![Recombinant Flagelliform Spider Silk 5
folds into β-turn structures (28,29), which yield a right-handed helix termed b-
spiral on stacking, similar to structural elements of elastin (13,14,30).
The outstanding properties of silk materials together with the modular
nature of the underlying proteins have prompted researchers to design proteins
mimicking natural silk in a modular approach. This design strategy employs
synthetic DNA modules that are reversely transcripted from oligopeptide motifs
characteristic for spider silk proteins. The DNA modules are assembled step by
step, yielding a synthetic gene, which can be recombinantly expressed in hosts
such as bacteria. Designed recombinant silk proteins allow controlled assem-
bly of nanostructures and morphologies for various applications and therefore
reflect a fascinating new generation of biomaterials.
2. Materials
1. Escherichia coli strains DH10B and BLR [DE3] (Novagen, Merck Biosciences
Ltd., Darmstadt, Germany).
2. Plasmids: pFastBac1 (Invitrogen, Carlsbad, CA).
3. Oligonucleotide primers (MWG Biotech AG, Ebersberg, Germany).
4. Restriction enzymes: AlwNI, BamHI, BglII, BseRI, BsgI, EcoRI, HindIII, and
NcoI (New England Biolabs, Beverly, MA).
5. T4 ligase (Promega Biosciences Inc., San Luis Obispo, CA).
6. Agarose, polymerase chain reaction (PCR), and DNA sequencing equipment.
7. LB (Luria Bertani) medium.
8. Appropriate antibiotics: Ampicillin stock solution (100mg/mL).
9. Isopropyl-β-d-galactopyranoside (IPTG) 1M stock solution.
10. Lysis buffer: 20mM HEPES, 5mM NaCl, pH 7.5.
11. Lysozyme (Sigma-Aldrich, St. Louis, MO).
12. MgCl2 2M solution.
13. Proteinase-free deoxyribonuclease (DNase) I (Roche, Mannheim, Germany).
14. Protease inhibitors (Serva, Heidelberg, Germany).
15. Inclusion bodies washing buffer: 100mM Tris-HCl, 20mM ethylenediaminetet-
raacetic acid (EDTA), pH 7.0.
16. Q Sepharose (Amersham Biosciences, Piscataway, NJ).
17. Fast protein liquid chromatographic (FPLC) equipment.
18. Binding buffer: 20mM HEPES, 5mM NaCl, 8M urea, pH 7.5.
19. Elution buffer: 20mM HEPES, 1M NaCl, 8M urea, pH 7.5.
20. 4M ammonium sulfate.
21. 1M ammonium carbonate.
22. Hexafluoroisopropanol (HFIP): Toxic solution; handle with care.
3. Methods
3.1. Design of a Cloning Vector
We developed a gene design method to recombinantly produce spider silk
proteins in bacteria (31–33). The commercially available vector pFastbac1,](https://image.slidesharecdn.com/87410-250225161140-c2c41738/85/Nanostructure-Design-Methods-and-Protocols-1st-Edition-Charlotte-Vendrely-21-320.jpg)
![Recombinant Flagelliform Spider Silk 9
The DNA cassettes Y, X, K, and sp were ligated to mimic one ensemble
repeat of the native flagelliform protein. A consensus sequence of a single
ensemble repeat is reflected by the sequence sfl: Y6X2spK2Y2. Successively,
starting with a single sfl module, various constructs have been designed, leading
to the exemplary proteins Sfl3, Sfl-CT, Sfl3-CT, NT-Sfl, and NT-Sfl-CT useful
for studying structure-function relationships of individual silk motifs.
3.2. Recombinant Production of Sfl Proteins
After engineering various artificial flagelliform genes, they were subcloned into
expression vectors pET21 or pET28 using the restriction enzymes BamHI and
HindIII or NcoI and HindIII, respectively. Escherichia coli BLR [DE3] was
transformed with the corresponding plasmid (see Note 3), and single clones
were incubated in a 4-mL preculture at 37°C overnight. After inoculation of a
2-L culture of LB medium, expression was initiated at OD600 0.8 using 1mM
IPTG at 30°C.
Escherichia coli cells were harvested 3–4h after induction, and the cell pellet
was resuspended in lysis buffer at 4°C (5mL per gram of cells). On addition of
0.2mg lysozyme per milliliter, the suspension was incubated at 4°C for 30min
until becoming viscous. Protease inhibitor was added before the cells were ultra-
sonicated. DNA was digested with 3mM MgCl2, 10µg/mL DNase, followed by
incubation at room temperature for 30min. Then, 0.5 volumes of 60mM EDTA,
2–3% Triton X-100 (v/v), 1.5M NaCl, pH 7.0, were added, and the suspension
was incubated at 4°C for another 30min. Recombinant flagelliform proteins are
entirely found in inclusion bodies, which were sedimented at 20,000g at 6°C
for 30min. The inclusion bodies were resuspended in 100mM Tris-HCl, 20mM
EDTA, pH 7.0, using an ultraturax. These steps were repeated one or two addi-
tional times to wash the inclusion bodies. After a final centrifugation step, the
inclusion bodies were frozen in liquid nitrogen and stored at −20°C.
3.3. Purification of Flagelliform Proteins From Inclusion Bodies
Frozen inclusion bodies were dissolved in binding buffer, and the solution was
applied to an equilibrated Q Sepharose Fast Flow column (20mL self-packed,
flow 1–1.5mL/min), which was eluted by a linear sodium chloride gradient.
Flagelliform silk proteins were eluted between 200 and 250mM NaCl. Pooled
protein fractions were precipitated at 30%w/v ammonium sulfate (final con-
centration 1.2M ammonium sulfate). After sedimentation, the protein pellet
was dissolved in 20mM HEPES, 5mM NaCl, 8M urea, pH 7.5m and dialyzed
against 10mM ammonium hydrogen carbonate. The protein (purity>98%) (see
Note 4) was aliquoted, frozen in liquid nitrogen, lyophilized overnight, and
stored at −20°C.](https://image.slidesharecdn.com/87410-250225161140-c2c41738/85/Nanostructure-Design-Methods-and-Protocols-1st-Edition-Charlotte-Vendrely-25-320.jpg)
![Recombinant Flagelliform Spider Silk 11
Based on such technology, chimera combining a spider silk domain and an
elastin peptide or a dentin matrix protein have been successfully engineered
(43,45). Chimeric silk proteins are capable of providing a wide variety of functions
or structures based on their peptide motifs, including chemically active sites,
enzyme activity, receptor-binding sites, and so on (42,46–48). The combination
of such potential with repetitive sequences will allow the design of new perfor-
mance proteins with defined nanostructures and chosen functionalities.
4. Notes
1. The length of the oligonucleotides is generally between 30 and 120 bases, depending
on technical limitations during synthesis.
2. Screening of bacterial clones can be facilitated by adjusting the codon usage to
incorporate a restriction site for a defined enzyme within the DNA cassette.
3. An appropriate bacterial strain is important for the production of proteins with
repetitive sequences. Escherichia coli BLR [DE3] does not contain recombinase
activity, preventing homolog recombination and subsequent shortening of the
repetitive genetic information.
4. Since the employed spider silk proteins do not comprise tryptophan residues, fluo-
rescence measurements of the purified protein will reveal a maximum at 305nm
after excitation of tyrosine residues at 280nm, but no tryptophan fluorescence
maximum (350nm) on excitation at 295nm (31). Therefore, protein purity can
easily be checked and quantified.
Acknowledgments
We thank members of the Fiberlab and Lasse Reefschläger for critical comments
on the manuscript. This work was supported by grants from DFG (SCHE
603/4-2) and ARO (W911NF-06-1-0451).
References
1. Faux NG, Bottomley SP, Lesk AM, et al. (2005) Functional insights from the
distribution and role of homopeptide repeat-containing proteins. Genome Res.
154, 537–551.
2. Foster JA, Bruenger E, Gray WR, Sandberg LB. (1973) Isolation and amino acid
sequences of tropoelastin peptides. J. Biol. Chem. 248, 2876–2879.
3. Fietzek PP, Kuhn K. (1975) Information contained in the amino acid sequence of
the alpha1(I)-chain of collagen and its consequences upon the formation of the
triple helix, of fibrils and crosslinks. Mol. Cell. Biochem. 8, 141–157.
4. Xu M, Lewis RV. (1990) Structure of a protein superfiber: spider dragline silk.
Proc. Natl. Acad. Sci. U. S. A. 87, 7120–7124.
5. Gosline JM, Guerette PA, Ortlepp CS, Savage KN. (1999) The mechanical design
of spider silks: from fibroin sequence to mechanical function. J. Exp. Biol. 202,
3295–3303.](https://image.slidesharecdn.com/87410-250225161140-c2c41738/85/Nanostructure-Design-Methods-and-Protocols-1st-Edition-Charlotte-Vendrely-27-320.jpg)
Nanostructure Design Methods and Protocols 1st Edition Charlotte Vendrely
- 1. Visit https://ebookultra.com to download the full version and explore more ebooks Nanostructure Design Methods and Protocols 1st Edition Charlotte Vendrely _____ Click the link below to download _____ https://ebookultra.com/download/nanostructure-design- methods-and-protocols-1st-edition-charlotte-vendrely/ Explore and download more ebooks at ebookultra.com
- 2. Here are some suggested products you might be interested in. Click the link to download Polyadenylation Methods and Protocols 1st Edition Joanna Rorbach https://ebookultra.com/download/polyadenylation-methods-and- protocols-1st-edition-joanna-rorbach/ Microsatellites Methods and Protocols 1st Edition Panagiotis Madesis https://ebookultra.com/download/microsatellites-methods-and- protocols-1st-edition-panagiotis-madesis/ Biofuels Methods and Protocols 1st Edition Shahabaddine Sokhansanj https://ebookultra.com/download/biofuels-methods-and-protocols-1st- edition-shahabaddine-sokhansanj/ Liposome Methods and Protocols 1st Edition Subroto Chatterjee https://ebookultra.com/download/liposome-methods-and-protocols-1st- edition-subroto-chatterjee/
- 3. Apoptosis Methods and Protocols 1st Edition Demetrius Matassov https://ebookultra.com/download/apoptosis-methods-and-protocols-1st- edition-demetrius-matassov/ Xenotransplantation Methods and Protocols 1st Edition Veronica Tisato https://ebookultra.com/download/xenotransplantation-methods-and- protocols-1st-edition-veronica-tisato/ Nanostructure Control of Materials 1st Edition R.H.J. Hannink https://ebookultra.com/download/nanostructure-control-of- materials-1st-edition-r-h-j-hannink/ Protoplast Technology Methods and Protocols 1st Edition Kan Wang https://ebookultra.com/download/protoplast-technology-methods-and- protocols-1st-edition-kan-wang/ Chromatin Remodeling Methods and Protocols 1st Edition Junbiao Dai https://ebookultra.com/download/chromatin-remodeling-methods-and- protocols-1st-edition-junbiao-dai/
- 5. Nanostructure Design Methods and Protocols 1st Edition Charlotte Vendrely Digital Instant Download Author(s): Charlotte Vendrely, Christian Ackerschott, Lin Römer, Thomas Scheibel (auth.), Ehud Gazit, Ruth Nussinov(eds.) ISBN(s): 9781934115350, 159745480X Edition: 1 File Details: PDF, 6.84 MB Year: 2008 Language: english
- 8. M E T H O D S I N M O L E C U L A R B I O L O G Y™ John M. Walker,SERIES EDITOR 474. Nanostructure Design: Methods and Protocols, edited by Ehud Gazit and Ruth Nussinov, 2008 473. Clinical Epidemiology: Practice and Methods, edited by Patrick Parfrey and Brendon Barrett, 2008 472. Cancer Epidemiology, Volume 2: Modifiable Factors, edited by Mukesh Verma, 2008 471. Cancer Epidemiology, Volume 1: Host Susceptibility Factors, edited by Mukesh Verma, 2008 470. Host-Pathogen Interactions: Methods and Protocols, edited by Steffen Rupp and Kai Sohn, 2008 469. Wnt Signaling, Volume 2: Pathway Models, edited by Elizabeth Vincan, 2008 468. Wnt Signaling, Volume 1: Pathway Methods and Mammalian Models, edited by Elizabeth Vincan, 2008 467. Angiogenesis Protocols: Second Edition, edited by Stewart Martin and Cliff Murray, 2008 466. Kidney Research: Experimental Protocols, edited by Tim D. Hewitson and Gavin J. Becker, 2008. 465. Mycobacteria, Second Edition, edited by Tanya Parish and Amanda Claire Brown, 2008 464. The Nucleus, Volume 2: Physical Properties and Imaging Methods, edited by Ronald Hancock, 2008 463. The Nucleus, Volume 1: Nuclei and Subnuclear Components, edited by Ronald Hancock, 2008 462. Lipid Signaling Protocols, edited by Banafshe Larijani, Rudiger Woscholski, and Colin A. Rosser, 2008 461. Molecular Embryology: Methods and Protocols, Second Edition, edited by Paul Sharpe and Ivor Mason, 2008 460. Essential Concepts in Toxicogenomics, edited by Donna L. Mendrick and William B. Mattes, 2008 459. Prion Protein Protocols, edited by Andrew F. Hill, 2008 458. Artificial Neural Networks: Methods and Applications, edited by David S. Livingstone, 2008 457. Membrane Trafficking, edited by Ales Vancura, 2008 456. Adipose Tissue Protocols, Second Edition, edited by Kaiping Yang, 2008 455. Osteoporosis, edited by Jennifer J. Westendorf, 2008 454. SARS- and Other Coronaviruses: Laboratory Protocols, edited by Dave Cavanagh, 2008 453. Bioinformatics, Volume 2: Structure, Function, and Applications, edited by Jonathan M. Keith, 2008 452. Bioinformatics, Volume 1: Data, Sequence Analysis, and Evolution, edited by Jonathan M. Keith, 2008 451. Plant Virology Protocols: From Viral Sequence to Protein Function, edited by Gary Foster, Elisabeth Johansen, Yiguo Hong, and Peter Nagy, 2008 450. Germline Stem Cells, edited by Steven X. Hou and Shree Ram Singh, 2008 449. Mesenchymal Stem Cells: Methods and Protocols, edited by Darwin J. Prockop, Douglas G. Phinney, and Bruce A. Brunnell, 2008 448. Pharmacogenomics in Drug Discovery and Development, edited by Qing Yan, 2008. 447. Alcohol: Methods and Protocols, edited by Laura E. Nagy, 2008 446. Post-translational Modifications of Proteins: Tools for Functional Proteomics, Second Edition, edited by Christoph Kannicht, 2008. 445. Autophagosome and Phagosome, edited by Vojo Deretic, 2008 444. Prenatal Diagnosis, edited by Sinhue Hahn and Laird G. Jackson, 2008. 443. Molecular Modeling of Proteins, edited by Andreas Kukol, 2008. 442. RNAi: Design and Application, edited by Sailen Barik, 2008. 441. Tissue Proteomics: Pathways, Biomarkers, and Drug Discovery, edited by Brian Liu, 2008 440. Exocytosis and Endocytosis, edited by Andrei I. Ivanov, 2008 439. Genomics Protocols, Second Edition, edited by Mike Starkey and Ramnanth Elaswarapu, 2008 438. Neural Stem Cells: Methods and Protocols, Second Edition, edited by Leslie P. Weiner, 2008 437. Drug Delivery Systems, edited by Kewal K. Jain, 2008 436. Avian Influenza Virus, edited by Erica Spackman, 2008 435. Chromosomal Mutagenesis, edited by Greg Davis and Kevin J. Kayser, 2008 434. Gene Therapy Protocols: Volume 2: Design and Characterization of Gene Transfer Vectors, edited by Joseph M. LeDoux, 2008 433. Gene Therapy Protocols: Volume 1: Production and In Vivo Applications of Gene Transfer Vectors, edited by Joseph M. LeDoux, 2008 432. Organelle Proteomics, edited by Delphine Pflieger and Jean Rossier, 2008 431. Bacterial Pathogenesis: Methods and Protocols, edited by Frank DeLeo and Michael Otto, 2008 430. Hematopoietic Stem Cell Protocols, edited by Kevin D. Bunting, 2008 429. Molecular Beacons: Signalling Nucleic Acid Probes, Methods and Protocols, edited by Andreas Marx and Oliver Seitz, 2008 428. Clinical Proteomics: Methods and Protocols, edited by Antonia Vlahou, 2008 427. Plant Embryogenesis, edited by Maria Fernanda Suarez and Peter Bozhkov, 2008 426. Structural Proteomics: High-Throughput Methods, edited by Bostjan Kobe, Mitchell Guss, and Thomas Huber, 2008 425. 2D PAGE: Sample Preparation and Fractionation, Volume 2, edited by Anton Posch, 2008 424. 2D PAGE: Sample Preparation and Fractionation, Volume 1, edited by Anton Posch, 2008 423. Electroporation Protocols: Preclinical and Clinical Gene Medicine, edited by Shulin Li, 2008 422. Phylogenomics, edited by William J. Murphy, 2008 421. Affinity Chromatography: Methods and Protocols, Second Edition, edited by Michael Zachariou, 2008 420. Drosophila: Methods and Protocols, edited by Christian Dahmann, 2008 419. Post-Transcriptional Gene Regulation, edited by Jeffrey Wilusz, 2008 418. Avidin–Biotin Interactions: Methods and Applications, edited by Robert J. McMahon, 2008 417. Tissue Engineering, Second Edition, edited by Hannsjörg Hauser and Martin Fussenegger, 2007 416. Gene Essentiality: Protocols and Bioinformatics, edited by Svetlana Gerdes and Andrei L. Osterman, 2008 415. Innate Immunity, edited by Jonathan Ewbank and Eric Vivier, 2007 414. Apoptosis in Cancer: Methods and Protocols, edited by Gil Mor and Ayesha Alvero, 2008 413. Protein Structure Prediction, Second Edition, edited by Mohammed Zaki and Chris Bystroff, 2008 412. Neutrophil Methods and Protocols, edited by Mark T. Quinn, Frank R. DeLeo, and Gary M. Bokoch, 2007
- 9. Nanostructure Design Methods and Protocols Edited by Ehud Gazit Faculty of Life Science, Tel Aviv University Tel Aviv, Israel Ruth Nussinov Center for Cancer Research Nanobiology Program National Cancer Institute, Frederick, MD; Medical School, Tel Aviv University Tel Aviv, Israel M E T H O D S I N M O L E C U L A R B I O L O G Y ™
- 10. e-ISBN: 978-1-59745-480-3 ISSN: 1064-3745 e-ISSN: 1940-6029 DOI: 10.1007/978-1-59745-480-3 Library of Congress Control Number: 2008921784 © 2008 Humana Press, a part of Springer Science+Business Media, LLC All rights reserved. This work may not be translated or copied in whole or in part without the written permis- sion of the publisher (Humana Press, 999 Riverview Drive, Suite 208, Totowa, NJ 07512 USA), except for brief excerpts in connection with reviews or scholarly analysis. Use in connection with any form of informa- tion storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed is forbidden. The use in this publication of trade names, trademarks, service marks, and similar terms, even if they are not identified as such, is not to be taken as an expression of opinion as to whether or not they are subject to proprietary rights. Cover illustration: Provided by Aleksei Aksimentiev et al. (Chapter 11, Figures 4, 9a, 12, 13A) Printed on acid-free paper 9 8 7 6 5 4 3 2 1 springer.com Editors Ehud Gazit Department of Molecular Biology Faculty of Life Science Tel Aviv University Tel Aviv, Israel Ruth Nussinov Center for Cancer Research Nanobiology Program SAIC-Frederick National Cancer Institute Frederick, MD and Department of Human Genetics Medical School Tel Aviv University Tel Aviv, Israel Series Editor John M. Walker School of Life Sciences University of Hertfordshire Hatfield, Hertfordshire AL10 9AB UK ISBN: 978-1-934115-35-0
