Mirnapcrarray
1 like552 views
The document describes miScript miRNA PCR Arrays for analyzing miRNA expression patterns. It discusses miRNA biogenesis and function, and how the miScript system allows for genome-wide and pathway-focused miRNA analysis using a qPCR-based approach. The miScript arrays offer high reproducibility, sensitivity, and the ability to discover cancer-related and developmentally regulated miRNAs. They can be used to screen focused miRNA panels or conduct genome-wide screens to discover novel miRNA roles.
![Multiple loci can generate the same mature miRNA
But are under different regulatory control
Stem Loop
CHR
Overlapping transcripts
CHR: Coordinates (GRCh37)
1302-1
12
intergenic
12: 113132839-113132981 [-]
1302-3
2
intergenic
2: 114340536-114340673 [-]
1302-7
8
intergenic
8: 142867603-142867674 [-]
1302-10
15
intergenic
15: 102500662-102500799 [-]
1302-11
19
intergenic
19: 71973-72110 [+]
1302-2
1
intronic
Non protein coding
1: 30366-30503 [+] sense
1302-4
2
intronic
Non protein coding
2: 208133999-208134148 [-]
1302-9
9
Non protein coding
9: 30144-30281 [+]; Sense
1302-5
20
intronic
Protein coding/FAM65C; intron4
1302-6
7
intronic
Protein coding/HDAC9; intron 1
1302-8
9
intronic
Protein coding/ch9orf174
20: 49231173-49231322 [-]; Sense
7: 18166843-18166932 [-] ; Antisense
9: 100125836-100125963 [-];
Antisense
Mature-miR-1302: UUGGGACAUACUUAUGCUAAA
www.mirbase.org
-8-
Sample & Assay Technologies](https://image.slidesharecdn.com/mirnapcrarray-140305100524-phpapp02/85/Mirnapcrarray-8-320.jpg)
Mirnapcrarray
- 1. miScript miRNA PCR Arrays Genome-Wide & Pathway-Focused Analysis With an Advanced qPCR Technology Samuel J. Rulli, Jr.,Ph.D. qPCR Applications Scientist Samuel.Rulli@QIAGEN.com Sample & Assay Technologies
- 2. miScript miRNA PCR Arrays Genome-Wide & Pathway-Focused Analysis With an Advanced qPCR Technology Questions? Comments? or Suggestions? Ask now or contact Technical Support . . Telephone: 888-503-3187; Email: support@SABiosciences.com . Sample & Assay Technologies
- 3. Welcome to SABiosciences: Systems Biology with a Pathway Focused Approach • SABiosciences is now a Company -3- Sample & Assay Technologies
- 4. Topics to be Covered Introduction to miRNA miScript miRNA PCR Array Overview How It Works Portfolio Benefit miScript miRNA PCR Array Applications Cancer Development & Differentiation Genome-Wide Discovery -4- Sample & Assay Technologies
- 5. What Is MicroRNA? . . . Endogenously expressed small functional RNAs (19-25 nt) Regulate mRNA expression post-transcriptionally mRNA degradation, but also translation inhibition Only partial sequence complementarity required One miRNA can potentially regulate hundreds of mRNAs One mRNA can be regulated by multiple miRNAs Another layer of complexity for regulating gene expression -5- Sample & Assay Technologies
- 6. Canonical pathway of microRNA biogenesis NUCLEUS microRNA Gene DNA Transcribed by RNA Polymerase II as a long primary transcript (pri-miRNAs), which may contain more than one miRNA. POL II Pri-miRNA Drosha-DGCR8 In the nucleus, Pri-miRNAs are processed to hairpin-like pre-miRNAs by RNAse IIIlike enzyme Drosha Pre-miRNA CYTOPLASM Exportin Pre-miRNAs are then exported to the Cytosol by Exportin 5 Exportin DICER-TRBP mature miRNA Ago RISC Assembly These miRNAs are incorporated in RISC RISC High homology mRNA cleavage In the cytosol RNAse III-like Dicer processes these precursors to mature miRNAs Partial homology Translational Repression mRNA degradation miRNAs with high homology to the target mRNA lead to mRNA cleavage miRNAs with imperfect base pairing to the target mRNA lead to translational repression and/or mRNA degradation Krol, J et.al., (2010) Nature Rev Genetics, 11, 597; Winter, J. et.al., (2009) Nature Cell Biology, 11, 228 -6- Sample & Assay Technologies
