Plant Functional Genomics Methods And Protocols 1st Edition Erich Grotewold

Plant Functional Genomics Methods And Protocols
1st Edition Erich Grotewold download
https://ebookbell.com/product/plant-functional-genomics-methods-
and-protocols-1st-edition-erich-grotewold-922666
Explore and download more ebooks at ebookbell.com

Here are some recommended products that we believe you will be
interested in. You can click the link to download.
Plant Functional Genomics Methods And Protocols 2nd Edition Jose M
Alonso
https://ebookbell.com/product/plant-functional-genomics-methods-and-
protocols-2nd-edition-jose-m-alonso-5031920
Plant Functional Genomics Methods In Molecular Biology Vol 236 1st
Edition Erich Grotewold
https://ebookbell.com/product/plant-functional-genomics-methods-in-
molecular-biology-vol-236-1st-edition-erich-grotewold-2362172
Crispr And Plant Functional Genomics 1st Edition Jentsung Chen
https://ebookbell.com/product/crispr-and-plant-functional-
genomics-1st-edition-jentsung-chen-55971546
Elucidation Of Abiotic Stress Signaling In Plants Functional Genomics
Perspectives Volume 1 1st Edition Girdhar K Pandey Eds
https://ebookbell.com/product/elucidation-of-abiotic-stress-signaling-
in-plants-functional-genomics-perspectives-volume-1-1st-edition-
girdhar-k-pandey-eds-5139996

Elucidation Of Abiotic Stress Signaling In Plants Functional Genomics
Perspectives Volume 2 1st Edition Girdhar K Pandey Eds
https://ebookbell.com/product/elucidation-of-abiotic-stress-signaling-
in-plants-functional-genomics-perspectives-volume-2-1st-edition-
girdhar-k-pandey-eds-5140050
Protein Phosphatases And Stress Management In Plants Functional
Genomic Perspective Girdhar Pandey
https://ebookbell.com/product/protein-phosphatases-and-stress-
management-in-plants-functional-genomic-perspective-girdhar-
pandey-12290596
Plant Specialized Metabolism Genomics Biochemistry And Biological
Functions Arimura
https://ebookbell.com/product/plant-specialized-metabolism-genomics-
biochemistry-and-biological-functions-arimura-5699532
Plant Functional Diversity Organism Traits Community Structure And
Ecosystem Properties Eric Garnier
https://ebookbell.com/product/plant-functional-diversity-organism-
traits-community-structure-and-ecosystem-properties-eric-
garnier-5431716
Plant Biodiversity In Urbanized Areas Plant Functional Traits In Space
And Time Plant Rarity And Phylogenetic Diversity 1st Edition Sonja
Knapp Auth
https://ebookbell.com/product/plant-biodiversity-in-urbanized-areas-
plant-functional-traits-in-space-and-time-plant-rarity-and-
phylogenetic-diversity-1st-edition-sonja-knapp-auth-4625200

Methods in Molecular BiologyTM
Methods in Molecular BiologyTM
Edited by
Erich Grotewold
Plant Functional
Genomics
VOLUME 236
Edited by
Erich Grotewold
Plant Functional
Genomics

Plant BAC Library Construction 3
3
From: Methods in Molecular Biology, vol. 236: Plant Functional Genomics: Methods and Protocols
Edited by: E. Grotewold © Humana Press, Inc., Totowa, NJ
1
An Improved Method for Plant BAC
Library Construction
Meizhong Luo and Rod A. Wing
Summary
Large genomic DNA insert-containing libraries are required as critical tools for physical
mapping, positional cloning, and genome sequencing of complex genomes. The bacterial arti-
ficial chromosome (BAC) cloning system has become a dominant system over others to clone
large genomic DNA inserts. As the costs of positional cloning, physical mapping, and genome
sequencing continuously decrease, there is an increasing demand for high-quality deep-
coverage large insert BAC libraries. In our laboratory, we have constructed many high-quality
deep-coverage large insert BAC libraries including arabidopsis, manocot and dicot crop plants,
and plant pathogens. Here, we present the protocol used in our laboratory to construct BAC
libraries.
Key Words
BAC, library, method, pCUGIBAC1, plant
1. Introduction
Large genomic DNA insert-containing libraries are essential for physical
mapping, positional cloning, and genome sequencing of complex genomes.
There are two principal large insert cloning systems that are constructed as
yeast or bacterial artificial chromosomes (YACs and BACs, respectively). The
YAC cloning (1) was first developed in 1987 and uses Saccharomyces
cerevisiae as the host and maintains large inserts (up to 1 Mb) as linear mol-
ecules with a pair of yeast telomeres and a centromere. Although used exten-
sively in the late 1980s and early 1990s, this system has several disadvantages
(2,3). The recombinant DNA in yeast can be unstable. DNA manipulation is
difficult and inefficient. Most importantly, a high level of chimerism, the clon-