- 11. Preface We are delighted to present Nanostructure Design: Methods and Protocols. Nanotechnology is one of the fastest growing fields of research of the 21st century and will most likely have a huge impact on many aspects of our life. This book is part of the excellent Methods in Molecular BiologyTM series as molecular biology offers novel and unique solutions for nanotechnology. Nanostructure Design: Methods and Protocols is designed to serve as a major reference for theoretical and experimental considerations in the design of biological and bio-inspired building blocks, the physical characterization of the formed structures, and the development of their technological applications. It gives exposure to various biological and bio-inspired building blocks for the design and fabrication of nanostructures. These building blocks include pro- teins and peptides, nucleic acids, and lipids as well as various hybrid bioorganic molecular systems and conjugated bio-inspired entities. It provides information about the design of the building blocks both by experimental exploration of synthetic chemicals and biological prospects and by theoretical studies of the conformational space; the characterization of the formed nanostructures by var- ious biophysical techniques, including spectroscopy (electromagnetic as well as nuclear magnetic resonance) together with electron and probe microscopy; and the application of bionanostructures in various fields, including biosensors, diagnostics, molecular imaging, and tissue engineering. The book is divided into two sections; the first is experimental and the second computational. At the beginning of the book, Thomas Scheibel and coworkers describe the use of a natural biological self-assembled system, the spider silk, as an excellent source for the production of nano-ordered materi- als. Using recombinant DNA technology and bacterial expression, large-scale production of the unique silk-like protein is achieved. In Chapter 2, by Anna Mitraki and coworkers in collaboration with Mark van Raaij, yet another fascinating biological system is explored for technological uses. The authors, inspired by biological fibrillar assemblies, studied a small trimeriza- tion motif from phage T4 fibritin. Hybrid proteins that are based on this motif are correctly folded nanorods that can withstand extreme conditions. In Chapter 3, Maxim Ryadnov, Derek Woolfson, and David Papapostolou study yet another important self-assembly biological motif, the leucine zipper. Using this motif, the authors demonstrate the ability to form well-ordered fibril- lar structures. In Chapter 4, Joseph Slocik and Rajesh Naik describe methodolo- gies that exploit peptides for the synthesis of bimorphic nanostructures. Another v
- 12. demonstration of the use of peptides for self-assembled structures is described in Chapter 5 by Radhika P. Nagarkar and Joel P. Schneider. The authors use these peptides for the formation of hydrogel materials that may have many applications in diverse fields, including tissue engineering and regeneration. In the last chapter of the book’s experimental section (Chapter 6), Yingfu Li and coworkers describe a protocol for the preparation of a gold nanoparticle combined with a DNA scaffold on which nanospecies can be assembled in a periodical manner. This demonstrates the combination of biomolecules with inorganic nanoparticles for technological applications. In Part II, on the computational approach, Bruce A. Shapiro and coauthors describe in Chapter 7 recent developments in applications of single-stranded RNA in the design of nanostructures. RNA nanobiology presents a relatively new approach for the development of RNA-based nanoparticles. In Chapter 8, Idit Buch and coworkers describe self-assembly of fused homo- oligomers to create nanotubes. The authors present a protocol of fusing homo-oligomer proteins with a given three-dimensional structure to create new building blocks and provide examples of two nanotubes in atomistic model details. The authors of Chapter 9, Joan-Emma Shea and colleagues, present a thor- ough discussion of the theoretical foundation of an enhanced sampling protocol to study self-assembly of peptides, with an example of a peptide cut from the Alzheimer Aβ protein. The self-assembly of Aβ peptides led to amyloid fibril formation. Thorough and efficient sampling is crucial for computational design of self-assembled systems. In Chapter 10, Maarten G. Wolf, Jeroen van Gestel, and Simon W. de Leeuw also model amyloid fibril formation. The fibrillogenic properties of many pro- teins can be understood and thus predicted by taking the relevant free energies into account in an appropriate way. Their chapter gives an overview of existing simulation techniques that operate at a molecular level of detail. Klaus Schulten and his coworkers provide an overview in Chapter 11 of the impressive array of computational methods and tools they have developed that should allow dramatic improvement of computer modeling in biotechnology. These include silicon bionanodevices, carbon nanotube-biomolecular systems, lipoprotein assemblies, and protein engineering of gas-binding proteins, such as hydrogenases. In the final chapter (Chapter 12), Ugur Emekli and coauthors discuss the lessons that can be learned from highly connected β-rich structures for structural interface design. Identification of features that prevent polymerization of these proteins into fibrils should be useful as they can be incorporated in interface design. Biology has already shown the merit of a nanostructure formation process; it is the essence of molecular recognition and self-assembly events in the orga- vi Preface
- 13. nization of all biological systems. Biology offers a unique level of specificity and affinity that allows the fine tuning of nanoscale design and engineering. While much progress has been made, challenges are still ahead. We hope that Nanostructure Design: Methods and Protocols, which is based on biology and uses its principles and its vehicles toward design, will be useful for newcomers and experienced nanobiologists. It can also help scientists from other fields, such as chemistry and computer science, who would like to explore the prospects of nanobiotechnology. Ehud Gazit Ruth Nussinov Preface vii
- 14. Contents Preface .......................................................................................................... v Contributors .................................................................................................. xi PART I EXPERIMENTAL APPROACH 1 Molecular Design of Performance Proteins With Repetitive Sequences: Recombinant Flagelliform Spider Silk as Basis for Biomaterials............................................................................... 3 Charlotte Vendrely, Christian Ackerschott, Lin Römer, and Thomas Scheibel 2 Creation of Hybrid Nanorods From Sequences of Natural Trimeric Fibrous Proteins Using the Fibritin Trimerization Motif ......................................................................... 15 Katerina Papanikolopoulou, Mark J. van Raaij, and Anna Mitraki 3 The Leucine Zipper as a Building Block for Self-Assembled Protein Fibers.................................................................................. 35 Maxim G. Ryadnov, David Papapostolou, and Derek N. Woolfson 4 Biomimetic Synthesis of Bimorphic Nanostructures............................ 53 Joseph M. Slocik and Rajesh R. Naik 5 Synthesis and Primary Characterization of Self-Assembled Peptide-Based Hydrogels ................................................................ 61 Radhika P. Nagarkar and Joel P. Schneider 6 Periodic Assembly of Nanospecies on Repetitive DNA Sequences Generated on Gold Nanoparticles by Rolling Circle Amplification ....................................................... 79 Weian Zhao, Michael A. Brook, and Yingfu Li PART II COMPUTATIONAL APPROACH 7 Protocols for the In Silico Design of RNA Nanostructures................... 93 Bruce A. Shapiro, Eckart Bindewald, Wojciech Kasprzak, and Yaroslava Yingling 8 Self-Assembly of Fused Homo-Oligomers to Create Nanotubes ......... 117 Idit Buch, Chung-Jung Tsai, Haim J. Wolfson, and Ruth Nussinov 9 Computational Methods in Nanostructure Design: Replica Exchange Simulations of Self-Assembling Peptides .............. 133 Giovanni Bellesia, Sotiria Lampoudi, and Joan-Emma Shea ix
- 15. 10 Modeling Amyloid Fibril Formation: A Free-Energy Approach.......... 153 Maarten G. Wolf, Jeroen van Gestel, and Simon W. de Leeuw 11 Computer Modeling in Biotechnology: A Partner in Development ............................................................................ 181 Aleksei Aksimentiev, Robert Brunner, Jordi Cohen, Jeffrey Comer, Eduardo Cruz-Chu, David Hardy, Aruna Rajan, Amy Shih, Grigori Sigalov, Ying Yin, and Klaus Schulten 12 What Can We Learn From Highly Connected β-Rich Structures for Structural Interface Design?..................................... 235 Ugur Emekli, K. Gunasekaran, Ruth Nussinov, and Turkan Haliloglu Index............................................................................................................. 255 x Contents
- 16. Contributors Christian Ackerschott • TUM, Department Chemie, Lehrstuhl Biotechnologie, Garching, Germany Aleksei Aksimentiev • Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, IL Giovanni Bellesia • Department of Chemistry and Biochemistry, University of California, Santa Barbara, CA Eckart Bindewald • Basic Research Program, SAIC-Frederick Inc., NCI-Frederick, Frederick, MD Michael A. Brook • Department of Chemistry, McMaster University, Hamilton, Ontario, Canada Robert Brunner • Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, IL Idit Buch • Department of Human Genetics, Sackler Institute of Molecular Medicine, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel Jordi Cohen • Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, IL Jeffrey Comer • Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, IL Eduardo Cruz-Chu • Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, IL Simon W. de Leeuw • DelftChemTech, Delft University of Technology, Delft, The Netherlands Ugur Emekli • Polymer Research Center and Chemical Engineering Department, Bogaziçi University, Istanbul, Turkey Ehud Gazit • Department of Molecular Biology, Faculty of Life Science, Tel Aviv University, Tel Aviv, Israel K. Gunasekaran • Basic Research Program, SAIC-Frederick Inc., Center for Cancer Research Nanobiology Program, NCI-Frederick, Frederick, MD Turkan Haliloglu • Polymer Research Center and Chemical Engineering Department, Bogaziçi University, Istanbul, Turkey David Hardy • Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, IL Wojciech Kasprzak • Basic Research Program, SAIC-Frederick Inc., NCI-Frederick, Frederick, MD Sotiria Lampoudi • Department of Computer Science, University of California, Santa Barbara, CA xi
- 17. Yingfu Li • Departments of Chemistry and Biochemistry and Biomedical Sciences, McMaster University, Hamilton, Ontario, Canada Anna Mitraki • Department of Materials Science and Technology, c/o Biology Department, University of Crete, Vassilika Vouton, Crete, Greece Radhika P. Nagarkar • Department of Chemistry and Biochemistry, University of Delaware, Newark, DE Rajesh R. Naik • Materials and Manufacturing Directorate, Air Force Research Lab, Wright-Patterson Air Force Base, OH Ruth Nussinov • Center for Cancer Research Nanobiology Program, SAIC-Frederick, National Cancer Institute. Department of Human Genetics, Medical School, Tel Aviv University, Tel Aviv, Israel Katerina Papanikolopoulou • Institute of Molecular Biology and Genetics, Vari 16672, Greece David Papapostolou • School of Chemistry, University of Bristol, Cantock’s Close, Bristol, UK Aruna Rajan • Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, IL Lin Römer • Universität Bayreuth, Lehrstuhl Biomaterialien, 95440 Bayreuth, Germany Maxim G. Ryadnov • School of Chemistry, University of Bristol, Cantock’s Close, Bristol, UK Thomas Scheibel • Universität Bayreuth, Lehrstuhl Biomaterialien, 95440 Bayreuth, Germany Joel P. Schneider • Department of Chemistry and Biochemistry, University of Delaware, Newark, DE Klaus Schulten • Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, IL Bruce A. Shapiro • Center for Cancer Research Nanobiology Program, National Cancer Institute, Frederick, MD Joan-Emma Shea • Department of Chemistry and Biochemistry, University of California, Santa Barbara, CA Amy Shih • Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, IL Grigori Sigalov • Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, IL Joseph M. Slocik • Materials and Manufacturing Directorate, Air Force Research Lab, Wright-Patterson Air Force Base, OH Chung-Jung Tsai • SAIC-Frederick Inc., Center for Cancer Research Nanobiology Program, NCI-Frederick, Frederick, MD Jeroen van Gestel • DelftChemTech, Delft University of Technology, Delft, The Netherlands xii Contributors
- 18. Mark J. van Raaij • Institute of Molecular Biology of Barcelona (IBMB- CSIC); Parc Cientific de Barcelona, 08028 Barcelona, Spain Charlotte Vendrely • TUM, Department Chemie, Lehrstuhl Biotechnologie, Garching, Germany Maarten G. Wolf • DelftChemTech, Delft University of Technology, Delft, The Netherlands Haim J. Wolfson • School of Computer Science, Tel Aviv University, Tel Aviv, Israel Derek N. Woolfson • School of Chemistry, University of Bristol, Cantock’s Close, Bristol, UK; Department of Biochemistry, School of Medical Sciences, University Walk, Bristol, UK Ying Yin • Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, IL Yaroslava Yingling • Center for Cancer Research Nanobiology Program, National Cancer Institute, Frederick, MD Weian Zhao • Department of Chemistry, McMaster University, Hamilton, Ontario, Canada Contributors xiii
- 19. 3 From: Methods in Molecular Biology, vol. 474: Nanostructure Design: Methods and Protocols Edited by: E. Gazit and R. Nussinov © Humana Press, Totowa, NJ 1 Molecular Design of Performance Proteins With Repetitive Sequences Recombinant Flagelliform Spider Silk as Basis for Biomaterials Charlotte Vendrely, Christian Ackerschott, Lin Römer, and Thomas Scheibel Summary Most performance proteins responsible for the mechanical stability of cells and organisms reveal highly repetitive sequences. Mimicking such performance proteins is of high interest for the design of nanostructured biomaterials. In this article, flagelliform silk is exemplary intro- duced to describe a general principle for designing genes of repetitive performance proteins for recombinant expression in Escherichia coli. In the first step, repeating amino acid sequence motifs are reversely transcripted into DNA cassettes, which can in a second step be seamlessly ligated, yielding a designed gene. Recombinant expression thereof leads to proteins mimicking the natural ones. The recombinant proteins can be assembled into nanostructured materials in a controlled manner, allowing their use in several applications. Key Words: Biomaterials; recombinant production; repetitive sequence; spider silk proteins. 1. Introduction Proteins with repetitive sequences often have specific structural properties and functions in nature. Such proteins comprise transcription factors, devel- opmental proteins (1), or structural biomaterials like elastin (2), collagen (3), and silk (4). Spider silks, for instance, possess outstanding mechanical properties (5–7), which are highly important for the stability, for a spider’s web. Among the diversity of silks produced by an individual spider, major ampullate silk forms the frame of the web and is responsible for its strength. In contrast, flagelliform silk building the capture spiral provides the elasticity necessary for dissipating
- 20. 4 Vendrely et al. the energy of prey flying into the web. Typically, all spider silks are composed of proteins that have a highly repetitive core sequence flanked by short, nonre- petitive sequences at the amino and carboxy termini (Fig. 1) (8,9). Sequence comparison of common spider silk proteins reveals four oligo- peptide motifs that are repeated several times in each individual protein: (1) (GA)n/(A)n, (2) GPGGX/GPGQQ, (3) GGX, and (4) “spacer” sequences that contain charged amino acids (4,10–14). Previously, distinct secondary structure contents (i.e., nanostructures) have been detected for silk proteins, depending on these amino acid sequences. The structural investigation of the motifs has often been performed using either entire silk fibers or short, nonassembled pep- tides mimicking the described oligopeptide sequences. Methods like Fourier transform infrared (FTIR), X-ray diffraction, and nuclear magnetic resonance (NMR) revealed that oligopeptides with the sequence (GA)n/(A)n tend to form α-helices in solution but β-sheet structures in assembled fibers (15–22). Such β-sheets presumably assemble the crystalline domains found within the natural silk fiber (19,23–25). In contrast, the structures adopted by GPGGX/GPGQQ and GGX repeats remain unclear. Based on X-ray diffraction studies, these regions have been described to resemble amorphous “rubber” (26,27), and NMR studies suggested that they form 31-helical structures or can be incorporated into β-sheets (17,19). Flagelliform silk, which is rich in GPGGX and GGX motifs (Fig. 1), likely Fig. 1. Repetitive nature of the flagelliform silk protein sequence. The core sequence consists of 11 ensemble repeats that contain four consensus motifs: Y, X, sp, and K. Sfl, the recombinant protein mimicking the core domain of natural flagelliform protein, is composed of Y6X2spK2Y2. In the natural protein, the repetitive core sequence is flanked by nonrepeated sequences at the amino terminus (NT) and the carboxy terminus (CT).