- 7. miRNA genomic structure (a) Independent Promoter MyoD SRF miR‐1‐1 miR‐1‐1 miR‐133a‐2 miR‐133a‐2 (b) Intronic miR‐208 Exon‐27 miR‐208 Exon‐28 (c) Exonic miR‐198 Exon‐10 miR‐198 Exon‐11 Intergenic miRNA genes: either monocistronic or polycistronic with a common promoter Intronic miRNA genes: present in the introns of protein coding or noncoding genes, can also be in clusters, transcribed by the host gene promoter Exonic miRNAs genes: rare and often overlap an exon and an intron of a noncoding gene miRNAs can be transcribed from the negative strand within or near a protein coding gene -7- Sample & Assay Technologies
- 8. Multiple loci can generate the same mature miRNA But are under different regulatory control Stem Loop CHR Overlapping transcripts CHR: Coordinates (GRCh37) 1302-1 12 intergenic 12: 113132839-113132981 [-] 1302-3 2 intergenic 2: 114340536-114340673 [-] 1302-7 8 intergenic 8: 142867603-142867674 [-] 1302-10 15 intergenic 15: 102500662-102500799 [-] 1302-11 19 intergenic 19: 71973-72110 [+] 1302-2 1 intronic Non protein coding 1: 30366-30503 [+] sense 1302-4 2 intronic Non protein coding 2: 208133999-208134148 [-] 1302-9 9 Non protein coding 9: 30144-30281 [+]; Sense 1302-5 20 intronic Protein coding/FAM65C; intron4 1302-6 7 intronic Protein coding/HDAC9; intron 1 1302-8 9 intronic Protein coding/ch9orf174 20: 49231173-49231322 [-]; Sense 7: 18166843-18166932 [-] ; Antisense 9: 100125836-100125963 [-]; Antisense Mature-miR-1302: UUGGGACAUACUUAUGCUAAA www.mirbase.org -8- Sample & Assay Technologies
- 9. miRNA: Cutting Edge of Science miRNA database: www.mirbase.org New miRNAs continually discovered (release 16.0) Human: 1066 Mouse: 940 Rat: 653 Nomenclature Pri-miRNA (>100nt) Pre-miRNA (~70nt) Mature miRNA (~20nt) . . microRNA/miRNA Research 4000 . Highwire + Pubmed Hits 3500 3000 2500 2000 1500 1000 500 0 2005 2006 2007 2008 2009 Year -9- Sample & Assay Technologies
- 10. Why Analyze miRNA Expression Patterns? Potential for genome-wide coverage, even though >1000 miRNAs identified miRNA expression profiles correlate with: Protein & Gene Expression Levels, Biological Phenotypes miRNA regulated genes are involved in a variety of biological processes and diseases: Cancer Development Immunology Aging Heart Diseases Neurological Diseases . . . - 10 - Sample & Assay Technologies
- 11. How to Monitor miRNA Expression Levels Northern Blot Very low throughput Very time consuming and complex Microarrays Profile More Sequences Poor Sensitivity & Dynamic Range, Complicated Protocol Real-Time RT-PCR Profiles Fewer Sequences (Up to 384) Simpler Protocol Better Sensitivity, Specificity & Reproducibility . . . - 11 - Sample & Assay Technologies
- 12. Topics to be Covered Introduction to miRNA miScript miRNA PCR Array Overview How It Works Portfolio Benefit miScript miRNA PCR Array Applications Cancer Development & Differentiation Genome-Wide Discovery - 12 - Sample & Assay Technologies