4 Luo and Wing
ing of two or more unlinked DNA fragments in a single molecule, is inherent
within the YAC cloning system. These disadvantages impede the utility of
YAC libraries, and subsequently, this system has been gradually replaced by
the BAC cloning system introduced in 1992 (4).
The BAC cloning uses a derivative of the Escherichia coli F-factor as vector
and E. coli as the host, making library construction and subsequent downstream
procedures efficient and easy to perform. Recombinant DNA inserts up to 200
kb can be efficiently cloned and stably maintained in E. coli. Although the
insert size cloning capacity is much lower than that of the YAC system, it is this
limited cloning capacity that helps to prevent chimerism, because the inserts
with sizes between 130–200 kb can be selected, while larger inserts, composed
of two or more DNA fragments, are beyond the cloning capacity of the BAC
system or are much less efficiently cloned.
In 1994, our laboratory was the first to construct a BAC library for plants
using Sorghum bicolor (5). Since then, we have constructed a substantial num-
ber of deep coverage BAC libraries, including Arabidopsis (6), rice (7), melon
(8), tomato (9), soybean (10), and barley (11) and have provided them to the
community for genomics research ([http://www.genome.arizona.edu] and
[http://www.genome.clemson.edu]).
The construction of a BAC library is quite different from that of a general
plasmid or h DNA library used to isolate genes or promoter sequences by posi-
tive screening. Megabase high molecular weight DNA is required for BAC
library construction. Because individual clones of the BAC library will be
picked, stored, arrayed on filters, and directly used for mapping and sequenc-
ing, a BAC library with a small average insert size and high empty clone (no
inserts) rate will dramatically increase the cost and labor for subsequent work.
Usually, a BAC library with an average insert size smaller than 130 kb and
empty clone rate higher than 5% is unacceptable. These strict requirements
make BAC library construction much more difficult than the construction of a
general DNA library.
As the costs of positional cloning, physical mapping, and genome sequenc-
ing continuously decrease, so increases the demand for high-quality deep-
coverage large insert BAC libraries (12). As a consequence, we describe in this
chapter how our laboratory constructs BAC libraries.
Several protocols have been published for the construction of high quality
plant and animal BAC libraries (13–18), including three from our laboratory
(16–18). We improved on these methods in several ways (8). First, to easily
isolate large quantities of single copy BAC vector, pIndigoBAC536 (see Note
1) was cloned into a high copy cloning vector, pGEM-4Z. This new vector,
designated pCUGIBAC1 (Fig. 1), replicates as a high copy vector and can be
isolated in large quantity using standard plasmid DNA isolation methods. It

retains all three unique cloning sites (HindIII, EcoRI, and BamHI), as well as
the two NotI sites flanking the cloning sites, of the original pIndigoBAC536.
Second, to improve the stability of megabase DNA and size-selected DNA
fractions in agarose, as well as digested dephosphorylated BAC vectors, we
determined that such material can be stored indefinitely in 70% ethanol at
–20°C and in 40–50% glycerol at –80°C, respectively.
The vector has been distributed to many users worldwide, and the high
molecular weight DNA preservation method, established by Luo et al. (8), has
been extensively used by colleagues and visitors and shown to be very effi-
cient (18). These improvements and protocols described here save on resources,
cost, and labor, and also release time constraints on BAC library construction.
2. Materials, Supplies, and Equipment
2.1. For pCUGIBAC1 Plasmid DNA Preparation
1. pCUGIBAC1 (http://www.genome.clemson.edu).
2. LB medium; 10 g/L bacto-tryptone, 5 g/L bacto-yeast extract, 10 g/L NaCl.
3. Ampicillin and chloramphenicol (Fisher Scientific).
4. Qiagen plasmid midi kit (Qiagen).
5. Thermostat shaker (Barnstead/Thermolyne).
2.2. For BAC Vector pIndigoBAC536 Preparation
2.2.1. For Method One
1. Restriction enzymes (New England Biolabs).
2. HK phosphatase, Tris-acetate (TA) buffer, 100 mM CaCl2, ATP, T4 DNA ligase
(Epicentre).
Fig. 1. pCUGIBAC1. Not drawn to scale.