- 21. Recombinant Flagelliform Spider Silk 5 folds into β-turn structures (28,29), which yield a right-handed helix termed b- spiral on stacking, similar to structural elements of elastin (13,14,30). The outstanding properties of silk materials together with the modular nature of the underlying proteins have prompted researchers to design proteins mimicking natural silk in a modular approach. This design strategy employs synthetic DNA modules that are reversely transcripted from oligopeptide motifs characteristic for spider silk proteins. The DNA modules are assembled step by step, yielding a synthetic gene, which can be recombinantly expressed in hosts such as bacteria. Designed recombinant silk proteins allow controlled assem- bly of nanostructures and morphologies for various applications and therefore reflect a fascinating new generation of biomaterials. 2. Materials 1. Escherichia coli strains DH10B and BLR [DE3] (Novagen, Merck Biosciences Ltd., Darmstadt, Germany). 2. Plasmids: pFastBac1 (Invitrogen, Carlsbad, CA). 3. Oligonucleotide primers (MWG Biotech AG, Ebersberg, Germany). 4. Restriction enzymes: AlwNI, BamHI, BglII, BseRI, BsgI, EcoRI, HindIII, and NcoI (New England Biolabs, Beverly, MA). 5. T4 ligase (Promega Biosciences Inc., San Luis Obispo, CA). 6. Agarose, polymerase chain reaction (PCR), and DNA sequencing equipment. 7. LB (Luria Bertani) medium. 8. Appropriate antibiotics: Ampicillin stock solution (100mg/mL). 9. Isopropyl-β-d-galactopyranoside (IPTG) 1M stock solution. 10. Lysis buffer: 20mM HEPES, 5mM NaCl, pH 7.5. 11. Lysozyme (Sigma-Aldrich, St. Louis, MO). 12. MgCl2 2M solution. 13. Proteinase-free deoxyribonuclease (DNase) I (Roche, Mannheim, Germany). 14. Protease inhibitors (Serva, Heidelberg, Germany). 15. Inclusion bodies washing buffer: 100mM Tris-HCl, 20mM ethylenediaminetet- raacetic acid (EDTA), pH 7.0. 16. Q Sepharose (Amersham Biosciences, Piscataway, NJ). 17. Fast protein liquid chromatographic (FPLC) equipment. 18. Binding buffer: 20mM HEPES, 5mM NaCl, 8M urea, pH 7.5. 19. Elution buffer: 20mM HEPES, 1M NaCl, 8M urea, pH 7.5. 20. 4M ammonium sulfate. 21. 1M ammonium carbonate. 22. Hexafluoroisopropanol (HFIP): Toxic solution; handle with care. 3. Methods 3.1. Design of a Cloning Vector We developed a gene design method to recombinantly produce spider silk proteins in bacteria (31–33). The commercially available vector pFastbac1,
- 22. 6 Vendrely et al. featuring an origin of replication and a cassette for antibiotic resistance for selection, was equipped with a specific multiple-cloning site (MCS). The MCS was generated by two complementary synthetic oligonucleotides, which were annealed by decreasing the temperature from 95°C to 20°C with an increment of 0.1K/s. Mismatched double strands were denatured at 70°C, and again the temperature was decreased to 20°C. The denaturing and annealing cycle was repeated 10 times, and 10 additional cycles were performed with a denaturing step at 65°C (instead of 70°C). The resulting double-stranded DNA fragment exhibited sticky ends for ligation with the vector pFastbac1 digested with BglII and HindIII. Both recognition sites were destroyed after ligation using T4 ligase. The resulting cloning vector pAZL contains recognition sites for the restriction enzymes BseRI, BsgI, BamHI, NcoI, EcoRI, and HindIII, which can individu- ally be employed for various steps of the cloning procedure. 3.1.1. Cloning Strategy The amino acid sequence of a repetitive protein is divided into distinct char- acteristic oligopeptide motifs. The amino acid sequences of these motifs are backtranslated into DNA sequences. To obtain double-stranded DNA cassettes, both sense and antisense strands are synthesized (see Notes 1 and 2), which are annealed as described in case of the MCS. The repetitive core sequence of flagelliform silk contains mainly four amino acid motifs (Fig. 1), which have been backtranslated into DNA sequences using the codon usage of Escherichia coli. For each construct, two complementary synthetic oligonucleotides were designed in a way that each 3′ end has two additional bases for direct cloning into linearized pAZL digested with either BseRI or BsgI (Fig. 2A). Multimerization or combination of the DNA cassettes was performed by digesting (1) pAZL containing one desired DNA cassette with AlwNI and BsgI and (2) pAZL containing another cassette with AlwNI and BseRI (Fig. 2B). After ligation using T4 ligase, pAZL was reconstituted, now containing both DNA cassettes. Since the recognition sequences of BsgI and BseRI are situated 14 and 8 basepairs away from the respective restriction site, all restriction sites are omitted between both DNA cassettes, and the cloning system allows direct ligation of the two cassettes without additional linker or spacer regions (Fig. 2B). 3.1.2. Cassettes With Specific Flagelliform Silk Sequences The flagelliform silk protein of Nephila clavipes contains nonrepetitive amino- and carboxyterminal regions and 11 ensemble repeats in the core domain. Each reflects subrepeats with distinct recurring oligopeptide motifs (Fig. 1). From there, a spacer (sp) and three repeating motifs (Y, X, K) have been selected for backtranslation into oligonucleotides, which were then annealed as described.
- 23. Recombinant Flagelliform Spider Silk 7 Fig. 2. Cloning strategy for the production of proteins with repeated sequences. (A) The protein of interest is analyzed and its amino acid sequence is backtranslated into DNA cassettes corresponding to single-oligopeptide motifs. Single DNA cassettes are incorporated into a predesigned vector. In the chosen example, the seamless clon- ing technique leads to the incorporation of a codon for a glycine residue between two cassettes. This connecting glycine residue is the natural linker in flagelliform silk but would also be a perfect linker for other peptide motifs since glycines do not signifi- cantly perturbate the protein structure. (B) Motifs 1 and 2 are joined in one plasmid by seamless ligation using restriction enzymes BsgI and BseRI. By repeatedly digesting/ ligating the respective plasmid, it is possible to obtain vectors containing a defined number and composition of motifs separated by glycine residues.
- 24. 8 Vendrely et al. The gene sequences of the native aminoterminal (NT) and carboxyterminal (CT) regions were amplified by PCR and inserted into pAZL like the other synthetic DNA sequences.
- 25. Recombinant Flagelliform Spider Silk 9 The DNA cassettes Y, X, K, and sp were ligated to mimic one ensemble repeat of the native flagelliform protein. A consensus sequence of a single ensemble repeat is reflected by the sequence sfl: Y6X2spK2Y2. Successively, starting with a single sfl module, various constructs have been designed, leading to the exemplary proteins Sfl3, Sfl-CT, Sfl3-CT, NT-Sfl, and NT-Sfl-CT useful for studying structure-function relationships of individual silk motifs. 3.2. Recombinant Production of Sfl Proteins After engineering various artificial flagelliform genes, they were subcloned into expression vectors pET21 or pET28 using the restriction enzymes BamHI and HindIII or NcoI and HindIII, respectively. Escherichia coli BLR [DE3] was transformed with the corresponding plasmid (see Note 3), and single clones were incubated in a 4-mL preculture at 37°C overnight. After inoculation of a 2-L culture of LB medium, expression was initiated at OD600 0.8 using 1mM IPTG at 30°C. Escherichia coli cells were harvested 3–4h after induction, and the cell pellet was resuspended in lysis buffer at 4°C (5mL per gram of cells). On addition of 0.2mg lysozyme per milliliter, the suspension was incubated at 4°C for 30min until becoming viscous. Protease inhibitor was added before the cells were ultra- sonicated. DNA was digested with 3mM MgCl2, 10µg/mL DNase, followed by incubation at room temperature for 30min. Then, 0.5 volumes of 60mM EDTA, 2–3% Triton X-100 (v/v), 1.5M NaCl, pH 7.0, were added, and the suspension was incubated at 4°C for another 30min. Recombinant flagelliform proteins are entirely found in inclusion bodies, which were sedimented at 20,000g at 6°C for 30min. The inclusion bodies were resuspended in 100mM Tris-HCl, 20mM EDTA, pH 7.0, using an ultraturax. These steps were repeated one or two addi- tional times to wash the inclusion bodies. After a final centrifugation step, the inclusion bodies were frozen in liquid nitrogen and stored at −20°C. 3.3. Purification of Flagelliform Proteins From Inclusion Bodies Frozen inclusion bodies were dissolved in binding buffer, and the solution was applied to an equilibrated Q Sepharose Fast Flow column (20mL self-packed, flow 1–1.5mL/min), which was eluted by a linear sodium chloride gradient. Flagelliform silk proteins were eluted between 200 and 250mM NaCl. Pooled protein fractions were precipitated at 30%w/v ammonium sulfate (final con- centration 1.2M ammonium sulfate). After sedimentation, the protein pellet was dissolved in 20mM HEPES, 5mM NaCl, 8M urea, pH 7.5m and dialyzed against 10mM ammonium hydrogen carbonate. The protein (purity>98%) (see Note 4) was aliquoted, frozen in liquid nitrogen, lyophilized overnight, and stored at −20°C.
- 26. 10 Vendrely et al. 3.4. Assembly of Recombinant Proteins Developing New Materials Over the past few years, various studies have explored the potential of insect and spider silks as new materials. Regenerated or recombinant silks can be assembled in various forms, like threads, micro- or nanofibers, hydrogels, porous sponges, and films (34). Such biomaterials could be employed in biomedical, cosmetic, and technical applications. Here, the example of a silk film is presented. The properties of those films are mediated by the employed protein dissolved in an appropriate solvent (35,36). Exemplarily, lyophilized Sfl is dissolved in HFIP and cast on a surface like polyethylene (PE). After evaporation of HFIP, the remaining Sfl film can be peeled off the surface (Fig. 3). The Sfl film reveals mainly β-sheet structure. The thickness of this silk film can be easily controlled by the amount of the protein and the size of the area where the organic solution is cast. 3.5. Design of Novel Proteins The polymeric nature of spider silk inspires the design of novel proteins with defined nanostructures and desired properties. Specific motifs can be integrated to improve the solubility of the protein, to control its assembly process, and to control thermal, chemical, biological, and mechanical properties. For example, motifs have been incorporated into silk protein sequences to control assembly (37–40). Side-specific functionalization is also feasible by incorporating amino acids with chemically active side groups, such as lysine or cysteine (32,41,42). Conceiving the addition of larger peptide motifs with specific functionalities or structures will lead to novel chimeric proteins (43,44). Fig. 3. Film casting using engineered flagelliform silk proteins. Lyophilized protein is dissolved in hexafluoro-2-propanol. The protein solution is cast on a surface, and the film is peeled off after evaporation of the solvent.
- 27. Recombinant Flagelliform Spider Silk 11 Based on such technology, chimera combining a spider silk domain and an elastin peptide or a dentin matrix protein have been successfully engineered (43,45). Chimeric silk proteins are capable of providing a wide variety of functions or structures based on their peptide motifs, including chemically active sites, enzyme activity, receptor-binding sites, and so on (42,46–48). The combination of such potential with repetitive sequences will allow the design of new perfor- mance proteins with defined nanostructures and chosen functionalities. 4. Notes 1. The length of the oligonucleotides is generally between 30 and 120 bases, depending on technical limitations during synthesis. 2. Screening of bacterial clones can be facilitated by adjusting the codon usage to incorporate a restriction site for a defined enzyme within the DNA cassette. 3. An appropriate bacterial strain is important for the production of proteins with repetitive sequences. Escherichia coli BLR [DE3] does not contain recombinase activity, preventing homolog recombination and subsequent shortening of the repetitive genetic information. 4. Since the employed spider silk proteins do not comprise tryptophan residues, fluo- rescence measurements of the purified protein will reveal a maximum at 305nm after excitation of tyrosine residues at 280nm, but no tryptophan fluorescence maximum (350nm) on excitation at 295nm (31). Therefore, protein purity can easily be checked and quantified. Acknowledgments We thank members of the Fiberlab and Lasse Reefschläger for critical comments on the manuscript. This work was supported by grants from DFG (SCHE 603/4-2) and ARO (W911NF-06-1-0451). References 1. Faux NG, Bottomley SP, Lesk AM, et al. (2005) Functional insights from the distribution and role of homopeptide repeat-containing proteins. Genome Res. 154, 537–551. 2. Foster JA, Bruenger E, Gray WR, Sandberg LB. (1973) Isolation and amino acid sequences of tropoelastin peptides. J. Biol. Chem. 248, 2876–2879. 3. Fietzek PP, Kuhn K. (1975) Information contained in the amino acid sequence of the alpha1(I)-chain of collagen and its consequences upon the formation of the triple helix, of fibrils and crosslinks. Mol. Cell. Biochem. 8, 141–157. 4. Xu M, Lewis RV. (1990) Structure of a protein superfiber: spider dragline silk. Proc. Natl. Acad. Sci. U. S. A. 87, 7120–7124. 5. Gosline JM, Guerette PA, Ortlepp CS, Savage KN. (1999) The mechanical design of spider silks: from fibroin sequence to mechanical function. J. Exp. Biol. 202, 3295–3303.
- 28. 12 Vendrely et al. 6. Vollrath F. (2000) Strength and structure of spiders’ silks. J. Biotechnol. 74, 67–83. 7. Gosline JM, Lillie M, Carrington E, Guerette P, Ortlepp C, Savage K. (2002) Elastic proteins: biological roles and mechanical properties Phil. Trans. R. Soc. Lond. B. 357, 121–132. 8. Bini E, Knight DP, Kaplan DL. (2004) Mapping domain structures in silks from insects and spiders related to protein assembly. J. Mol. Biol. 335, 27–40. 9. Hu X, Vasanthavada K, Kohler K, et al. (2006) Molecular mechanisms of spider silk. Cell. Mol. Life. Sci. 63, 1986–1999. 10. Anderson SO. (1970) Amino acid composition of spider silks. Comp. Biochem. Physiol. 35, 705–711. 11. Work RW, Young CT. (1987) The amino acid compositions of major and minor ampullate silks of certain orb-web-building spiders (Araneae, Araneidea) J. Arachnol. 15, 65–80. 12. Lombardi SL, Kaplan DL. (1990) The amino acid composition of major ampullate gland silk (dragline) of Nephila clavipes (Araneae, Tetragnathidae). J. Arachnol. 18, 297–306. 13. Hayashi CY, Lewis RV. (1998) Evidence from flagelliform silk cDNA for the structural basis of elasticity and modular nature of spider silks. J. Mol. Biol. 275, 773–784. 14. Hayashi CY, Shipley NH, Lewis RV. (1999) Hypotheses that correlate the sequence, structure, and mechanical properties of spider silk proteins. Int. J. Biol. Macrom. 24, 271–275. 15. Simmons A, Ray E, Jelinski LW. (1994) Solid state 13C NMR of N. clavipes drag- line silk establishes structure and identity of crystalline regions. Macromolecules 27, 5235–5237. 16. Hijirida DH, Do KG, Michal C, Wong S, Zax D, Jelinski LW. (1996) 13C NMR of Nephila clavipes major ampullate silk gland. Biophys. J. 71, 3442–3447. 17. Kümmerlen J, van Beek JD, Vollrath F, Meier BH. (1996) Local structure in spider dragline silk investigated by two-dimensional spin-diffusion NMR. Macromolecules 29, 2820–2928. 18. Seidel A, Liivak O, Calve S, et al. (2000) Regenerated spider silk: processing, properties, and structure. Macromolecules 33, 775–780. 19. van Beek JD, Hess S, Vollrath F, Meier BH. (2002) The molecular structure of spider dragline silk: folding and orientation of the protein backbone. Proc. Natl. Acad. Sci. U. S. A. 99, 10266–10271. 20. Lawrence BA, Vierra CA, Moore AMF. (2004) Molecular and mechanical prop- erties of major ampullate silk of the black widow spider, Latrodectus hesperus. Biomacromolecules 5, 689–685. 21. Yang M, Nakazawa Y, Yamauchi K, Knight D, Asakura T. (2005) Structure of model peptides based on Nephila clavipes dragline silk spidroin (MaSp1) studied by 13C cross polarization/magic angle spinning NMR. Biomacromolecules 6, 3220–3226. 22. Zhou C, Leng B, Yao J, et al. (2006) Synthesis and characterization of multi- block copolymers based on spider dragline silk proteins. Biomacromolecules 7, 2415–2419.
