogenes vsg Gene Diversification
- 33. Silent VSG array Active VSG expression site 3’conserved region 70-bp repeat A B B C 70-bp repeat arrays VSG Switching by Gene Conversion Frequently Relies on Homology Upstream and Within the 3’ Conserved Region of Genes Switch
- 34. L Miller et al, Nature 2002 Clonal Antigenic Variation in Plasmodium falciparum
- 35. Plasmodium falciparum: Antigenic Variation and Cytoadhesion are Linked PfEMP1 switch, binding/antigenicity changes Miller 2002
- 36. ~60 genes per parasite haplotype (few pseudogenes) One gene on, the others off Similar A,B,C gene organization between parasite isolates A’s are not under strong CD36 selection, others are The A,B,Cs of var Organization
- 37. PfEMP1 proteins have multiple receptor-like domains ~60 proteins: Different protein forms Common adhesion trait CD36 (blood vessels, immune cells) Rarer ICAM-1 (blood vessels, immune cells) Rosetting with uninfected erythrocytes Pregnancy restricted CSA Binding determines IE tropism
- 38. Multiple Layers of Gene Control Layer 1: Gene structure and putative regulatory elements
- 39. Var Genes are Expressed in situ DBL CIDR DBL DBL ATS TM Sterile Transcripts Exon 1 hypervariable Exon 2 Conserved • Monocistronic • Only one var gene is expressed at a time • No dedicated expression sites, genes are expressed in situ • Transcription factors? Members of ApiAP2 family?
- 40. var Intron Promoter May Cooperate in Gene Silencing luciferase var upstream region luciferase var upstream region luciferase var upstream region intron promoter disabled intron promoter Default var promoter state Active Active Silent promoter pairing Deitsch et al. Nature. 2001. 412:875-6
- 41. Note: others argue var promoter is sufficient to silence genes Voss et al. (2006) A var promoter controls allelic exclusion of virulence genes in Plasmodium falciparum malaria
- 42. Layer 2: Chromatin modifications
- 43. Silent and Active Chromatin Marks Note: similar “marks” are found at many active and silent genes
- 44. SIR2 Regulates the Silencing of Some Var Genes • Silent information regulator (SIR) proteins associate with the ends of chromosomes in yeast and Plasmodium. • Deacetylation of histones by SIR2 can initiate the establishment of heterochromatin (silent chromatin in which transcription is repressed). • ‘silent’ subtelomeric var genes are bound by SIR2. • SIR2 binding is lost when gene is activated. • SIR2 gene disruption leads to activation of a subset of var genes.
- 45. Layer 3: Subnuclear architecture
- 46. Active Var Gene May Re-Locate to Region of Euchromatin
- 47. Clustering of var Genes May Promote Gene Recombination
- 48. Pathogenic Neisseriae Gram-negative bacteria Two pathogens of importance to human health N. Gonorrhoeae sexually transmitted causes cervical and urethral infections Uses pili to attach to epithelial cells, invades, replicates in basement membrane N. Meningitidis transmitted by saliva or respiratory secretions cause of meningitis Uses pili to attach to host cells
- 49. Small set of outer membrane protein (Opacity protein), up to 7 genes (possibly adhesive proteins) All copies are transcribed, control is at translation: Signal sequences have variable # of coding repeats (CTCTT) Phase variation is RecA independent, thought due to strand slippage changes Very high frequency (>10-2 per division) Opa ss …CTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCCGCA… 7 x CTCTT = Stop 8 x CTCTT = Stop 9 X CTCTT = in frame Phase variation in Neisseria opa genes
- 50. Antigenic Variation and Phase Variation of Neisseria pili Pathogen lifestyle: extracellular and within neutrophils Variant antigen: type IV pilin protein Protein location: Expressed at surface of bacteria Protein function: Adhesion ligand Gene copies: one expressed gene (pilE), several silent pseudogenes (pilS) Switch rate: as high as 4 X 10-3 per cell per generation Role of recombination: Antigenic variation is RecA dependent
- 51. Mechanisms of Pili Variation Antigenic variation: Occurs when silent pilin cassettes (pilS) recombine with the sole expression site (pilE) a) intergenomic – take up DNA released by lysis from neighboring Neisseria cells b) intragenomic – recA dependent recombination with silent copies Phase variation: the reversible inter-conversion between piliated (P+) and nonpiliated states (P-). pilC is turned on or off.
- 52. Organization of Pilin loci Meyer et al. Clin Micro Reviews 1989. S139-145