6 Luo and Wing
3. Agarose and glycerol (Fisher Scientific).
4. 10× Tris-borate EDTA (TBE) and 50× Tris-acetate EDTA (TAE) buffer (Fisher
Scientific).
5. 1 kb DNA ladder (New England Biolabs).
6. Ethidium bromide (EtBr) (10 mg/mL).
7. h DNA (Promega).
8. Water baths.
9. CHEF-DR III pulse field gel electrophoresis system (Bio-Rad).
10. Dialysis tubing (Spectra/Por2 tubing, 25 mm; Spectrum Laboratories).
11. Model 422 electro-eluter (Bio-Rad).
12. Minigel apparatus Horizon 58 (Whatman).
13. UV transilluminator.
2.2.2. For Method Two
1. Restriction enzymes and calf intestinal alkaline phosphatase (CIP) (New England
Biolabs).
2. 0.5 M EDTA, pH 8.0.
3. Absolute ethanol, agarose, and glycerol (Fisher Scientific).
4. T4 DNA ligase (Promega).
5. 10× TBE and 50× TAE buffer (Fisher Scientific).
6. 1 kb DNA ladder.
7. EtBr (10 mg/mL).
8. h DNA.
9. Water baths.
10. CHEF-DR III pulse field gel electrophoresis system.
11. Dialysis tubing (Spectra/Por2 tubing, 25 mm).
12. Model 422 electro-eluter.
13. Minigel apparatus Horizon 58.
2.3. For Preparation of Megabase Genomic DNA Plugs from Plants
1. Nuclei isolation buffer (NIB): 10 mM Tris-HCl, pH 8.0, 10 mM EDTA, pH 8.0,
100 mM KCl, 0.5 M sucrose, 4 mM spermidine, 1 mM spermine.
2. NIBT: NIB with 10% Triton® X-100.
3. NIBM: NIB with 0.1% `-mercaptoethanol (add just before use).
4. Low melting temperature agarose (FMC).
5. Proteinase K solution: 0.5 M EDTA, 1% N-lauroylsarcosine, adjust pH to 9.2
with NaOH; add proteinase K to 1 mg/mL before use.
6. 50 mM phenylmethylsulfonyl fluoride (PMSF) (Sigma) stock solution (prepared
in ethanol or isopropanol).
7. T10E10 (10 mM Tris-HCl and 10 mM EDTA, pH 8.0) and TE (10 mM Tris-HCl
and 1 mM EDTA, pH 8.0).
8. Mortars, pestles, liquid nitrogen, 1-L flasks, cheese cloth, small paintbrush, and
Pasteur pipet bulbs.

9. 50-mL Falcon® tubes (Fisher Scientific) and miracloth (Calbiochem-
Novabiochem).
10. Plug molds (Bio-Rad).
11. GS-6R centrifuge (Beckman).
12. Model 230300 Bambino hybridization oven (Boekel Scientific).
2.4. For Preparation of High Molecular Weight Genomic
DNA Fragments
2.4.1. For Pilot Partial Digestions
1. Restriction enzymes and BSA (Promega).
2. 40 mM Spermidine (Sigma) and 0.5 M EDTA, pH 8.0.
3. h Ladder pulsed field gel (PFG) marker (New England Biolabs).
4. Agarose and 10× TBE.
5. EtBr (10 mg/mL).
6. Razor blades, microscope slides, and water baths.
9. EDAS 290 image system (Eastman Kodak).
2.4.2. For DNA Fragment Size Selection
1. Restriction enzymes and BSA.
2. 40 mM spermidine and 0.5 M EDTA, pH 8.0.
3. h Ladder PFG marker.
4. Agarose and 10× TBE.
5. Low melting temperature agarose.
6. EtBr (10 mg/mL) and 70% ethanol.
7. Razor blades, microscope slides, water baths, and a ruler.
10. EDAS 290 image system.
2.5. For BAC Library Construction
2.5.1. For DNA Ligation
1. T4 DNA ligase and h DNA.
2. Agarose and 1× TAE buffer.
3. EtBr (10 mg/mL).
4. Dialysis tubing (Spectra/Por2 tubing, 25 mm) or Model 422 electro-eluter.
5. Minigel apparatus Horizon 58.
7. Water baths.
8. 0.1 M Glucose/1% agarose cones: melt 0.1 M glucose and 1% agarose in water,
dispense 1 mL to each 1.5-mL microcentrifuge, insert a 0.5-mL microcentrifuge