- 29. Recombinant Flagelliform Spider Silk 13 23. Simmons A, Michal C, Jelinski L. (1996) Molecular orientation and two- component nature of the crystalline fraction of spider dragline silk. Science 271, 84–87. 24. Jelinski LW, Blye A, Liivak O, et al. (1999) Orientation, structure, wet-spinning, and molecular basis for supercontraction of spider dragline silk. Int. J. Biol. Macromol. 24, 197–201. 25. Riekel C, Bränden C, Craig C, Ferrero C, Heidelbach F, Müller M. (1999) Aspects of X-ray diffraction on single spider fibers. Int. J. Biol. Macromol. 24, 179–186. 26. Gosline JM, Denny MW, DeMont ME. (1984) Spider silk as rubber. Nature 309, 551–552. 27. Termonia Y. (1994) Monte Carlo diffusion model of polymer coagulation. Macromolecules 27, 7378–7381. 28. Zhou Y, Wu S, Conticello VP. (2001) Genetically directed synthesis and spectro- scopic analysis of a protein polymer derived from a flagelliform silk sequence. Biomacromolecules 2, 111–125. 29. Ohgo K, Kawase T, Ashida J, Asakura T. (2006) Solid-state NMR analysis of a peptide (Gly-Pro-Gly-Gly-Ala)6-Gly derived from a flagelliform silk sequence of Nephila clavipes. Biomacromolecules 7, 1210–1214. 30. Becker N, Oroudjev E, Mutz S, et al. (2003) Molecular nanosprings in spider capture-silk threads. Nat. Mater. 2, 278–283. 31. Huemmerich D, Helsen CW, Quedzuweit S, Oschman J, Rudolph R, Scheibel T. (2004) Primary structure elements of spider dragline silks and their contribution to protein solubility. Biochemistry 43, 13604–13612. 32. Scheibel T. (2004) Spider silks: recombinant synthesis, assembly, spinning, and engineering of synthetic proteins. Microb. Cell. Fact. 3, 14–23. 33. Vendrely C, Scheibel T. (2007) Biotechnological production of spider silk pro- teins enables new applications. Macromol. Biosci. 7, 401–409. 34. Altman GH, Diaz F, Jakuba C, et al. (2003) Silk-based biomaterials. Biomaterials 24, 401–416. 35. Huemmerich D, Slotta U, Scheibel T. (2006) Processing and modification of films made from recombinant spider silk proteins. Appl. Phys. A 82, 219–222. 36. Slotta U, Tammer M, Kremer F, Kölsch P, Scheibel T. (2006) Structural analysis of spider silk films. Supramol. Chem. 18, 465–472. 37. Szela S, Avtges P, Valluzzi R, et al. (2000) Reduction-oxidation control of beta- sheet assembly in genetically engineered silk. Biomacromolecules 1, 534–542. 38. Winkler S, Wilson D, Kaplan DL. (2000) Controlling β-sheet assembly in genetically engineered silk by enzymatic phosphorylation/dephosphorylation. Biochemistry 39, 12739–12746. 39. Valluzzi R, Winkler S, Wilson D, Kaplan DL. (2002) Silk: molecular organiza- tion and control of assembly. Philos. Trans. R. Soc. Lond. B Biol. Sci. 357, 165–167. 40. Wong Po Foo C, Bini E, Huang J, Lee SY, Kaplan DL. (2006) Solution behaviour of synthetic silk peptides and modified recombinant silk proteins. Appl. Phys. A 82, 193–203.
- 30. 14 Vendrely et al. 41. Scheibel T, Parthasarathy R, Sawicki G, Lin X-M, Jaeger H, Lindquist S. (2003) Conducting nanowires built by controlled self-assembly of amyloid fibers and selective metal deposition. Proc. Natl. Acad. Sci. U. S. A. 100, 4527–4532. 42. Scheibel T. (2005) Protein fibers as performance proteins: new technologies and applications. Curr. Opin. Biotechnol. 16, 427–433. 43. Scheller J, Henggeler D, Viviani A, Conrad U. (2004) Purification of spider silk- elastin from transgenic plants and application for human chondrocyte prolifera- tion. Transgenic Res. 13, 51–57. 44. Wong Po Foo C, Patwardhan SV, Belton DJ, et al. (2006) Novel nanocomposites from spider silk-silica fusion (chimeric) proteins Proc. Natl. Acad. Sci. U. S. A. 103, 9428–9433. 45. Huang J, Wong C, George A, Kaplan DL. (2007) The effect of genetically engi- neered spider silk-dentin matrix protein 1 chimeric protein on hydroxyapatite nucleation. Biomaterials 28, 2358–2367. 46. Cappello J, Crissman J, Dorman M, et al. (1990) Genetic engineering of struc- tural protein polymers. Biotechnol. Prog. 6, 198–202. 47. Yang M, Asakura T. (2005) Design, expression, and solid-state NMR character- ization of silk-like materials constructed from sequences of spider silk, Samia cynthia ricini and Bombyx mori silk fibroins. J. Biochem. 137, 721–729. 48. Bini E, Wong Po Foo C, Huang J, Karageorgiou V, Kitchel B, Kaplan DL. (2006) RGD-functionalized bioengineered spider silk dragline silk biomaterial. Biomacromolecules 7, 3139–3145.
- 31. 2 Creation of Hybrid Nanorods From Sequences of Natural Trimeric Fibrous Proteins Using the Fibritin Trimerization Motif Katerina Papanikolopoulou, Mark J. van Raaij, and Anna Mitraki Summary Stable, artificial fibrous proteins that can be functionalized open new avenues in fields such as bionanomaterials design and fiber engineering. An important source of inspiration for the creation of such proteins are natural fibrous proteins such as collagen, elastin, insect silks, and fibers from phages and viruses. The fibrous parts of this last class of proteins usually adopt trimeric, β-stranded structural folds and are appended to globular, receptor-binding domains. It has been recently shown that the globular domains are essential for correct folding and trimerization and can be successfully substituted by a very small (27-amino acid) trimerization motif from phage T4 fibritin. The hybrid proteins are correctly folded nanorods that can withstand extreme condi- tions. When the fibrous part derives from the adenovirus fiber shaft, different tissue-targeting specificities can be engineered into the hybrid proteins, which therefore can be used as gene therapy vectors. The integration of such stable nanorods in devices is also a big challenge in the field of biomechanical design. The fibritin foldon domain is a versatile trimerization motif and can be combined with a variety of fibrous motifs, such as coiled-coil, collagenous, and triple β-stranded motifs, provided the appropriate linkers are used. The combination of different motifs within the same fibrous molecule to create stable rods with multiple functions can even be envisioned. We provide a comprehensive overview of the experimental procedures used for designing, creating, and characterizing hybrid fibrous nanorods using the fibritin trimerization motif. Key Words: Fibritin; fibrous proteins; fusion proteins; nanorods; trimerization. 1. Introduction 1.1. Fibrous Proteins in Nature and Their Possible Use in Applications Fibrous proteins such as collagens, elastins, silkworm and insect silks, and viral fibers are mainly designed for providing mechanical functions and structural support in nature (1–5). Their primary sequences consist of repetitive sequences 15 From: Methods in Molecular Biology, vol. 474: Nanostructure Design: Methods and Protocols Edited by: E. Gazit and R. Nussinov © Humana Press, Totowa, NJ
- 32. 16 Papanikolopoulou, van Raaij, and Mitraki that serve as building blocks for their bottom-up, controlled self-assembly, lead- ing to complex molecular architectures. Furthermore, site-specific changes can be easily introduced at the sequence level to achieve their functionalization. This possibility of chemical and structural control at the nanoscale confers considerable advantages to fibrous biomaterials compared to conventional, nonbiological fibrous materials (6–8). Fibrous proteins from viruses are a distinctive family of extracellular pro- teins, usually entirely composed of β-structure (9). Their fibrous parts fold into triple β-structured folds and are joined to globular domains, usually located at their C-termini. These globular domains are essential for the trimerization of the fibrous parts (10,11). On top of excellent mechanical properties, this family of proteins, as well as amyloid-forming peptides derived from them, is exceptionally resistant to extreme conditions (temperature, detergents, denatur- ants) (12,13). This exceptional resistance offers the possibility of interfacing with the inorganic world, that is, to use biological nanofibers and nanotubes in nanodevices (6,14–16). In adenoviruses, the C-terminal globular domain is the cell receptor domain, essential for attachment specificity (17,18). Adenoviruses are used as gene therapy vectors, and new generations of vectors seek to selectively target tis- sues. If an attaching specificity different from the one conferred by the natural C-terminal is desired, the C-terminal domain has to be replaced by another motif/domain. This domain has to be a trimerization motif to support trimeriza- tion of the fibrous part (19). This kind of “knobless” construct/vector, further derivatized with the desired tissue-targeting motifs, can be used for enabling gene therapy and tissue engineering applications (20–22). 1.2. Methodology for Creating and Studying Chimeric Proteins Between Fibritin and Triple-Stranded Segments of Fibrous Proteins The methodology for creating and studying chimeric proteins was first devel- oped from fundamental studies aimed at structural understanding of fibrous proteins. In phage T4 fibritin, a 27-amino acid (aa) domain (amino acids 457–483 of fibritin) forms a trimeric globular, β-propellor-like structure located at the C-terminal end of a triple coiled-coil motif (23). This small domain (termed foldon) can fold and trimerize autonomously (24). N-terminal deletion mutants with an intact foldon domain trimerize successfully, whereas fibritins with a deleted or mutated foldon domain fail to fold correctly. It has therefore been proposed that the foldon domain serves as a registration motif for the segmented triple coiled-coil motif of the fibritin (25). It has been subsequently shown that chimeric proteins between the foldon domain and fibrous sequences from collagen, phage T4 short-tail fibers, and HIV glycoproteins can be created and can fold successfully (26–28).
- 33. Fibritin Domain for Engineering b-Structured Nanorods 17 We have recently created chimeric proteins by replacing the head of the adenovirus fiber by the fibritin foldon to gain insight into the trimerization mechanisms of the fiber. The previously reported structure of a stable frag- ment (residues 319–582 of the fiber) (29) served as the basis for the chimeric protein design. Three chimeric proteins were constructed, two comprising the shaft segment (residues 319–392) with the foldon domain in its C-terminal end (replacing the natural head domain) and one with the foldon domain in the N-terminal end of the shaft segment. In one of the chimeric proteins with the foldon at the C-terminal end, the natural linker sequence (Asn-Lys-Asn-Asp- Asp-Lys, residues 393–398) that connects the globular head to the shaft was used to connect the shaft sequences to the foldon domain. In the second, as well as in the protein with the foldon at its N-terminal end, the two domains were joined without incorporating the linker sequence. The chimeric proteins with the foldon domain appended to the C-terminus of the fiber shaft sequences fold into highly stable, sodium dodecyl sulfate (SDS)-resistant trimers, indicative of correct folding and assembly (30). The crystal structure of these two chime- ras was subsequently solved, showing that the individual domains retain their native fold (see Fig. 3) (31). The results suggested that the foldon domain not only ensures correct trimerization of the shaft sequences but also allows them to assume their triple β-spiral fold. This result combined with the versatility of the foldon domain, suggests that its fusion to longer adenovirus shaft segments as well as segments from other trimeric, β-structured fiber proteins should be feasible. The experimental methodology described can be applied to the following areas: Fundamental studies of new fibrous folds. Although several novel fibrous folds emerged during the last decade, many still remain unresolved. The asymmetric nature (coexistence of globular and fibrous parts; large differences in relative dimen- sions) and natural flexibility in trimeric fibrous proteins are major barriers in crystallogenesis. Even when crystals can be obtained, they often suffer from local disorder. Replacement of big globular terminal domains with the fibritin foldon, allowing the creation of stable crystallizable fragments, can become a general strategy leading to solving the fibrous part structures. Construction of gene therapy vectors. When the fibritin foldon replaces the C-terminal globular head of adenovirus, it enables correct trimerization of shaft repeats, but the construct is devoid of biological activity. However, it can be derivatized with tissue-targeting motifs that can offer different attaching specificities and therefore could be used as gene therapy vectors. Rational design of fibrous constructs with controlled dimensions. Adding a desired number of building blocks derived from β-structured fibrous motifs to the fibritin foldon can create stable nanorods that could be used for integration in devices.
- 34. 18 Papanikolopoulou, van Raaij, and Mitraki 2. Materials All reagents are analytical grade. 2.1. Cloning 1. Oligonucleotides have been synthesized by MWG-biotech; reconstitute the lyoph- ilized powder at 100pmol/µL. 2. Perform polymerase chain reaction (PCR) using Pwo polymerase (Roche). 3. Bacteriophage T4 genomic DNA is obtained from Sigma. 4. Restriction enzymes are purchased from Roche. 5. For preparative gel electrophoresis of DNA fragments less than 1kb, use Nusieve GTG agarose. The isolated fragments can be purified using the QIAquick Gel Extraction kit (Qiagen). 6. For the ligation reactions, the Rapid DNA Ligation Kit is supplied by Roche. 7. The amplified DNA fragments are cloned in the PT7-7 vector (32). 8. Plasmid DNA production is performed in the strain DH5α (Invitrogen). 9. For plasmid DNA purification, the Plasmid Miniprep Kit (Qiagen) can be used. 2.2. Culture and Lysis of Escherichia Coli 1. Protein expression is performed in the strain JM109(DE3) (Promega). 2. Prepare 1L of LB (Luria Bertani) medium supplemented with sorbitol (330mM), betaine hydrochloride (2.5mM), and ampicillin (100µg/mL). 3. Dissolve ampicillin (Sigma) at 100mg/mL in water, aliquot, and store at −80°C. 4. Isopropyl-β-d-thiogalactopyranoside (IPTG) is dissolved in water at 0.5M and stored at −80°C in aliquots. 5. Ethylenediaminetetraacetic acid (EDTA) stock solution: 0.5M in water. Dissolve 18.6g EDTA (disodium salt, dihydrate, M = 372.2) into 70mL water, titrate to pH 8.0, and make up to 100mL. Store at room temperature or at 4°C. 6. Lysis buffer: 50mM Tris-HCl at pH 8.0, 2mM EDTA, 20mM NaCl. Add a tablet of Roche Complete™ protease inhibitors to lysis buffer just before use. 7. Streptomycin sulfate is purchased from Sigma. 8. For cell lysis, use a French press. 2.3. Purification (see Note 1) 1. Anion exchange chromatography: a. Column: Resource Q column (Pharmacia). b. Buffer A: 10mM Tris-HCl buffer at pH 8.5, 1mM EDTA. c. Buffer B: 10mM Tris-HCl buffer at pH 8.5, 1mM EDTA, 200mM NaCl. 2. Hydrophobic interaction chromatography: a. Column: Phenyl superose 5/5 column (Pharmacia). b. Buffer 1: 25mM Na2HPO4, 25mM NaH2PO4, 1mM EDTA, 1.7M ammonium sulfate, pH 6.5. c. Buffer 2: 25mM Na2HPO4, 25mM NaH2PO4, 1mM EDTA, pH 6.5. 3. For the fractional precipitation, ammonium sulfate is purchased from Sigma.
- 35. Fibritin Domain for Engineering b-Structured Nanorods 19 2.4. Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) is considered a standard procedure known to all biochemists and molecular biolo- gists; therefore, we do not describe it in detail here. However, all the recipes for preparing buffers and setting up gels according to the original protocols (33) can be found on the Jonathan King lab Web site, http://web.mit.edu/king-lab/ www/cookbook/cookbook.htm. 2.5. Crystallogenesis For crystallization of proteins in general, several aspects are important. First, reagents should be crystallization grade if available or otherwise of the high- est purity that can be obtained. The experiments should be set up using glass- ware or high-quality plastics resistant to common organic solvents and clear enough for convenient visualization of the experiments afterward. Provision of a reliable fixed-temperature room or fixed-temperature incubators free of excessive vibrations is necessary for storing the potentially long-term crystal- lization experiments. Finally, a stereomicroscope is needed for observation of the crystallization trials, if possible with magnification greater than 50-fold to observe microcrystals and to judge if precipitates appear crystalline. A camera for recording crystallization results is also useful. Crystallization plates can be obtained from many sources. First, tissue culture plates are available from general laboratory suppliers; these plates (e.g., Linbro plates and Terasaki plates) can be adapted for crystallization use. Plates developed and marketed especially for crystallization purposes are also available and, although somewhat more expensive, can be recom- mended for their ease of use. Our favorites are ready-to-use sitting-drop vapor diffusion plates, for example, CrysChem plates (Hampton Research, Aliso Viejo, CA, http://www.hamptonresearch.com/) and CompactClover plates (Jena Bioscience, Jena, Germany, http://www.jenabioscience.com/); these are to be covered with extraclear tape and should be resistant to organic solvent if these are used in the crystallization screen. There are several worldwide suppliers of crystallization reagents, ready-made crystallization screens, crystallization plates, and other materials useful for protein crystallography. Hampton Research was the first company on the market and still has a lead- ing position. More recently, companies like Molecular Dimensions (Apopka, FL, http://www.moleculardimensions.com/) and Jena Bioscience have come onto the market, also providing a full catalogue of crystallization reagents and consumables. These companies often also supply material for data collec- tion, such as goniometer heads, adaptors, capillaries, and loops for mounting crystals.