- 13. miScript miRNA PCR Array System . . . miRNeasy miRNA Isolation Kit miScript miRNA 1st Strand cDNA Synthesis Kit Preferentially reverse transcribe mature miRNA Built-in external RNA control One-step reaction miScript miRNA PCR Arrays and qPCR Primers Human, mouse, rat: Search miRNA Primers: http://www.sabiosciences.com/mirna_pcr_assay.php -or- . . PCR Arrays: Pathways and Genomes Cancer Cell Differentiation & Development Immunopathology Inflammation miFinder Whole Genome (miRNome) – Sanger miRBase V14.0 Serum (or plasma) Brain Cancer miRNA Neurological Development & Disease Optimized miScript SYBR® Green Master Mix miScript miRNA Data Analysis Excel Template & Web Portal - 13 - Sample & Assay Technologies
- 14. miScript miRNA Array format: Standardized controls (96 well plate) 1 A B C D E F G H 2 3 4 5 6 7 8 9 10 11 12 84 miRNA Pathway Assays Controls 1 2 3 4 5 6 7 8 9 10 11 12 H Cel-miR-39 SNORD61; SNORD68; SNORD72 SNORD95; SNORD96A; RNU6B miRTC PPC Spike in Control miScript Controls for Normalization RT Control PCR Control miScript controls: Common for Human, Mouse, Rat and Dog Arrays - 14 - Sample & Assay Technologies
- 15. miScript miRNA PCR Arrays cDNA Synthesis (miScript II RT KIT) 1 hours . Load Plates (Preferably with 8-Channel Pipettors) 2 minutes . Run 40 cycle qPCR Program 2 hours . Upload and Analyze Data 15 minutes . - 15 - Sample & Assay Technologies
- 16. miScript miRNA PCR Arrays Complete miRNA genome (miRNome) miRNA Pathway Arrays Human, Mouse, Rat: Brain Cancers Cancer Cell Differentiation & Development Immunopathology Inflammation miFinder Neurological Development & Disease Serum and Plasma (NEW!) Breast Cancer Ovarian Cancer Human miScript miRNA PCR Array Mouse miScript miRNA PCR Array Rat miScript miRNA PCR Array Dog miScript miRNA PCR Array All miRNA designs based on mirBase 16 - 16 - Sample & Assay Technologies
- 17. Compatible Instrumentation: 96- & 384-Well Formats . . . . . 96-Well Blocks: 7000, 7300, 7500, 7700, 7900HT, ViiA 7 FAST 96-Well Blocks: 7500, 7900HT, Step One Plus, ViiA 7 FAST 384-Well Block: 7900HT, ViiA 7 . . Mastercycler ep realplex 2/2S/4/4S . Mx3000p, Mx3005p, Mx4000p iCycler, MyiQ, MyiQ2, iQ5, CFX96, CFX384 Opticon, Opticon 2, Chromo 4 LightCycler 480 . Rotor-Gene Q, Rotor-Gene 6000 miRNA PCR Array Service Core - 17 - Sample & Assay Technologies
- 18. miRNA RT-PCR Technical Difficulties Short sequence (21-23nt) . Background from contaminating small RNAs (tRNA, rRNA, snRNA) . Highly homologous Many miRNAs have a single nucleotide difference . - 18 - Sample & Assay Technologies
- 19. SABio: Universal miRNA Reverse Transcription Same cDNA preparation can assay ANY miRNA miRNA Poly(A) Polymerase AAAAAAAA NNTTTTTTTT miRNA RT Primer Reverse Transcriptase TTTTTTTT Real-Time PCR miRNA-Specific Primer TTTTTTTT Universal Primer - 19 - Sample & Assay Technologies
- 20. Performance: Universal RT Advantages Ease of Universal Reverse Transcription Reaction Simpler setup, without primer interaction issues Less sample necessary for analyses Equal RT reaction for each miRNA, to ensure reproducible expression analysis Comprehensive miRNA coverage cDNA can be saved for new analyses when additional miRNA sequences are discovered . . Similar potential specificity, & additional flexibility! - 20 - Sample & Assay Technologies
- 21. Performance: Reproducibility The miscript miRNA PCR Assays are highly reproducible, ensuring run-to-run, plate-to-plate and sample-to-sample reliability. - 21 - Sample & Assay Technologies