8 Luo and Wing
into each 1.5-mL microcentrifuge containing 0.1 M glucose and 1% agarose, af-
ter solidification, pull out the 0.5-mL microcentrifuges.
2.5.2. For Test Transformation
1. DH10B T1 phage-resistant cells (Invitrogen).
2. SOC: 20 g/L bacto-tryptone, 5 g/L bacto-yeast extract, 10 mM NaCl, 2.5 mM
KCl, autoclave, and add filter-sterilized MgSO4 to 10 mM, MgCl2 to 10 mM, and
glucose to 20 mM before use.
3. 100-mm diameter Petri dish agar plates containing LB with 12.5 µg/mL of
chloramphenicol, 80 µg/mL of x-gal (5-bromo-4-chloro-3-indolyl-`-D-
galactoside or 5-bromo-4-chloro-3-indolyl-`-D-galactopyranoside [X-gal]) and
100 µg/mL of IPTG isopropyl-`-D-thiogalactoside or isopropyl-`-D thiogalacto-
pyranoside.
4. 15-mL culture tubes.
5. Thermostat shaker.
6. Electroporator (cell porator; Life Technologies).
7. Electroporation cuvettes (Whatman).
8. 37°C incubator.
2.5.3. For Insert Size Estimation
2.5.3.1. FOR BAC DNA ISOLATION
1. LB with 12.5 µg/mL chloramphenicol.
2. Isopropanol and ethanol.
3. P1, P2, and P3 buffers from plasmid kits (Qiagen).
4. 15-mL culture tubes.
5. Thermostat shaker.
6. Microcentrifuge.
2.5.3.2. FOR BAC INSERT SIZE ANALYSIS
1. NotI (New England Biolabs).
2. DNA loading buffer: 0.25% (w/v) bromophenol blue and 40% (w/v) sucrose in
TE, pH 8.0.
3. MidRange I PFG molecular weight marker (New England Biolabs).
4. Agarose, 0.5× TBE buffer, and EtBr (10 mg/mL).
5. 37°C water bath or incubator.
8. EDAS 290 image system.
2.5.4. For Bulk Transformation, Colony Array, and Library
Characterization
1. Freezing media: 10 g/L bacto-tryptone, 5 g/L bacto-yeast extract, 10 g/L NaCl,
36 mM K2HPO4, 13.2 mM KH2PO4, 1.7 mM Na-citrate, 6.8 mM (NH4)2SO4,