- 36. 20 Papanikolopoulou, van Raaij, and Mitraki 3. Methods 3.1. Cloning 1. One critical parameter for successful amplification in a PCR is the correct design of oligonucleotide primers. While constructing chimeric proteins, the aim of primer design is not only to obtain a balance between specificity and efficiency of amplification but also to ensure structural compatibility of the joining parts. If crystal structures are available, their inspection is necessary to provide guidelines for the incorporation or not of appropriate linker sequences. In the case study described here, it was estimated that the joining of the shaft domain residues 319–392 and the fibritin foldon domain residues 457–483 should not introduce structural conflicts because the three Gly392 residues of the fiber shaft lie on a triangle with sides of 13.5 Å and the three Gly457 residues of the foldon domain lie on a triangle with sides of 12.5 Å. In most of the known triple-stranded folds from viruses, hinges exist between globular and fibrous parts (9). If the fold is unknown, hinges can still be predicted from inspection of sequences, breaking of sequence repeat patterns, and so on. When constructing a chimeric protein between fibrous parts of unknown fold and the foldon domain, incorporating the hinge sequences as linker sequences between the two parts is a good initial strat- egy for avoiding structural conflicts. 2. The fragment coding for the foldon domain, spanning residues Gly457 to Leu483 of fibritin can be obtained by PCR using the bacteriophage T4 genomic DNA as a template. The forward primer I is designed to contain the BamHI restriction site that results in the addition of two residues, Gly and Ser at the N-ter of the foldon (Table 1). The reverse primer II contains the ClaI site for cloning into the expres- sion vector PT7.7. For the construction of the chimeras that comprise the foldon domain in replacement of the natural head domain, fiber shaft fragments starting from Val319 can be joined to the N-ter of the foldon by incorporating or not the 6-aa linker of the fiber protein (Asn-Lys-Asn-Asp-Asp-Lys, residues 393–398) Table 1 Primers Used in Constructing Foldon-Adenovirus Shaft Chimeras N° SEQUENCE (5′→3′) Restriction site I CAAGCTCTCCAAGGATCCGGTTATATT BamHI II CTTGCGGCCCCATCGATTGCTGGTTATAAAAAGGTAGA ClaI III GAAGGAGATATACATATGGTTAGCATAAAAA NdeI IV GGTAAGTTTGTCATCATTGGATCCTCCTATTGTAAT BamHI V TTGTCCACAGGGATCCTTTGTCATCATTTTTGT BamHI VI CAAGCTCTCCAACATATGGGTTATATTCCTGAA NdeI VII CTTGCGGCCCCATGTTATGCGGATCCTAAAAAGGTAGA BamHI VIII CAAACAATACTAAAGGATCCGGAGTTAGCATAAAAA BamHI IX CAGGGTAAGTTTGTCATCGATTTTTTATCCTATTGTAA ClaI
- 37. Fibritin Domain for Engineering b-Structured Nanorods 21 that connects the globular head to the shaft (Fig. 1). The DNA fragments are amplified between primers III–IV and III–V subsequently from the complemen- tary DNA of the protein containing the original stable fragment (Val319–Glu582) cloned in the pT7.7 vector. 3. For adenoviruses, as for most of the triple-stranded fibers from viruses, the globu- lar trimerization domains are located at their C-termini (34). Therefore, the most natural design is to place the foldon at the C-terminus of the chimeric proteins. In the framework of the original study, the authors created also a construct that connects the foldon domain to the N-terminal end of the shaft segment (Fig. 1). Although the resulting proteins fail to fold into SDS-resistant trimers, the con- struction strategy is also mentioned. For this construct, the gene encoding the foldon (Gly457–Leu483) is amplified between primers VI and VII and the shaft segment, spanning residues Val319–Glu582, is amplified between primer VIII and primer IX (containing stop codon taa). The generation of the BamHI site results in the introduction of three residues, Gly-Ser-Gly, between the two segments. 4. Set up the PCR reactions according to the product instructions provided with the polymerase. Place tubes into the preheated thermal cycler and perform each amplification for 30 cycles according to the following schedule: 30-s denaturation at 95°C, 30-s annealing at 60°C, and 45-s extension at 72°C. 5. Purify the PCR reactions by preparative gel electrophoresis on a 4% Nusieve GTG agarose gel, cut the bands of interest with a sharp blade, and extract the amplified DNA fragments using the QIAquick Gel Extraction kit. 6. Digest 1µg of the purified bands and pT7.7 vector with the corresponding restric- tion enzymes for 1h 30min at 37°C and purify the DNA using the QIAquick Gel Extraction kit. 7. Set up 20-µL ligation reactions according to the instructions of the Roche Rapid DNA Ligation Kit. Start with 35–50ng of vector while the insert to vector ratio is kept at 3:1. 8. Aliquot 100µL of competent DH5α cells into an Eppendorf tube and add 4µL of the ligation mixture. Swirl the contents of the tube gently and incubate on ice for 30min. Heat pulse each transformation reaction in a 42°C water bath for 2min. Add 900µL of LB medium to each tube and incubate at 37°C for 1h with shak- ing at 220rpm. Centrifuge for 3min at 1300g discard 800µL, and resuspend the pelleted cells in the remaining 200µL. Use a sterile spreader to plate 200µL of the transformed bacteria onto LB agar plates that contain ampicillin (100µg/mL). Colonies will appear following overnight incubation at 37°C. 9. Culture single colonies overnight in 5mL LB medium supplemented with ampi- cillin (100µg/mL). Harvest cells and isolate the plasmid DNA using the Plasmid Miniprep Kit. Positive clones are identified by restriction enzyme digestion. 3.2. Protein Expression 1. Pick a single colony from a freshly streaked plate, inoculate 10mL LB supple- mented with ampicillin (100µg/mL), and grow overnight with shaking at 37°C. 2. Inoculate 1 L of LB medium containing sorbitol (330 mM), betaine hydrochlo- ride (2.5 mM), and ampicillin (100 µg/mL) with 10 mL of an overnight culture and grow at 37°C until the OD600 reaches 0.4. Cool culture to 22°C.
- 38. 22 Papanikolopoulou, van Raaij, and Mitraki Fig. 1. (A) Schematic representation of the domain structure of the chimeric proteins: (1) the stable adenovirus fiber fragment (fiber residues 319–582). Residues belonging to the shaft domain (V319 to G392) are symbolized with a rectangle, and residues belonging to the globu- lar head (L399–E582) are symbolized with a circle. Residues 393–398 (NKNDDK) form the linkerthatconnectsthefibrousandglobularpartsandaredrawninitalics.(2)Thechimericpro- teinthatcomprisesthefibritinfoldondomain(fibritinresiduesG457toL483,ovalshape)fused to the C-terminus of the shaft domain with use of the natural linker between the two domains. For the sake of clarity, the numbers corresponding to the fibritin residues are underlined. The residues GS, highlighted in bold, are not part of the coding sequence and are introduced as a result of the cloning strategy. (3) The chimeric protein with the foldon domain appended at the C-terminal end of the shaft domain without the use of the natural linker sequence. (4) The chimeric protein with the foldon domain appended at the N-terminal end of the shaft domain. The residues GSG, highlighted in bold, do not belong to the coding sequence and are introduced as a result of the cloning strategy. (B) Amino acid sequences of the fiber shaft residues 319–392 and of the fibritin foldon residues 457–483. The fiber shaft sequence repeat numbers (repeats 18–22 according to 29) are indicated to the left. The repeats are not aligned. (From ref. 30 with permission.)
- 39. Fibritin Domain for Engineering b-Structured Nanorods 23 3. When the temperature of the culture reaches 22°C, add IPTG to 0.5 mM final concentration to induce protein expression. Continue the incubation for 14 h at 22°C. 4. Harvest the bacterial cells by centrifugation at 14,000g at 4°C for 10min and pour off the supernatant. 5. Add approximately 20mL of lysis buffer (50mM Tris-HCl pH 8.0, 2mM EDTA, 20mM NaCl) containing a tablet of Roche Complete protease inhibitors. 6. After cell lysis using a French press, remove cell debris by centrifugation at 43,000g at 4°C for 20min. 7. Recuperate the supernatant and add streptomycin sulfate (Sigma) to a final con- centration of 1% (w/v). Stir the suspension for a further 15min in the cold room to remove the viscous nucleic acid. Centrifuge for 15min at 19,000rpm and 4°C and discard the pellet. 3.3. Protein Purification (see Note 1) 1. Measure the volume of the supernatant after streptomycin sulfate treatment and pour it into a glass beaker. 2. Weigh 0.361g of solid ammonium sulfate for every 1mL of protein solution to reach a final concentration of 60% saturation. 3. Place the beaker on ice and stir with a magnetic stirrer. Add the ammonium sulfate to the protein solution slowly and in small batches. 4. After addition is complete, incubate for 15min on ice and then remove the precipi- tated protein by centrifugation at 43,000g at 4°C for 20min. 5. Decant off the supernatant into a measuring cylinder and determine the total volume. 6. Add 0.129g of solid ammonium sulfate per milliliter of protein solution to take the concentration from 60% to 80% saturation as described above. 7. After centrifugation, discard supernatant and dissolve the protein precipitate in 1mL of 10mM Tris-HCl buffer pH 8.5, 1mM EDTA. 8. Transfer the protein suspension into a dialysis bag and dialyze against 10mM Tris-HCl buffer pH 8.5, 1mM EDTA, overnight in the cold room. 9. The next day, equilibrate the Resource Q column with 10mM Tris-HCl buffer pH 8.5, 1mM EDTA (buffer A) at a flow rate of 3mL/min. Load the sample onto the column and elute the protein with a gradient of 0–200mM NaCl (buffer B). 10. Pool the fractions containing the protein, bring them to 1.7M ammonium sulfate, and dialyze against a phosphate buffer (25mM Na2HPO4, 25mM NaH2PO4, 1mM EDTA, 1.7M ammonium sulfate, pH 6.5) overnight in the cold room. 11. Apply the sample to a Pharmacia phenyl superose 5/5 column equilibrated with buffer 1 (25mM Na2HPO4, 25mM NaH2PO4, 1mM EDTA, 1.7M ammonium sulfate, pH 6.5). Elute with a linear gradient of 1.7–0.0M ammonium sulfate (buffer 2). 12. The chimeric protein elutes at about 1.5M ammonium sulfate. Collect the fraction and precipitate the purified protein by adding ammonium sulfate to 80% satura- tion. Store the precipitated protein at 4°C.
- 40. 24 Papanikolopoulou, van Raaij, and Mitraki 3.4. Characterization of Chimeric Proteins With Denaturing and Nondenaturing SDS-PAGE A hallmark of well-folded, trimeric β-structured fibers is their SDS resistance. In the standard Laemmli SDS buffer, which contains 2% final SDS, all or most of these fibers are stable at 4°C. For the trimers to be completely dissociated, boiling for 3min in sample buffer is recommended. This SDS resistance is a precious biochemical tool that allows easy assessment of native, trimeric states of proteins from nonnative and even intermediate states. In standard SDS gels, trimers do not bind SDS efficiently and migrate slowly in the gel; the denatured, misfolded, or aggregated forms are completely dissociated by SDS and migrate in the monomer position. Since this methodology can be applied to cell lysates, it allows rapid screening of various chimeric constructs before purification and selects the ones that fold successfully into trimers for further purification and characterization. The following procedure is recommended: 1. Mix the lysate or protein solution with Laemmli SDS sample buffer and split in two tubes. 2. Place one tube on ice. 3. Place the second tube in a heating block for 3min at 100°C, then put the tube on ice and let it cool. 4. Run the two samples in adjacent wells in the SDS gel and compare the running positions. If the nonboiled band migrates with an apparent mass compatible with a trimer that chases to the monomer band after boiling, it is a good indication that the chimeric protein folds into a trimer (Fig. 2). It is very important for the gel to be refrigerated since it has been observed that above room temperature partial unfolding of native trimers can occur, leading to “open” forms that migrate slower than the native trimer (12). If the SDS gel is not refrigerated, partial unfolding induced by the combination of SDS and temperature may occur in situ and lead to formation of slower migrating bands. 3.5. Crystallization For crystallization, several aspects of the protein preparation have to be con- sidered. A high degree of purity (better than 99%) is important, although preliminary experiments with somewhat less-pure preparation can give some useful initial information about solubility and in some cases even yield crystals. As important as “chemical” purity is conformational homogeneity or, in other words, absence of flexibility. At this point appropriate design of the expression vector comes into play, as does the presence of a not too flexible linker between the fused domains. If purification aids such as histidine tags are to be introduced,
- 41. Fibritin Domain for Engineering b-Structured Nanorods 25 it is preferable to include a protease cleavage site between the tags and the protein to be crystallized as the purification tags lead to undesirable flexibility. Having said that, there are examples of successful crystallization of proteins including these purification tags, especially if these are relatively small. The fibrous fusion proteins discussed here are in general not expected to be air sensitive, so vapor diffusion is the method of choice. Sitting-drop vapor diffusion can be recommended for ease of setup, visualization, and crystal harvesting. These can be sealed with extra-clear tape, which permits opening individual wells by carefully removing the tape only from that well and reseal- ing with a piece of the same tape. If the proteins are found or expected to be oxidation sensitive, vapor diffusion experiments can be set up under a nitrogen atmosphere, or more easily, microbatch experiments can be performed. In microbatch experiments, protein solution is directly mixed with precipitant solution and incubated under a layer of mineral oil, allowing for slow evapora- tion of aqueous solvent through the oil layer. A percentage of silicon oil can be mixed with the mineral oil if faster evaporation is desired. Fig. 2. Expression of the chimeric proteins with the foldon domain at their C-terminus. After a pellet supernatant fractionation of Escherichia coli lysates, supernatants were electrophoresed on a 12.5% sodium dodecyl sulfate (SDS) polyacrylamide gel and visualized with Coomassie blue staining. Electrophoresis was carried at 4°C. The + symbol indicates boiling in loading buffer containing 2% SDS for 3min prior to loading in the gel. Lane 7, lysate of noninduced bacteria. Lanes 1 and 2, supernatants of lysates of the original fiber stable fragment, nonboiled and boiled, respectively, are shown to allow comparison with the chimeric proteins. The trimer (lane 1) and monomer (lane 2) positions are marked with brackets. Lanes 3 and 4, chimeric protein with linker, nonboiled and boiled, respectively. Lanes 5 and 6, chimeric protein without the linker, nonboiled and boiled, respectively. The trimer and monomer positions for the chimeric proteins are marked with arrows. Lane M, molecular mass markers. (From ref. 30 with permission.)
- 42. 26 Papanikolopoulou, van Raaij, and Mitraki Increasingly, crystallization robots are available locally, especially if small- volume drops can be set up; these can significantly expedite the crystallization process, eliminating a lot of tedious manipulations. There are robots specialized in sitting-drop vapor diffusion or microbatch experiments, but multipurpose ones are also available. It is generally not worth investing in a crystallization robot for a limited number of projects as the time invested in setup and maintenance of the robot is only amortized when it is used regularly and for many experiments. A typical initial screen would consist of a 96-well plate with 96 very dif- ferent conditions (35) and, if possible, several plates incubated at different temperatures (e.g., 20°C and 5°C). If hits are obtained, crystals are measured to confirm that they are protein, not salt or another small-molecule additive, and to assess their diffraction limit and quality. However, in many cases, no crystals are obtained in the first screen. If crystalline precipitates are obtained, further screens are performed around these conditions to see if crystals can be obtained. At the same time, it is worth carefully examining the cloning strategy and the expression and purification procedure to see if improvements in protein purity and conformational homogeneity can be obtained. In addition to these initial more-or-less random screens (and if enough material is available), it is worth screening common precipitants like ammonium sulfate and polyethylene glycol 6000 at different concentrations, pH, and temperatures. Crystallization trials should be regularly examined, with the results noted in a notebook or spreadsheet system and photographically documented if possible. A suitable regime would be a quick examination straight after setup, then more extensive ones after a day, after 3d, after a week, after 2wk, after a month, and so forth until suitable crystals have been obtained or the drops have dried. For more complete information on protein crystallization, several textbooks are available (36–38); a special issue of the Journal of Structural Biology about protein crystallization methods is also very useful (39). 3.6. Structure Determination 3.6.1. Choice of Method Structure solution by crystallography is in principle feasible for molecules of almost any size if, of course, crystals can be obtained. If the protein is not too large, structure solution by nuclear magnetic resonance (NMR) spectroscopic methods may be considered (40). This has the major advantage of not having to crystallize the protein, although depending on the protein size different labeling techniques will be necessary. For up to around 30kDa (trimeric size), labeling with carbon-13 and nitrogen-15 is likely to be sufficient, while with additional deuterium labeling structures of size up to 50–60kDa may be tractable. Given the trimeric foldon size of just over 9kDa, this would permit solving unknown trimeric nanorod structures of just over 20 or 40–50kDa, respectively (7 or
- 43. Fibritin Domain for Engineering b-Structured Nanorods 27 13–17kDa per monomer, respectively). Introduction of a protease cleavage site between the fibrous and foldon domains would allow removal of the foldon domain and the study of the fibrous domain on its own, allowing structure solution of trimeric nanorods of up to 30 and 50–60kDa trimeric size by NMR spectroscopic methods. 3.6.2. Data Collection The first step of data collection is the recovery of crystals from the crystalliza- tion setup. As protein crystals are generally fragile, they will either have to be carefully transferred to a quartz capillary and mounted in conditions in which the crystal will not dry up or attract moisture from the surrounding atmosphere and dissolve. They can be picked up with a nylon or plastic microloop slightly larger than the crystal. If the loop is then covered with a plastic hood filled with a drop of mother liquor, data collection can proceed at room temperature. To prolong crystal life, a crystal can also be briefly incubated in a suitable cryoprotectant; in this case, they can either be flash frozen at 100K or frozen in liquid nitrogen (41). If data collection is then performed at 90–120K, significant increase in crystal lifetime can be obtained (radiation damage decreases at lower temperature; 42). Depending on the space group of the crystals obtained and the structure solu- tion method that is to be used, somewhat different data collection procedures will need to be employed. In all cases, complete datasets are necessary and, if the anomalous signal is to be exploited, high multiplicity. For high-symmetry space groups, a relatively small fraction of reciprocal space needs to be explored, while for lower-symmetry space groups, a larger fraction of reciprocal space will need to be covered (i.e., more images per dataset will have to be collected). For structure solution by molecular replacement or isomorphous replacement methods (see Subheading 3.6.3.), high multiplicity is not a necessity, while for anomalous dispersion methods it is. High-multiplicity datasets will require longer data collection times; at the same time, radiation damage will have to be avoided. Therefore, to allow successful structure solution, at times resolution will have to be sacrificed for data completeness or multiplicity. 3.6.3. Structure Solution Given that the foldon structure is known, structure solution by a molecular replacement technique (43) will be possible if the foldon is a significant frac- tion of the total protein, say 25–30%. If molecular replacement is not success- ful, heavy atom derivatives will have to be produced for structure solution by multiple isomorphous replacement (MIR), single isomorphous replacement using anomalous signal (SIRAS), multiwavelength anomalous dispersion (MAD; 44), or single-wavelength anomalous dispersion (SAD; 45). Common
- 44. 28 Papanikolopoulou, van Raaij, and Mitraki derivatives are mercury compounds, which bind to cysteine residues and are especially useful for MIR or SIR(AS), or seleno-methionine derivatives, espe- cially useful for the MAD method (46). Heavy atoms are generally introduced into preformed protein crystals by soaking techniques (47), although cocrystallization is also a possibility. Seleno- methionine can be introduced into proteins instead of methionine by growing methionine-auxotroph bacteria in expression cultures in the presence of seleno- methionine (48) or by inhibition of the methionine synthesis pathway and provision of the necessary amino acids and seleno-methionine in expression cultures (49). If no cysteines or methionines are present in the natural sequence, these can be introduced by site-directed mutagenesis. A discussion and expla- nation of macromolecular phasing methods is available in ref. 50 and in several textbooks and compilations (51–56). 3.6.4. Model Building, Refinement, Validation, and Analysis Once interpretable electron density maps have been obtained, a model for the protein will have to be built either “by hand” using molecular graphics pro- grams or, if the map is of sufficient quality (resolution better than 2.3 Å), in combination with automated building procedures like Arp-Warp (57). Once a complete protein model, including ordered solvent molecules, has been built, the structure should be refined using appropriate geometric restraints and the best-available dataset with respect to completeness and resolution. Refmac is the program of choice for refinement as it uses maximum likelihood targets (58). Validation of the structure is always necessary as important errors in model building and refinement may have gone unnoticed. Molprobity is the software of choice for this purpose (59). Validation judges parameters used in refinement such as bond distances and angles, planarity of aromatic groups, and parameters not used in refinement such as whether all amino acids are in suitable environments respective to their nature (polar, apolar, charged), whether the Ramachandran plot of the structure looks reasonable, and so on. Once the structure has been solved, and preferably refined to completion, the structure will have to be analyzed, first judging whether a new fibrous fold has been discovered or whether the structure is similar to other known structures. The program DALI can perform similarity searches against the protein structure data- base automatically (60). Further analysis will concern the biological interest of the structure. In the case of viral fibers, examine whether the structure may contain regions implicated in receptor binding or interaction with other biomolecules. The structure is also likely to be of interest for materials science, and inspec- tion may reveal the presence of surface loops that may be modified without affecting the structure. These modified surface loops may then be used to bind small molecules or other proteins to function as sensors, metals in an attempt
- 45. Fibritin Domain for Engineering b-Structured Nanorods 29 to make the fibers conductive, and the like. As many biological fibers contain sequence repeats, inspection of the structure will also likely reveal the start and end of the structural repeat, which is important for design of longer fibers made up of repeating sequences. 3.6.5. Verification and Application of the Foldon Fusion Strategy for Structure Solution of Trimeric Fibrous Domains Papanikolopoulou et al. (31) have shown that the C-terminal four adenovirus type 2 fiber shaft repeats have the same structure when fused to a C-terminal foldon domain (Fig. 3A) as the native fold (29), showing that the foldon fusion strategy is viable and valid for solving crystal structures of unknown fibrous Fig. 3. Crystal structures of foldon fusion proteins. (A) Fusion construct consisting of human adenovirus type 2 fiber shaft residues 319–392 (bottom), a Gly-Ser linker, and bacteriophage T4 fibritin residues 457–483 (top). Note the partially disordered linker (31). (B) Structure of “minifibritin,” a fusion construct consisting the N-terminal domain of the bacteriophage T4 fibritin with the C-terminal foldon (61). (C) Fusion construct consisting of synthetic collagen sequence (GPP) repeats and the foldon domain (top). Note the pronounced angle between the two domains, caused by the stagger of the collagen triple helix (27). These figures were prepared using the deposited coordinates (pdb-codes 1V1H, 1OX3, and 1NAY, respectively) and the Pymol program (62).
