Mutation, evolution, and natural selection cook
- 1. Mutation, Evolution, and Natural SelectionDNA is found in the nucleus of the cellHttp://www.youtube.com/watch?v=ZK6YP1Smbxk
- 2. While the copying of DNA is a very accurate process, what happens when a mistake is made?
- 3. Mutation A mutation = change in gene sequence.Some mutations are harmful to survivalSome mutations are beneficial to survival= adaptation
- 5. Types of ErrorsIncorrect pairing of nucleotide baseOnly changes onecodon so only one amino acid protein is changedDelete/ Add entire pairChanges every codon after the mistake so many amino acid proteins are changedVC: DNA Mutation
- 6. Original: TACGGGGGCGTAACCACAACTHere is the other side (copy). 1) Find the error:ATGCGCCCGCATTGGTGTTGAATGCGCCCGCATTGGTGTTGA2) Write the new RNA3) Form the new codons (you can draw lines on RNA code above to separate)4) Translate into the new amino acidsAUGCGCCCGCATTGGTGTTGAMethionine-Arginine-proline-histadine-tryptophan-cysteine-stop
- 7. What’s the difference from the original (example B on your worksheet)?Methionine-Arginine-proline-histadine-tryptophan-cysteine-stop
- 8. B: TACCGGATGCCAGATCAAATCHere is the other side. Find the error:AT_GCCTACGGTCTAGTTTAG
- 9. How does mutations work?DNA is very accurate when making copies of itself, however, sometimes it makes a mistake.Here’s a DNA sequenceAGCCCTTATAGGCTCWhat are the corresponding base pairs?TCGGGAATATCCGAGNow when it’s being copied it replaces the T with a U. Rewrite the your answer with U’s instead of T’s.UCGGGAAUAUCCGAGWhat amino acids will this be coded for?Serine, Glycine, Isoleucine, Serine, Glutamic Acid
- 11. The Mutation Here’s our original DNA sequenceAGCCCTTATAGGCTCATCCCTTATAGGCTC we replaced the G with a TNow what are the corresponding base pairs?TAGGGAATATCCGAGNow when it’s being copied it replaces the T with a U. Rewrite the your answer with U’s instead of T’s.UAGGGAAUAUCCGAGWhat amino acids will this be coded for?Stop, Glycine, Isoleucine, Serine, Glutamic Acid You can see how replacing 1 base will change everything!
- 12. Who was Charles Darwin?British scientist that in 1859 published The Origin of Species
- 13. Stated that all life today came from a common ancestor
- 14. Change from one to many is called evolution
- 15. This happens by a process called natural selection.
- 16. http://www.youtube.com/watch?v=nMgLF8n4DnADarwinGalapagosVoyage of H.M.S. Beagle, 1831 - 183690 feet of ship, 74 people living together for 5 years...
- 17. Evolution the change in the inherited traits (passed on from parents to offspring) of a populationover many generations. These traits could be: physical (teeth shape) chemical (ability to use sun for energy) behavioral (run fast). This change is caused by mutations in the genes.http://www.youtube.com/watch?v=yVqJ_mQazik
- 18. PHYSICAL: This moth mimics an owl’s eyesBEHAVIORAL: This monkey is using tools to get foodCHEMICAL: this orchid smells like a female bee
- 19. Common Ancestor-We did not come from monkeys, we just had a common ancestor
- 20. Theories on LifeTheory of EvolutionScienceBased on evidenceCreationismReligionBased on faith
- 21. Adaptationthe evolutionary process where a population becomes better suited to its environment.This process takes many generations.A featurewhich is especially important for an organism's survival.For example, the adaptation of horses' teeth to the grinding of grassFlat teeth (due to genetic mutation) chew grass better
- 23. How does Evolution Work?Natural Selection- survival of the fittest Organisms best suited to their environmentNatural selection is the result of four features of living systems: 1) variation – differences in the population because of genetic mutation2) inheritance- parents pass on their genetic mutations to their offspring3) selection- some organisms reproduce more (fittest) than others 4) time – happens over time, takes many generations
- 24. There are 2 variations of the beetles, green and red.The birds prefer eating the green beetles.Over generations the red beetles increase in population because they are not eaten by the birds.More survive to produce more offspring.Generations later….Over time the red beetles have been selected over the green beetlesSo what happens to the birds now?
- 26. INCORRECT MODEL OF EVOLUTION: BASED ON NEED
- 27. Why does this not work?Change through use and disuse
- 28. Natural Selection’s ExplanationAncestors had different neck lengthsThrough natural selection, longer necks survived and passed on their genes.Eventually all giraffes had long necks.
- 29. ONE Ancestor Many Varieties What are the different types?
- 30. What could cause all the variety?http://www.youtube.com/watch?v=sCEeefdaRcw
- 31. Common Ancestor-We did not come from monkeys, we just had a common ancestor