- 22. Replicates: Technical & Biological Technical Reproducibility of the PCR Arrays is very high Results demonstrate that what you are seeing is a result of biology, not technique. RTC & PPC show technical reproducibility on each plate, and comparable across plates. Biological Needed to verify the results are a result of biology Need multiple samples At least 3 replicates per sample for statistical analysis p values 95% Confidence Intervals - 22 - Sample & Assay Technologies
- 23. Topics to be Covered Introduction to miRNA miScript miRNA PCR Array Overview How It Works Portfolio Benefit miScript miRNA PCR Array Applications Cancer Development & Differentiation Genome-Wide Discovery - 23 - Sample & Assay Technologies
- 24. Application Data: Cancer Biomarkers Human Cancer miscript miRNA PCR Array: Many Cancer-Specific miRNA Are Up-regulated in a Colon Tumor. - 24 - Sample & Assay Technologies
- 25. Application Data: Cell Differentiation & Development 26 Brain-Specific miRNA 20 Muscle-Specific miRNA Human Cell Differentiation & Development miscript miRNA PCR Array: Identifies 26 Brain- and 20 Muscle-Specific miRNA Potentially Regulating Tissue-Specific Gene Expression. - 25 - Sample & Assay Technologies
- 26. Application Data: Genome-Wide Screening 40 Ct Adeno-p53 35 30 203 551a 25 34a 940 20 15 15 20 25 30 35 40 Ct Control miscript Human Genome miRNA PCR Array: Identifies Known and Novel miRNA Targets of the p53 Signaling Pathway - 26 - Sample & Assay Technologies
- 27. Application Data: FFPE Expression rank order of 88 cancer related miRNAs in RNA extracted from one 20m section of a 2-year old normal human colon FFPE block using the miscript FFPE RNA Extraction Kit. - 27 - Sample & Assay Technologies
- 28. SUMMARY miRNA Function . • Regulates gene expression post-transcriptionally miRNA Performance . • • • RT-PCR vs. Microarrays Universal vs. Sequence-Specific RT Specificity, Sensitivity & Reproducibility miRNA Applications . • • Screen cancer- or development-focused miRNA panels Discover novel roles for miRNA sequences How can YOU analyze miRNA in YOUR research? … With miscript miRNA PCR Arrays & Assays! - 28 - Sample & Assay Technologies
- 29. New User Promotion Experience miRNA PCR Array Performance Try them today! Promo Code: FDK-MIS1 Starter Pack for miscript miRNA PCR Arrays • 2 96-well or 1 384-well (4x96) PCR Arrays (Free) • Any pathway • With purchase of: • mIScript SYBR PCR Kit (200 reaction) • miscript miRNA 1st Strand cDNA Synthesis Kit Please call to take advantage of this offer. Valid for US & Canadian customers Questions? Contact Technical Support 9 AM – 6 PM Eastern M – F Many scientists have discovered the power of miRNA PCR Arrays. Contact: 1-888-503-3187 OR support@SABiosciences.com Join them on the road to success! http://www.sabiosciences.com/promotion/miscriptdemo.php - 29 - Sample & Assay Technologies
- 30. What’s Next – After PCR Arrays . . . . . . Validate results with more sample and focused set of genes Custom PCR Arrays Identify Transcription Factors Regulating your Gene Biology-on-Array Assess Biological Impact Cignal™ Reporters Knockdown Analysis SureSilencing™ shRNA Plasmids Flexitube/Flexiplate siRNAs Analyze interaction between DNA & nuclear proteins ChampionChIP™ Chromatin Immunoprecipitation PCR Arrays Quantify secreted proteins in blood plasma sera ELISArrays - 30 - Sample & Assay Technologies
- 31. Additional Resources E-Learning Center: Recorded Seminars - 31 - Sample & Assay Technologies