- 46. 30 Papanikolopoulou, van Raaij, and Mitraki domains. Also, it showed that a flexible linker between the two domains is not necessarily an obstacle to crystallization and structure solution. With regard to applications, the foldon fusion strategy has been used to solve the structure of the N-terminal domain of the bacteriophage fibritin itself (Fig. 3B; 61), a structure that could not be solved before due to flexibility of the intermediate domains. A third example is the structure of a collagen model peptide, a Gly-Pro-Pro repeat- ing sequence, in which the staggered collagen triple helix leads to a rather sharp angle between the collagen and foldon domains (Fig. 3C; 27). However, this was not an insurmountable problem for crystallization and structure solution. What to our knowledge has not been tried with success is incorporating a protease site between the trimeric fibrous protein domain and the foldon domain, so that after correct trimerization and partial purification, the foldon domain can be removed and the fibrous domain further purified and crystallized. 4. Note 1. This purification protocol was developed for the case study of the chimeric protein described here. It will be necessary to develop an adapted protocol for each case of chimeric protein studied. References 1. Beck K, Brodsky B. (1998) Supercoiled protein motifs: the collagen triple-helix and the alpha-helical coiled coil. J. Struct. Biol. 122, 17–29. 2. Geddes AJ, Parker KD, Atkins ED, Beighton E. (1968) “Cross-beta” conforma- tion in proteins. J. Mol. Biol. 32, 343–358. 3. Mitraki A, Miller S, van Raaij MJ. (2002) Review: conformation and folding of novel beta-structural elements in viral fiber proteins: the triple beta-spiral and triple beta-helix. J. Struct. Biol. 137, 236–247. 4. Pauling L, Corey RB. (1951) The pleated sheet, a new layer configuration of polypeptide chains. Proc. Natl. Acad. Sci. U. S. A. 37, 251–256. 5. Steinbacher S, Seckler R, Miller S, Steipe B, Huber R, Reinemer P. (1994) Crystal structure of P22 tailspike protein: interdigitated subunits in a thermostable trimer. Science 265, 383–386. 6. Gazit E. (2007) Use of biomolecular templates for the fabrication of metal nanowires. FEBS J. 274, 317–322. 7. Rajagopal K, Schneider JP. (2004) Self-assembling peptides and proteins for nanotechnological applications. Curr. Opin. Struct. Biol. 14, 480–486. 8. Woolfson DN, Ryadnov MG. (2006). Peptide-based fibrous biomaterials: some things old, new and borrowed. Curr. Opin. Chem. Biol. 10, 559–567. 9. Mitraki A, Papanikolopoulou K, Van Raaij MJ. (2006) Natural triple beta-stranded fibrous folds. Adv. Protein Chem. 73, 97–124. 10. Hong JS, Engler JA. (1996) Domains required for assembly of adenovirus type 2 fiber trimers. J. Virol. 70, 7071–7078.
- 47. Fibritin Domain for Engineering b-Structured Nanorods 31 11. Novelli A, Boulanger PA. (1991) Deletion analysis of functional domains in baculovirus-expressed adenovirus type 2 fiber. Virology 185, 365–376. 12. Mitraki A, Barge A, Chroboczek J, Andrieu JP, Gagnon J, Ruigrok RW. (1999) Unfolding studies of human adenovirus type 2 fibre trimers. Evidence for a stable domain. Eur. J. Biochem. 264, 599–606. 13. Papanikolopoulou K, Schoehn G, Forge V, et al. (2005) Amyloid fibril formation from sequences of a natural beta-structured fibrous protein, the adenovirus fiber. J. Biol. Chem. 280, 2481–2490. 14. Reches M, Gazit E. (2003) Casting metal nanowires within discrete self-assembled peptide nanotubes. Science 300, 625–627. 15. van Raaij MJ, Mitraki A. (2004) Beta-structured viral fibres: assembly, structure and implications for materials design. Curr. Opin. Solid State Mater. Sci. 8, 151–156. 16. Yemini M, Reches M, Rishpon J, Gazit E. (2005) Novel electrochemical biosens- ing platform using self-assembled peptide nanotubes. Nano. Lett. 5, 183–186. 17. Bewley MC, Springer K, Zhang YB, Freimuth P, Flanagan JM. (1999) Structural analysis of the mechanism of adenovirus binding to its human cellular receptor, CAR. Science 286, 1579–1583. 18. Burmeister WP, Guilligay D, Cusack S, Wadell G, Arnberg N. (2004) Crystal structure of species D adenovirus fiber knobs and their sialic acid binding sites. J. Virol. 78, 7727–7736. 19. Krasnykh V, Belousova N, Korokhov N, Mikheeva G, Curiel DT. (2001) Genetic targeting of an adenovirus vector via replacement of the fiber protein with the phage T4 fibritin. J. Virol. 75, 4176–4183. 20. Glasgow JN, Everts M, Curiel DT. (2006) Transductional targeting of adenovirus vectors for gene therapy. Cancer Gene Ther. 13, 830–844. 21. Nicklin SA, Wu E, Nemerow GR, Baker AH. (2005) The influence of adenovirus fiber structure and function on vector development for gene therapy. Mol. Ther. 12, 384–393. 22. Noureddini SC, Curiel DT. (2005) Genetic targeting strategies for adenovirus. Mol. Pharm. 2, 341–347. 23. Tao Y, Strelkov SV, Mesyanzhinov VV, Rossmann MG. (1997) Structure of bacteriophage T4 fibritin: a segmented coiled coil and the role of the C-terminal domain. Structure 5, 789–798. 24. Frank S, Kammerer RA, Mechling D, et al. (2001) Stabilization of short collagen- like triple helices by protein engineering. J. Mol. Biol. 308, 1081–1089. 25. Letarov AV, Londer YY, Boudko SP, Mesyanzhinov VV. (1999) The carboxy- terminal domain initiates trimerization of bacteriophage T4 fibritin. Biochemistry (Mosc.) 64, 817–823. 26. Miroshnikov KA, Marusich EI, Cerritelli ME, et al. (1998) Engineering trimeric fibrous proteins based on bacteriophage T4 adhesins. Protein Eng. 11, 329–332. 27. Stetefeld J, Frank S, Jenny M, et al. (2003) Collagen stabilization at atomic level. Crystal structure of designed (GlyProPro)(10)foldon. Structure (Camb.) 11, 339–346. 28. Yang X, Lee J, Mahony EM, Kwong PD, Wyatt R, Sodroski J. (2002) Highly stable trimers formed by human immunodeficiency virus type 1 envelope
- 48. 32 Papanikolopoulou, van Raaij, and Mitraki glycoproteins fused with the trimeric motif of T4 bacteriophage fibritin. J. Virol. 76, 4634–4642. 29. van Raaij MJ, Mitraki A, Lavigne G, Cusack S. (1999) A triple beta-spiral in the adenovirus fibre shaft reveals a new structural motif for a fibrous protein. Nature 401, 935–938. 30. Papanikolopoulou K, Forge V, Goeltz P, Mitraki A. (2004) Formation of highly stable chimeric trimers by fusion of an adenovirus fiber shaft fragment with the foldon domain of bacteriophage t4 fibritin. J. Biol. Chem. 279, 8991–8998. 31. Papanikolopoulou K, Teixeira S, Belrhali H, Forsyth VT, Mitraki A, van Raaij MJ. (2004) Adenovirus fibre shaft sequences fold into the native triple beta-spiral fold when N-terminally fused to the bacteriophage T4 fibritin foldon trimerisa- tion motif. J. Mol. Biol. 342, 219–227. 32. Tabor S. (1990) Expression using the T7 RNA polymerase/promoter system. In: Ausubel FA, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, and Struhl K, eds. Current Protocols in Molecular Biology. New York: Greene and Wiley-Interscience. 33. King J, Laemmli UK. (1971) Polypeptides of the tail fibres of bacteriophage T4. J. Mol. Biol. 62, 465–477. 34. Schwarzer D, Stummeyer K, Gerardy-Schahn R, Muhlenhoff M. (2007) Characterization of a novel intramolecular chaperone domain conserved in endo- sialidases and other bacteriophage tail spike and fiber proteins. J. Biol. Chem. 282, 2821–2831. 35. Jancarik J, Kim SH. (1991) Sparse matrix sampling: a screening method for crys- tallization of proteins. J. Appl. Cryst. 24, 409–411. 36. Bergfors T. (1999) Protein Crystallization Techniques. International University Line, La Jolla, CA. 37. McPherson A. (1989) Preparation and Analysis of Protein. Crystals. Krieger, Malabar, FL. 38. McPherson A. (2004) Introduction to protein crystallization. Methods 34, 254–265. 39. McPherson A. (2003) Macromolecular crystallization in the structural genomics era. J. Struct. Biol. 142, 1–2. 40. Foster MP, McElroy CA, Amero CD. (2007) Solution NMR of large molecules and assemblies. Biochemistry 46, 331–340. 41. Hope H. (1990) Crystallography of biological macromolecules at ultra-low temperature. Annu. Rev. Biophys. Biophys. Chem. 19, 107–126. 42. Massover WH. (2007) Radiation damage to protein specimens from electron beam imaging and diffraction: a mini-review of anti-damage approaches, with special reference to synchrotron X-ray crystallography. J. Synchrotron Radiat. 14, 116–127. 43. Rossmann MG. (2001) Molecular replacement–historical background. Acta Crystallogr. 57, 1360–1366. 44. Ealick SE. (200) Advances in multiple wavelength anomalous diffraction crystal- lography. Curr. Opin. Chem. Biol. 4, 495–499. 45. Dodson E. (2003) Is it jolly SAD? Acta Crystallogr. 59, 1958–1965.
- 49. Fibritin Domain for Engineering b-Structured Nanorods 33 46. Hendrickson W. (1999) Maturation of MAD phasing for the determination of macromolecular structures. J. Synchrotron Radiat. 6, 845–851. 47. Garman E, Murray JW. (2003) Heavy-atom derivatization. Acta Crystallogr. 59, 1903–1913. 48. Hendrickson WA, Horton JR, LeMaster DM. (1990) Selenomethionyl proteins produced for analysis by multiwavelength anomalous diffraction (MAD): a vehicle for direct determination of three-dimensional structure. EMBO J. 9, 1665–1672. 49. Doublie S, Carter C. (1992) Preparation of Selenomethionyl Protein Crystals. Oxford University Press, New York. 50. Taylor G. (2003) The phase problem. Acta Crystallogr. 59, 1881–1890. 51. Blow D. (2002) Outline of Crystallography for Biologists. Oxford University Press, New York. 52. Carter C. (2003) Methods in Enzymology Parts C and D. Elsevier, New York. 53. Drenth J. (1999) Principles of Protein X-ray Crystallography. Springer-Verlag, New York. 54. McPherson A. (2002) Introduction to Macromolecular Crystallography. Wiley, New York. 55. McRee D. (1999) Practical Protein Crystallography. Academic Press, New York. 56. Rhodes G. (1993) Crystallography Made Crystal Clear. Academic Press, New York. 57. Morris RJ, Perrakis A, Lamzin VS. (2003) ARP/wARP and automatic interpreta- tion of protein electron density maps. Methods Enzymol. 374, 229–244. 58. Murshudov GN, Vagin AA, Dodson EJ. (1997) Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr. 53, 240–255. 59. Lovell SC, Davis IW, Arendall WB 3rd, et al. (2003) Structure validation by C-alpha geometry: phi,psi and Cbeta deviation. Proteins 50, 437–450. 60. Holm L, Sander C. (1999) Protein folds and families: sequence and structure alignments. Nucleic Acids Res. 27, 244–247. 61. Boudko SP, Strelkov SV, Engel J, Stetefeld J. (2004) Design and crystal structure of bacteriophage T4 fibritin NCCF. J. Mol. Biol. 339, 927–935. 62. DeLano WL. (2002) The PyMOL Molecular Graphics System. DeLano Scientific, San Carlos, CA. Available at: http://www.pymol.org.
- 50. 3 The Leucine Zipper as a Building Block for Self-Assembled Protein Fibers Maxim G. Ryadnov, David Papapostolou, and Derek N. Woolfson Summary Nanostructured materials are receiving increased attention from both academia and industry. For example, the fundamental understanding of fiber formation by peptides and proteins both is of interest in itself and may lead to a range of applications. A key idea here is that the folding and subsequent supramolecular assembly of the monomers can be programmed within polypeptide chains. Thus, with an understanding of so-called sequence-to-structure relationships for these peptide assemblies, it may be possible to design novel nanostructures from the bottom up that exhibit properties determined by, but not characteristic of, their component building blocks. In this respect, the α-helical leucine zipper presents an excellent place to start in the rational design of ordered nanostructures that span several length scales. Indeed, such systems have been put forward and developed to different degrees. Despite their apparent diversity, they employ similar assembly routes that can be compiled into one basic methodology. This chapter gives examples and provides methods of what can be achieved through leucine zipper-based assembly of fibrous structures. Key Words: Fibers; α-helical leucine zipper; hierarchical self-assembly; nanostructures; peptide design; supramolecular chemistry. 1. Introduction Fundamental studies in designing novel nanostructures, such as protein fibers, advance our understanding of protein folding, assembly, and chemistry. Potential applications in this area include the fabrication of scaffolds for cell growth in culture and templates for the controlled and directed assembly of inorganic materials (1). Peptide-based fibers and matrices can be, and indeed have been, assembled from a variety of protein-folding motifs as well as from artificial peptide amphiphiles (2). The underpinning concept here is that rules and guides for assembly processes are programmed into such motifs, and that 35 From: Methods in Molecular Biology, vol. 474: Nanostructure Design: Methods and Protocols Edited by: E. Gazit and R. Nussinov © Humana Press, Totowa, NJ
- 51. Another Random Scribd Document with Unrelated Content
- 52. VIEW OF LLANGOLLEN "'I was,' said Kynon, 'the only son of my mother and father, and I was exceedingly aspiring, and my daring was very great. I thought there was no enterprise in the world too mighty for me, and after I had achieved all the adventures that were in my own country, I equipped myself and set forth through deserts and distant regions. And at length it chanced that I came to the fairest valley in the world, wherein were trees of equal growth; and a river ran through the valley, and a path was by the side of the river. And I followed the path until mid-day, and continued my journey along the remainder of the valley until the evening; and at the extremity of an plai I came to a large and lustrous castle, at the foot of which was a torrent. And I approached the castle, and there I beheld two youths with yellow curling hair, each with a frontlet of gold upon his head, and clad in a garment of yellow satin, and they had gold clasps upon
- 53. their insteps. In the hand of each of them was an ivory bow, strung with the sinews of the stag; and their arrows had shafts of the bone of the whale, and were winged with peacock's feathers; the shafts also had golden heads. And they had daggers with blades of gold, and with hilts of the bone of the whale. And they were shooting their daggers. A LONELY SHORE NEAR PENRHYN DEUDRAETH "'And a little way from them I saw a man in the prime of life, with his beard newly shorn, clad in a robe and a mantle of yellow satin; and round the top of his mantle was a band of gold lace. On his feet were shoes of variegated leather, fastened by two bosses of gold. When I saw him, I went towards him and saluted him, and such was his courtesy that he no sooner received my greeting than he
- 54. returned it. And he went with me towards the castle. Now there were no dwellers in the castle except those who were in one hall. And there I saw four-and-twenty damsels, embroidering satin at a window. And this I tell thee, Kai, that the least fair of them was fairer than the fairest maid thou hast ever beheld in the Island of Britain, and the least lovely of them was more lovely than Gwenhwyvar, the wife of Arthur, when she has appeared loveliest at the Offering, or on the day of the Nativity, or at the feast of Easter. They rose up at my coming, and six of them took my horse, and divested me of my armour; and six others took my arms, and washed them in a vessel until they were perfectly bright. And the third six spread cloths upon the tables and prepared meat. And the fourth six took off my soiled garments, and placed others upon me; namely, an under vest and a doublet of fine linen, and a robe, and a surcoat, and a mantle of yellow satin with a broad gold band upon the mantle. And they placed cushions both beneath and around me, with coverings of red linen; and I sat down. Now the six maidens who had taken my horse unharnessed him, as well as if they had been the best squires in the Island of Britain. Then, behold, they brought bowls of silver wherein was water to wash, and towels of linen, some green and some white; and I washed. And in a little while the man sat down to the table. And I sat next to him, and below me sat all the maidens, except those who waited on us. And the table was of silver, and the cloths upon the table were of linen; and no vessel was served upon the table that was not either of gold or of silver or of buffalo horn. And our meat was brought to us. And, verily, Kai, I saw there every sort of meat and every sort of liquor that I have ever seen elsewhere; but the meat and the liquor were better served there than I have ever seen them in any other place....'" Only the brain of the man who saw things thus could describe that clear day in May.
