Breaking the code
- 2. How Do Cells Reproduce ? Identical copy http://waynesword.palomar.edu/lmexer2a.htm http://luigigalvani5.blogspot.com/2008/... ary.html Different copy
- 3. Mix ing of Genes CROSSING OVER
- 4. From Gene to Protein : An exercise in breaking the code
- 5. DNA COPIES ITSELF : Base pairings: A- T C – G DNA molecule unzips breaking the base pairs forming 2 sides VC: DNA Replication
- 6. A: TACCGGATGCCAGATCAAATC What is the other side? __________________________ 1. Given the code of a DNA molecule , what would be the code of the new DNA strand? B: TACGGGGGCGTAACCACAACT What is the other side? __________________________
- 7. 2. CODE IS READ . The code of the new strand (DNA copy) is READ with the T replaced with a new base Uracil or U . A: ____________________________________ B: ____________________________________
- 8. A: ____________________________________ B: ____________________________________ 3. CODE IS TRANSLATED . The code is read in groups of 3 called codons ).
- 9. 4. Find the Amino Acid sequence that is coded: A: ____________________________________ B: ____________________________________
- 11. Genes(DNA) Make copies of itself New copy (RNA) is read and translated Crossover (mixing of code) Amino acids (protein) are formed A trait is expressed VC: What is phenotype www.squidoo.com/geneticsresearch
- 12. DNA RNA PROTEIN Cracking the Code VC: Cracking the code http:// entomology.wisc.edu/~goodman/wgr ... rch.html copied and read translated
- 13. While the copying of DNA is a very accurate process , what happens when a letter is altered ? VC: DNA Mutation