4.4% glycerol, autoclave, and add filter-sterilized MgSO4 stock solution to 0.4
mM.
2. 384-well plates and Q-trays (Genetix).
3. Toothpicks (hand picking) or Q-Bot (Genetix).
3. Methods
3.1. Preparing pCUGIBAC1 Plasmid DNA
1. Inoculate a single well-isolated E. coli clone harboring pCUGIBAC1 in LB con-
taining 50 mg/L of ampicillin and 12.5 mg/L of chloramphenicol and grow at
37°C for about 20 h with continuous shaking.
2. Prepare pCUGIBAC1 plasmid DNA using the plasmid midi kit according to the
manufacturer’s instruction, except that after adding solution P2, the sample was
incubated at room temperature for not more than 3 min instead of 5 min (see
acknowledgments). Each 100 mL of culture yields about 100 µg of plasmid DNA
when using a midi column.
3.2. Preparing BAC Vector, pIndigoBAC536
3.2.1. Method One
1. Set up 4–6 restriction digestions, each digesting 5 µg pCUGIBAC1 plasmid DNA
(with HindIII, EcoRI, or BamHI depending on which enzyme is selected for BAC
library construction) in 150 µL 1× TA buffer at 37°C for 2 h. Check 1 µL on a 1%
agarose minigel to determine if the plasmid is digested.
2. Heat the digestions at 75°C for 15 min to inactivate the restriction enzyme.
3. Add 8 µL of 100 mM CaCl2, 1.5 µL of 10× TA buffer, and 5 µL of HK phos-
phatase, and incubate the samples at 30°C for 2 h.
4. Heat the samples at 75°C for 30 min to inactivate the HK phosphatase.
5. Add 6.4 µL of 25 mM ATP, 5 µL of 2 U/µL T4 DNA ligase, and 1.3 µL of 10×
TA buffer, incubate at 16°C overnight for self-ligation.
6. Heat the self-ligations at 75°C for 15 min.
7. Combine the samples and run the combined sample in a single well, made by
taping together several teeth of the comb according to the sample vol, on a 1%
CHEF agarose gel at 1–40 s linear ramp, 6 V/cm, 14°C in 0.5× TBE buffer along
with the 1 kb ladder loaded into the wells on the both sides of the gel as marker
for 16–18 h.
8. Stain the two sides of the gel containing the marker and a small part of the sample
with 0.5 µg/mL EtBr and recover the gel fraction containing the 7.5-kb
pIndigoBAC536 DNA band from the unstained center part of the gel by aligning
it with the two stained sides. Undigested circular plasmid DNA and non-
dephosphorylated linear DNA that has recircularized or formed concatemers
after self-ligation should be reduced to an acceptable level after this step. Figure
2 shows a gel restained with 0.5 µg/mL EtBr after having recovered the gel frac-
tion containing the 7.5-kb pIndigoBAC536 vector. The 2.8-kb band is the pGEM-
4Z vector.

10 Luo and Wing
9. Electroelute pIndigoBAC536 from the agarose gel slice in 1× TAE buffer at 4°C.
Either dialysis tubing (19) or the Model 422 electro-eluter can be used (18).
10. Estimate the DNA concentration by running 2 µL of its dilution along with 2 µL
of each of serial dilutions of h DNA standards (1, 2, 4, and 8 ng/µL) on a 1%
agarose minigel containing 0.5 µg/mL EtBr (for 10 min) and comparing the
images under UV light, or simply by spotting a 1-µL dilution along with 1 µL of
each of serial dilutions of h DNA standards (1, 2, 4, and 8 ng/µL) on a 1% agar-
ose plate containing 0.5 µg/mL EtBr and comparing the images under UV light
after being incubated at room temperature for 10 min.
11. Adjust DNA concentration to 5 ng/µL with glycerol (final glycerol concentration
40–50%), aliquot into microcentrifuge tubes, and store the aliquots at –80°C.
Use each aliquot only once.
12. Test the vector quality by cloning h DNA fragments digested with the same re-
striction enzyme as used for vector preparation. Prepare a sample without the h
DNA fragments as the self-ligation control. For ligation, transformation, and in-
sert check, follow the protocols in Subheading 3.5. for BAC library construc-
tion, except that inserts are checked on a standard agarose gel instead of a CHEF
gel. Colonies from the ligation with the h DNA fragments should be at least 100
times more abundant than those from the self-ligation control. More than 95% of
the white colonies from the ligation with the h DNA fragments should contain
inserts.
Fig. 2. Recovering linearized dephophorylated 7.5-kb pIndigoBAC536 vector from
a CHEF agarose gel. See text for details.