- 55. June I It was a country of deep, calm pastures and slow streams that might have been in England, except that smiling women at the last farm I had passed were talking in Welsh and calling one another Mary Margaret, or Blodwen, or Olwen; and that far off, like a dim thought or a half-forgotten dream, a mountain conversed with the most distant clouds. THE SHORE NEAR HARLECH—AFTERNOON
- 56. Along my path there had been many oaks and doves among their leaves; and deep hedges that sent bragging stems of briers far out over the footpath, and hid delicate single coils of black bryony in their shadows; and little bridges of ferny stone, and beneath them quiet streams that held flower and tree and cloud in their depth, as if in memory; and great fields where there was nothing, or perhaps a merry, childlike, scampering stoat that pursued a staring, trotting rabbit. I had walked for ten miles and had not seen a man. But it would be more just to ignore such measurements, since the number of milestones was unimportant; so also were the hours. For the country had given me the freedom of time. Dreams of brains that had long been dead became stronger than the strong right hand of to-day and of yesterday. And without asking, these verses sang themselves in my head:— Midways of a walled garden, In the happy poplar land, Did an ancient castle stand, With an old knight for a warden.... Across the moat the fresh west wind In very little ripples went; The way the heavy aspens bent Towards it, was a thing to mind. The painted drawbridge over it Went up and down with gilded chains; 'Twas pleasant in the summer rains Within the bridge-house there to sit. There were five swans that ne'er did eat The water weeds, for ladies came Each day, and young knights did the same, And gave them cakes and bread for meat. I remembered them with a curious sense of being uncontrolled, or, if you will, of being controlled as one is in sleep, and not by friends, railways, clothes, and meals, as one usually is. I had entered that golden age that is always with us, where there are no wars except in the Iliad and Paradise Lost. At one stile, I saw Aeneas,—in mediæval
- 57. mail,—revealing a blue-eyed, confident face, with a slippery mouth set firm by his destiny. The country was without obvious character. An artist could have made nothing of it. Nothing in the arrangement of meadow and corn-land, wood and reedy water, made a clear impression on the mind: they might, perhaps, have been rearranged without attracting attention. So the landscape occupied the eyes little and the mind not at all. Wandering over it with no emotion but rest, I made of it what I would. In different moods I might have met there Proserpina, or Camilla, or Imogen. But chiefly I met there the vague persons of poetry, like Shelley's Ione, which are but as large eyes or eloquent lips discerned in fleeting darkness. And I was too deeply lost to be at once rescued by the sight of a dignified, untenanted house, whose shrubberies I wandered into, along a rabbit run as deep as a footpath in the short, hawk-weedy grass. Docks and milk-thistles had not yet overpowered lupin and phlox in the deep borders that still had a tinge of race in their order and luxuriance. The martins of the eaves had added to the pompous portico of the house, so that it had the look of wild rock. The roses had sent up enormous talons from their roots and tyrannised everywhere. There were no flowers in the garden more delicate than the enchanter's nightshade and nipplewort of the shrubbery, and the short wild poppies that could just flower in the old gravel of the paths. For this one moment the wild and the cultivated were at peace together, and the harmony gave the place an unreality,—so that even at the time I had a dim belief that I was in a garden out of a book,—which made it a fit haven for my mood. Then, in a corner, among ruined, ivy-covered elms, I found a stupid, mournful grotto of wildly-shaped stones wildly accumulated: at the threshold lay a penny doll that played a part between comedy and tragedy very well. Going near, I saw, not quite so clearly as I see it now, a long-bearded, miserable man, reclining, with fair, unwrinkled brow and closed eyes and shining teeth. On his long sloping forehead a high-mounted spider dreamed; yet he did not stir. A snake, in a fold of his coat beneath his beard, disregarded the heaving of his chest. His breath filled the grotto as a
- 58. cow's would have done, and it was sweet. And I turned away suddenly, put to shame by what my soul, rather than my eyes, had recognised as Pan. For I ought to have been prepared and I was not. And as I walked home in an embowered lane, some floating, clashing insects troubled me, and that night, whilst I enjoyed the coming on of sleep, I could not but fancy that I heard the whisper of a god's garment, and wondered had I troubled a god's meditation and walk. II To-day, it is another country, as different from the last as old age from maturity. No longer does the greenfinch in the hawthorn say a hundred times that it has five young ones and is happy. No longer does the perfect grass, seen betwixt the boles of beeches, burn against the sky. For that dream of mountains has come true, and so many and so great are they that I can compare my loneliness only with what I have fancied to be the loneliness of one planet that now is and again is not in a tumultuous, grey, midnight sky, or of a light upon a ship between clouds and angry sea, far off.
- 59. IN THE WOODS, FARCHYNYS, BARMOUTH ESTUARY The thought of steam and electricity never truly touches the primitive sense of distance; and here, even the milestones among the foxgloves are somewhat insolent, when they say that the town under that farthest hill is thirty miles away; for the hill, unknown to me, is farther away than any place I have ever seen, and I would rather say that it is thirty years away and in the dim future or the dim past. In their shape, there is something human, or suggesting human work, in these hills. Castles, or less noble masonry, noble when fallen, look thus in their ruins, and become thus tricked with delicate verdure and flowers. A great plough driven at random through frosty country would have turned up half-mile clods like these. And at twilight there is a ridge like an extended giant with raised knees and
- 60. chin thrown back; and often I have seen a horned summit, like a Pan, capture the white moon. This mountain ahead is not only old, but with its uncovered rock and broken boulders and hoary streams and twisted trees, that look as if a child had gathered garlands and put them in play upon the ancient stems, it declares mightily, if vaguely, the immense past which it has seen. There are English hills which remind us that this land also was once in Arcady: they are of a golden age,—the age of Goldsmith, of Walton, of Chaucer if you like, or of Theocritus; but they speak of nothing since; they bear no wrinkles, no wounds, no trophies. But by this mountain you cannot be really at ease until in some way you have travelled through all history. For it has not been as nothing to it that Persia, Carthage, Greece and Rome, and Spain have been great and are not. It has been worn by the footprints of time which have elsewhere but made the grass a little deeper or renewed the woods. It has sat motionless, looking on the world; it has grown wrinkled; it is all memory. Were it and its fellows to depart, we should not know how old we were; for we should have only books. Therefore I love it. It offers no illusions. Its roads are winding and rough. The grass is thin; the shelter scarce; the valley crops moderate; the cheese and mutton good; the water pure; the people strong, kind, intelligent, and without newspapers; the fires warm and bright and large, and throwing light and shadow upon pewter and brass and oak and books. It offers no illusions; for it is clear, as it is not in a city or in an exuberant English county, that the world is old and troubled, and that light and warmth and fellowship are good. Sometimes comes a thought that it is a huge gravestone, so is it worn, so obscure and brief its legend. It belongs to the past, to the dead; and the dead, as they are more numerous, so here they are greater than we, and we only great because we shall one day be of their number. You cannot look at it without thinking that the time will come when it may be, and we are not, nor the races of men—
- 61. INCOMING TIDE, NEAR BARMOUTH sed haec prius fuere: nunc recondita senet quiete. And hearing an owl among its oak trees, its age was quaintly expounded to me by that passage in the Mabinogion where the Eagle of Gwernabwy seeks a wife. "The Eagle of Gwernabwy had been long married to his wife, and had by her many children. She died, and he continued a long time a widower; but at length he proposed a marriage with the Owl of Cwm Cawlwyd. But afraid of her being young, so as to have children by her, and thereby degrade his own family, he first of all went to inquire about her age amongst the aged of the world. Accordingly he applied to the Stag of Rhedynfre, whom he found lying close to the trunk of an old oak, and requested to know the Owl's age.
- 62. "'I have seen,' said the Stag, 'this oak an acorn, which is now fallen to the ground through age, without either bark or leaves, and never suffered any hurt or strain, except from my rubbing myself against it once a day, after getting up on my legs; but I never remember to have seen the Owl you mention younger or older than she seems to be at this day. But there is one older than I am, and that is the Salmon of Glynllifon.' "The Eagle then applied to the Salmon for the age of the Owl. The Salmon answered, 'I am as many years old as there are scales upon my skin, and particles of spawn within my belly; yet never saw I the Owl you mention but the same in appearance. But there is one older than I am, and that is the Blackbird of Cilgwri.' "The Eagle next repaired to the Blackbird of Cilgwri, whom he found perched upon a small stone, and inquired of him the Owl's age. "'Dost thou see this stone upon which I sit,' said the Blackbird, 'which is now no bigger than what a man can carry in his hand? I have seen this very stone of such weight as to be a sufficient load for a hundred oxen to draw, which has suffered neither rubbing nor wearing, save that I rub my bill on it once every evening, and touch the tips of my wings on it every morning, when I expand them to fly; yet I have not seen the Owl either older or younger than she appears to be at this day. But there is one older than I am, and that is the Frog of Mochno Bog; and if he does not know her age, there is not a creature living that does know it.' "The Eagle went last of all to the Frog, and desired to know the Owl's age. He answered, 'I never ate anything but the dust from the spot which I inhabit, and that very sparingly; and dost thou see these great hills that surround and overawe this bog where I lie? They are formed only of the excrements from my body since I have inhabited this place; yet I never remember to have seen the Owl but an old hag, making that hideous noise Too-hoo-hoo, always frightening the children of the neighbourhood.'"
- 63. Farther along the road, and not wholly cut off from a world of richer fields, there is the ruin of an abbey, which, being the work of human hands, says the same thing more clearly. It is but a cave of masonry topped by umbrageous ivy that swells over its edge like froth over a tankard. Altar and bells and books and large abbatic oven are gone. Only the jackdaw remains. The winds blow through and through the ruins. There is moss; here are flowers,—yellow cistus and cinque- foil, purple fumitory, pearly eyebright, and still some white stitchwort stars. But nothing dies save what we let die, and here, as in a library, on this once consecrated ground, meet all religions. It has room for the Druid. Its ivy leaves repeat the praises of moon and sun. It will deny no fairy and no god an altar and a place for dancing. I have gone there with many fancies and many memories of books, and there they find a home. And if, as some have done, you go there with willingness and an inability to accept what dreams have hitherto been dreamed, you may seem there,—in favourable hours, when the casements of all the senses are opening wide upon eternity, and all things are silent as fishes, and the curves of bramble and brier among the masonry seem to be thinking,—to be on the edge of a new mythology and to taste the joy of the surmises of him who first saw Pan among the sedges or the olives.
- 64. BARMOUTH BRIDGE
- 65. July I For three days I walked and drove towards Llyn-y-Fan Fach. On the first day I passed through a country of furnaces and mines, and the country had been exquisitely made. The gently swirling lines of hill and valley spoke of the mountains far off, as the little waves and the foam coming up the shore like chain-mail speak of the breakers out in the bay. Every large field that was left unburdened by house or factory had a fair curve in it, and even the odd pieces of land were something more than building sites and suggested their context. But as we passed through, only the highest points gave the curious eye any satisfaction, since the straight lines of houses, the pits and the heaps of refuse, and the enormous factories, obscured the true form of the land. Even so might some survivor of a deluge look upon the fair land he knew; for we lacked the courage to think of hill and valley as having undergone an inevitable change, which in a century might be known to have brought beauty with it, as changes do. Everything was brand-new, but not fresh. A wanton child might have done it all, had he been large and rich and careless enough to do it thus, nec numero nec honore. Or had it been all built to the music of the organ-grinder whom I met playing, for the joy of playing, "The Absent-minded Beggar"? The staring, mottled houses of various stone and brick, which had no character save what comes of perfect lack of character, might have been made by some neglected boy who had only played with penny trains and motor cars and steamers and bicycles. Phlox and foxglove, and sweet-william and snapdragon, and campanula and amber lilies could not make sweet the "rockeries" of hot-looking waste. The streets, named after factory magnates, had been made in long blocks and broken up by the boy, thoughtlessly. The factories themselves, noble as some of the
- 66. furnaces were by day and night when sweating men moved to and fro before them, were of the same origin. They were mere cavities, and one marvelled that the smoke from their chimneys was permitted to waver and roll in the same way as clouds the most splendid and august. Many were already in places decayed. That they had been glazed only to have the windows pierced by the stones of happy children was all in their favour that could be seen. Their roofs had fallen in, and neither moss nor ivy had had time to grow thereon; the splintered wood was still new and white. Middle- aged men of fifteen and aged men of thirty were in keeping with their ludicrous senility. A millionaire playing at imitating antiquity could have done no worse. The decay was made in Birmingham. Time had been sweated and had done its work very ill. Here and there, indeed, there were scenes which perhaps an unprejudiced mind would have found sublime. There were pools, for example, filled with delicate grass and goldfish amongst it. They were made yesterday, and yet had they fed little brooks for ages they could not have been more shining and serene as sunset poured all its treasury into their depths. Passing one, soon after dawn, and before the night-workers had left the factory, the reeds in it stood up just so that no storied pool had more the trick of antiquity. Near by, one green field, set amidst houses and a factory, was enclosed by abundant but ill-stretched barbed wire, without gate or possible entrance of any kind. In the middle was a tattered notice, warning trespassers. No cloister was ever more inviolate. The grass grew as it liked, and all whom the heavy headstones of the buildings had spared in the rash burial of rural divinities must there have danced; and the grass shone as if with recent festival, and its emptiness hinted at a recent desertion. All the other fields had been carelessly defaced by broken cheap china and tin kettles and rags, and like cattle that have a day to live and are insulted with the smell of their lucky companions' blood, they were dreary and anxious. Footmarks, but not one footpath, crossed them in all directions.... A Battersea kitchen after Christmas is adorned like this land with similar spoiled toys. Their pathos is the same in kind; but here it is worse, because a grown-up person—the original grandeur and antiquity of the land
- 67. as shown in the one green field—has burst in and marred the completeness of the children's play. MISTY MORNING, NEAR BARMOUTH II At the edge of one village in this country there was a new public- house, the worst of the buildings in the place, because the most impudent. It glittered and stank and was called "The Prince of Wales." Inside, English and some Welsh voices were singing together all of Britain's most loved songs; perhaps "Dolly Gray" predominated, and in its far-floating melody the world-sorrow found a voice; for a harper played on the harp while they sang. The landlord liked to have the harper there, because he drew customers and kept them, and it was clear that he himself, when he had time,
- 68. loved music, since he took his pipe out of his mouth to hum the last words of a song about a skylark, a dead mother, and some angels. The next song was "The Rising of the Lark," which begins thus: A LONELY SHORE, BARMOUTH ESTUARY
- 69. No one sang except the harper; the landlord frowned, remarked that "Evan was very drunk tonight," and offered to stop the song if we objected, and then began to talk. He said that the harper was a poor sort of man; had been a schoolmaster and was a "scholar"; had been to prison for an unmentioned crime; and was now a man with a wife, whom he supported by odd jobs and by "my own charity, for," explained the host, "I let him have his drinks free." He was fond of his harp, as if it had been a horse or a barrel of beer; and boasted, when drunk, that he knew that he was the sixth of his family who had played the harp, and that same harp, and that he was the last of the true harpers. So we went into the taproom and sat down with fourteen miners and the harper, who was doing his best with "God bless the Prince of Wales." "You are fond of your National Anthem," said a voice which might have cut glass and perhaps came from Glasgow. Whereupon, with sublime, gentle anger the harper played and sang the National Anthem of Wales:—
- 70. Mae hen wlad fy Nhadau yn anwyl i mi, Gwlad beirdd a chantorion, en- wogion o fri; Ei gwrol ry - fel - wyr, gwlad-garw-yr tra mad, Dros ryddid goll-a-sant eu gwaed. Gwlad! Gwlad! pleid - iol wyf i'm Gwlad, Tra môr yn fur i'r bur hoff bau, O bydded i'r hen-iaith ba - rhau. VIEW FROM BONTDDU, DOLGELLY The words cannot, of course, be translated, but the following are as much like them as a photograph of Snowdon is like Snowdon. "Dear to me is the old land of my fathers, a land of bards and minstrels of great name. Her brave warriors, best of patriots, poured out their blood for freedom. Ancient and mountainous Wales, Paradise of the bard, every valley and cliff is lovely in my sight; through the feeling of patriotism, how alluring is the ripple on her rivers and brooks. If
- 71. the enemy treads my country under foot, the old language of the Welsh lives as it used to live; the Muse suffers not, in spite of the horrid hand of the traitor, nor yet the melodious harp of my country." And the chorus says: "My country, my country, I am bound up with my country. While the sea is a boundary to the fair and well-loved place, may the old language last." ... While he sang, we saw that the harper was a little, pale, snub- nosed, asthmatic man, with red hair and a delicate, curved mouth and heavy-lidded, pathetic, sentimental, but unsympathetic grey eyes, and glowing white fingers. He leaned over his instrument as a mother over her child when she is bathing it, or as a tired man reaping with a reaping-hook. He evidently knew what he liked; yet, as the evening wore out, he lost himself sentimentally over the poorest tunes. He seemed to love listening at least as well as playing. Slowly we emptied the house of all its Englishmen by encouraging him to play the airs which the harp had known through all its life. He played the plaintive best. Such quick happiness as "New Year's Eve," which begins— moved his sorrow more and his sentiment less, and his white fingers stuck among the strings. When he rose at 11 P.M. to go, he could carry the harp, but hardly himself; and we led him home, murmuring sad ditties lovingly. As he stumbled in, he cursed his wife, a frail burden of middle age, singularly like himself, and then continued to murmur. The light of one candle and the beauty of the harp almost made beautiful the room in which we stood, while he sat with his instrument. The garish wall-paper was mildewed with lovely gleaming white fur, near the windows; elsewhere it was decorated by a large tradesman's photograph of Mr. Chamberlain, a copy of
- 72. "The Maiden's Prayer," and the usual framed mourning verses on relatives; there was, too, a plush mandoline, and in the hearth a frond of the royal fern, and over it photographs of two generations of big consumptive men. THUNDERY WEATHER, NEAR DOLGELLY For a time the harper hesitated between the English tunes which were most in favour at "The Prince of Wales" and the songs for which the harp was made, when it was made for a bard who could string a harp, make a song for it, and accompany himself on the strings. We praised the Welsh airs, and though he seemed to ignore us, he played nothing else. We saw only his eyes, his white flickering fingers, and the harp, and as the triumphant, despairing, adoring
- 73. melodies swept over it, this foolish casket of a man seemed to gather up all that could live of the lovers and warriors of a thousand years. No epitaph could be so eloquent of transient mortality. He had but to cloud or brighten those cruel, sentimental eyes, and to whisper to the dead instrument, to utter all that they had ever uttered. To this heir had come the riches of many hearts and he squandered them in a taproom for beer, and here for our amusement, as if they had been no better than gold and he a spendthrift. When sometimes he paused and silence came, or only the bark of a pump was heard, we seemed to have been assisting at the death and the last carouse of the souls for whom the music spoke. They lived only in his fingers and the harp, and with these they must die. They were as fleeting as pale butterflies in storm or as the Indian moonflower that blossoms only after sunset in May. Yet again and again the fingers and the harp consented to their life, and reassured, and half-believing that, because he had so much in trust, he could not die, we sat down and fell asleep, and waking again, were not surprised to find, as the July dawn approached, that the harper was harping still. For in that holy light that twittered among the strings, he was an immortal harper, doomed for ever to go on, because there was so much to be done, and because, as the landlord had said, he was the last of his race. III I went on, and was over the edge of this country, "built to music and so not built at all," when the sun began to rise behind me. Before, a range of hills stood up against the cold sky with bold lines such as a happy child will draw who has much paper and a stout crayon, and looked so that I remembered the proverb which says, that if a man goes up Cader Idris at night, by dawn he is dead, or mad, or a poet. They were immense; they filled half the sky; yet in the soft light that felt its way glimmeringly, and as if fearfully, among their vast valleys and along their high crags, they looked like ruins of something far more mighty; the fields also, on this side of them, and all the alder-
- 74. loving streams and massy woods, were but as the embers of something which the night had made and had only half destroyed before its flight. And it was with surprise that, as I took my eyes off the prospect and looked down and in the hedge, I saw that I was in a place where lotus and agrimony and vetch were yellow, and the wild rose continued as ever to hesitate between red and white. NEAR PENMAEN POOL—NOON It was not long possible to turn my back upon the rising sun, and when I looked round, I saw that the country I had left had been taken into the service of the dawn and was beautiful two miles away. Factory and chimney and street were bent in a rude circle round the sun, and were as the audience of some story-teller, telling a new tale —silent, solemn, and motionless, round a fire; and over them the
- 75. blue clouds also were silent, solemn, and motionless, listening to the same tale, round the sun. When I went on towards the hills, they by that time looked as if they had never known the night; and sweet it was to pass, now and then, a thatched, embowered cottage, with windows open to the scented air, and to envy the sleepers within, while I could see and recognise the things—the sky and earth and air, the skylarks singing among the fading stars, and the last cuckoo calling in the silent, vast and lonely summer land—which make dreamless sleep amidst them so divine, I had long not known why. For half the day there was nothing to remember but sudden long views that led, happily, nowhere, among the clouds or the hills, and farms with sweetly smiling women, and jutting out of every hedge-bank a little pistyll of fair water, curving and shining in the heat, over a slice of stone or through a pipe, into the road. These things the memory has to work to remember. For, in truth, the day was but as a melody heard and liked. A child who, in the Welsh story, went to the land of the fairies, could only say that he had been listening to sweet airs, when he returned after a long stay. But at length, when I was among the hills, the ferns whispered all along the stony hedges, and on a cold stream of wind came the scent of invisible hay, and a great drop of rain shook all the bells on a foxglove stalk, and the straight, busy rain came down, and the hills talked with the heavens while it thundered heavily. The doves and jays only left the hedge as I passed within reach of them. The crouching partridge did not stir even after her eye caught mine. The lightning was as a tree of fire growing on the northern sky. The valley below was a deep and tranquil mere, in which I saw a church and trees and fields, as if they were reflections of things in the sky, and, like reflections in water, they were reverend in their beauty. The rain in my face washed off more than the weariness of a long day's walk, and I rejoiced, and found it easy to catch a train six miles off, which had seemed impossible.
- 76. VIEW OF CADER IDRIS IV On the next day I was near the lake, Llyn-y-Fan Fach, and high up among hills, which had in many places outgrown their grassy garments, and showed bare cliffs, senates of great boulders, and streams of sliding fragments of stone like burnt paper. The delicate mountain sheep were panting in the heat, or following the shifting oasis of a shadow that sometimes moved across the hill; a horse stood nervously still, envying the shadow which he cast upon the ground. The world, for hours, was a hot, long road, with myself at one end and the lake at the other, when gradually I descended into a gentle land again. Far off, church bells were celebrating the peace and beauty of the morning as I turned into a lane of which more than twenty yards
- 77. were seldom visible at one time; and I lost sight of everything else. Tall hedgerow elms and orchard trees held blue fragments of the sky among their leaves and hid the rest. Here and there was a cottage among the trees, and it seemed less the work of human hands than the cordon and espalier trees, apple and pear, and the fan-shaped cherry on the wall, with glowing bark. July, which had made the purple plum and the crimson bryony berry, had made it also, I thought. The lane was perhaps long enough to occupy an hour of the most slow-paced tranquil human life. Even if you talked with every ancient man that leaned on his spade, and listened to every young linnet that was learning to sing in the hazels, you could not spend more than two hours in passing along it. Yet, more than once, as I was pausing to count the white clusters of nuts or to remind myself that here was the first pale-blue flower of succory, I knew that I took up eternity with both hands, and though I laid it down again, the lane was a most potent, magic thing, when I could thus make time as nothing while I meandered over many centuries, consulting many memories that are as amulets. And even as I walked, the whole of time was but a quiet, sculptured corridor, without a voice, except when the tall grasses bowed and powdered the nettles with seed at my feet. For the time I could not admit the existence of strident or unhappy or unfortunate things. I exulted in the knowledge of how cheaply purchased are these pleasures, exulted and was yet humiliated to think how rare and lonely they are, nevertheless. The wave on which one is lifted clear of the foam and sound of things will never build itself again. And yet, at the lane's end, as I looked back at the long clear bramble curves, I will confess that there was a joy (though it put forth its hands to an unseen grief) in knowing that down that very lane I could never go again, and was thankful that it did not come rashly and suddenly upon the white highroad, and that there is no such thing known to the spirit as a beginning and an end. For not without cool shadow and fragrance was the white highroad. Then, after some miles up a hot and silent hill, I came to the lake under the chin of a high summit, and it was cool....
- 78. At the end of the twelfth century, when Owen Gwynedd in the north and Lord Rhys in the south made little of English kings, a farmer's widow lived with one son at Blaensawdde, near the lake. She sent her cattle on to the Black Mountain under the care of her son. And the cattle liked Llyn-y-Fan because the great stones on its shore gave them shade, and because the golden stony shallows were safe and sweet, and no water was finer than that in the little quiet wells of the Sawdde brook. Watching his cattle there one day, the youth saw a lovely girl, with long, yellow hair and pale, melancholy face, seated on the surface of the lake and looking down into the mirror of the water, for she was combing her hair. Some say that she was rowing with golden sculls up and down the lake in a golden boat, so ample was her hair. The young man was moved by her loveliness to hold out to her his own barley-bread and cheese, which was all that he had with him. And she came near, but she would not accept the food; when he tried to touch her, she slid away, saying— "O thou of the crimped bread, 'Tis not easy to catch me"; and so disappeared, as a lily when the waves are rising. The youth told his adventure to his mother, who advised him to take unbaked dough for the girl, instead of his crisp barley bread.
- 79. MIST ON CADER IDRIS The next morning he was at the lake before dawn, and saw cold ripples on the water and a cloud on the highest of the hills. But as the light overcame the cloud and began to warm the ripples, he saw some of his cattle in danger on the steep side of the lake, where the rains run almost perpendicularly down to the margin and cut weals of naked red earth in the mountain-side. And as he was running round to the cattle, he saw the girl upon the water, and again held out his hand to offer his unbaked dough. Again she refused, and said: "O thou of the moist bread, I will not have thee." Then, with smiles, she disappeared.
- 80. The youth told his second adventure to his mother, and she advised him to take slightly baked bread. The Welsh have a proverb: "Better is cookery than kingship"; and she being skilled with the oven, baked him the bread. The next morning he was again at the lake. The cold ripples turned to gold and then to silver, and the cloud left the mountain; and he saw the wind making grey O's and V's on the water, until it was almost evening, and behind him the oak trees in the Sawdde valley gleamed where his homeward way would be, when he saw several cows walking on the water, and then the girl moving towards him. He ran forward into the water; he held out the bread, and she took it, and promised to marry him on the condition that he should not give her three causeless blows; if he did, she would disappear. Suddenly she left him, and he would have cast himself in with despair, if she had not returned with another as beautiful and in the same way, together with a majestic, tall, and hoary man, who promised to bestow the girl upon him if he could distinguish her. So the two girls stood before him; and the youth, casting down his eyes in thought and perplexity, saw one thrust her little foot forward, and he noticed how her sandals were tied, because he had before studied the beauty of her ankles and feet; and he chose rightly. The old man promised that they should have as many cattle, horses, sheep, and goats as she could count of each without drawing breath. The girl counted quickly, 1, 2, 3, 4, 5, 1, 2, 3, 4, 5, and so on, and all the beasts came up from the lake; and the young man went with the girl and married her, and lived at Esgair Llaethdy beyond Blaensawdde, and there she bore him three sons.
- 81. IN THE WOODS, BERWYN But one day, when they were to go together to a christening, she was reluctant, saying that it was too far to walk; and he bade her take a horse. She asked for her gloves, and when he returned with them, he found her still delaying, and flicked her shoulder with one and said pettingly, "Go, go." And she reminded him that he had given her a causeless blow. On another day, at a wedding, she gave way to tears, and he tapped her shoulder to admonish her. And she reminded him that he had given her two causeless blows. Many years later, at a funeral, she laughed, and again he tapped her shoulder. And she turned, and called her cattle and horses and sheep and goats by name—the brindled cow, the white speckled, the mottled, the white-faced cows;
- 82. "And the grey Geingen With the white bull From the court of the king; And the little black calf Though suspended on the hook, Come thou also quite well home"; and the four grey oxen ploughing in the fields. They followed her to the lake, and behind them grew the furrow made by the plough which the four oxen still drew, and they all entered the lake. Her sons desired to see her, and she appeared again to her son Rhiwallon, and told him that he was to be a healer of men, and gave him prescriptions, and promised that if he needed her, she would come again. So she often met them near the lake, and once walked with them towards Myddfai, as far as Pant-y-Meddygon, where she showed them herbs and their virtues. And they became famous, and good physicians. They were physicians to Rhys Gryg of South Wales; and the last of their descendants who practised at Myddfai was buried in 1739 at Myddfai church.
- 83. August I On a fine, very hot day I had to wait three hours for a train, and should have left the bald junction for that time, if I had not seen there a poet of my acquaintance, contentedly reading Spenser on the central platform. I sat down with him, but he preferred reading to talking, and I looked over his shoulder to read: Begin then, O my dearest sacred Dame! Daughter of Phœbus and of Memorye....
- 84. ABERDOVEY And I could not sufficiently admire his fortitude, until, on the arrival of a train, he left the book on the seat, and walked down alongside the train. It stopped ten minutes, and he talked with persons in three different carriages before it left. He came back unperturbed, and told me briefly that —— from Patagonia was in the train, with —— the bard from North Wales, and a friend from London. Seeing me surprised, he explained that every Saturday in the summer he spent entirely on the platform, waiting for surprises of this kind. Four trains stopped there before I left, and each seemed to be laden with friends and acquaintances,—some who lived in distant parts and even overseas, and some whom he had not seen for years. And some of the persons whom he greeted he had never seen before, which was a good reason for greeting them; he had perhaps heard of them, or they of him; and so they talked. The liking of Welshmen for Welshmen is very strong, and that not only when they meet on foreign soil, as in London, but in their own land. They do not, I suppose, love their neighbours more than other men do, but when they meet a fellow-countryman for the first time they seem to have a kind of surprise and joy, in spite of the commonness of such meetings. They do not acquiesce in the fact that the man they shake hands with is of their race, as English people do. They converse readily in trains: they are all of one family, and indeed if you are Welsh, not only can you not avoid meeting relatives, but you do not wish to. Small news about the coming and going of people travels among them rapidly, and I have never got out of a train in Wales without feeling that I shall meet some one whom I should like to meet, on the platform or in the first street. They like their own land in the same way. I do not easily believe in patriotism, in times of peace or war, except as a party cry, or the result of intoxication or an article in a newspaper, unless I am in Wales.
- 85. I did not know before that any save sellers of newspapers were happy in railway stations, and as my train went out, I passed the poet at his Spenser again and recalled the poem called "Howell's Delight," which was written by a young, unfortunate prince of North Wales in the twelfth century:—
- 86. A white foam-crowned wave flows o'er the grave Of Rhuvawn Bevyr, chief of Rulers. I this day hate England, a flat and inactive land, With a people involved in every wile; I love the land where I had the much-desired gift of mead, Where the shores extend in tedious conflict; I love the society and the numerous inhabitants Therein, who, obedient to their Lord, Direct their views of peace; I love its sea-coast and its mountains, Its cities bordering on its forests, its fair landscapes, Its dales, its waters, and its vales, Its white seamews, and its beauteous women; I love its warriors, and its well-trained steeds, Its woods, its strongholds, and its social domicile; I love its fields clothed with tender trefoil, Where I had the glory of a lasting triumph; I love its cultivated regions, the prerogative of heroism, Its far extended wilds, and its sports of the chase, Which, Son of God! are great and wonderful. How sleek the majestic deer, and in what plenty found; I achieved with a push of a spear the task of honour Between the Chief of Powys and fair Gwynedd; And if I am pale in the rush of conflict, 'Tis that I know I shall be compelled to leave my country, For it is certain that I cannot hold out till my party comes, A dream has revealed it, and God says 'tis true. A white foam-crowned wave flows o'er the grave, A white bright-foaming wave boldly raves against the towns, Tinted the time it swells like glittering hoar. I love the marches of Marioneth, Where my head was pillowed on a snow-white arm; I love the nightingale on the privet wood In the famous vale of Cymmer Deuddwfr, Lord of heaven and earth, the glory of Gwyneddians. Though it is so far from Keri to Caerliwelydd, I mounted the yellow steed, and from Maelienydd Reached the land of Reged between night and day. Before I am in the grave, may I enjoy a new blessing From the land of Tegyngyl of fairest aspect!
- 87. Welcome to our website – the ideal destination for book lovers and knowledge seekers. With a mission to inspire endlessly, we offer a vast collection of books, ranging from classic literary works to specialized publications, self-development books, and children's literature. Each book is a new journey of discovery, expanding knowledge and enriching the soul of the reade Our website is not just a platform for buying books, but a bridge connecting readers to the timeless values of culture and wisdom. With an elegant, user-friendly interface and an intelligent search system, we are committed to providing a quick and convenient shopping experience. Additionally, our special promotions and home delivery services ensure that you save time and fully enjoy the joy of reading. Let us accompany you on the journey of exploring knowledge and personal growth! ebookultra.com