3.2.2. Method Two
1. Set up 4–6 digestions, each digesting 5 µg pCUGIBAC1 plasmid DNA (with
HindIII, EcoRI, or BamHI depending on which enzyme is selected for BAC
library construction) in 150 µL 1× restriction buffer at 37°C for 1 h. Check 1 µL
on a 1% agarose minigel to see if the plasmid is digested.
2. Add 1 U of CIP and incubate the samples at 37°C for an additional 1 h (see Note
2).
3. Add EDTA to 5 mM and heat the samples at 75°C for 15 min.
4. Precipitate DNA with ethanol, wash it with 70% ethanol, air-dry, and add: 88
µL of water, 10 µL of 10× T4 DNA ligase buffer, and 2 µL of 3 U/µL T4 DNA
ligase.
5. Incubate the samples at 16°C overnight for self-ligation. Then follow steps 6–12
of Method One (Subheading 3.2.1.).
3.3. Preparing Megabase Genomic DNA Plugs from Plants (see [18] for
alternatives) (see Note 3)
1. Young seedlings of monocotyledon plants, such as rice and maize, and young
leaves of dicotyledon plants, such as melon, are used fresh or collected and stored
at –80°C.
2. Grind about 100 g of tissue in liquid N2 with a mortar and a pestle to a level that
some small tissue chunks can be still seen (see Note 4).
3. Divide and transfer the ground tissue into two 1-L flasks, each containing 500
mL of ice-cold NIBM (1 g tissue/10 mL).
4. Keep the flasks on ice for 15 min with frequent and gentle shaking.
5. Filter the homogenate through four layers of cheese cloth and one layer of
miracloth. Squeeze the pellet to allow maximum recovery of nuclei-containing
solution.
6. Filter the nuclei-containing solution again through one layer of miracloth.
7. Add 1:20 (in vol) of NIBT to the nuclei-containing solution and keep the mixture
on ice for 15 min with frequent and gentle shaking.
8. Transfer the mixture into 50-mL Falcon tubes. Centrifuge the tubes at 2400g at
4°C for 15 min.
9. Gently resuspend the pellets in the residual buffer by tapping the tubes or with a
small paintbrush.
10. Dilute the nucleus suspension with NIBM and combine it into two 50-mL Falcon
tubes. Adjust the vol to 50 mL with NIBM in each tube and centrifuge the tubes
at 2400g at 4°C for 15 min.
11. Resuspend the pellets as in step 9. Dilute the nucleus suspension with NIBM and
combine it into one 50-mL Falcon tube. Adjust the vol to 50 mL with NIBM and
centrifuge it at 2400g at 4°C for 15 min.
12. Remove the supernatant and gently resuspend the pellet in approx 1.5 mL of NIB.
13. Incubate the nucleus suspension at 45°C for 5 min. Gently mix it with an equal
vol of 1% low melting temperature agarose, prepared in NIB and pre-incubated

12 Luo and Wing
at 45°C, by slowly pipeting 2 or 3 times. Transfer the mixture to plug molds and
let stand on ice for about 30 min to form plugs.
14. Tranfer <50 agarose plubs into each 50-mL Falcon tube, containing 40 mL of
proteinase K solution, with a Pasteur pipet bulb.
15. Incubate the tubes in a hybridization oven (e.g., Model 230300 Bambino hybrid-
ization oven) at 50°C with a gentle rotation for about 24 h.
16. Repeat step 15 with fresh proteinase K solution.
17. Wash the plugs, each time for about 1 h at room temperature with gentle shaking
or rotation, twice with T10E10 containing 1 mM PMSF and twice with TE (40 mL
each time for each 50-mL Falcon tube containing <50 plugs).
18. Store the plugs in TE buffer at 4°C (for frequent use) or rinse them with 70%
ethanol and store in 70% ethanol (40 mL for each 50-mL Falcon tube containing
<50 plugs) at –20°C (for long-term storage) (see Note 5).
3.4. Preparing High Molecular Weight Genomic DNA Fragments
3.4.1. Pilot Partial Digestions
1. Soak required number (e.g., 4 plugs) of TE-stored plugs in sterilized distilled
water (more than 20 vol) for 1 h before partial digestion. For ethanol-stored plugs,
transfer required number of 70% ethanol-stored plugs into TE buffer or directly
into sterilized distilled water (more than 20 vol) at 4°C the day before use (see
Note 6) and soak them in sterilized distilled water (more than 20 vol) for 1 h before
partial digestion.
2. Dispense 45 µL of buffer mixture (24.5 µL of water, 9.5 µL of 10× restriction
enzyme buffer, 1 µL of 10 mg/mL bovine serum albumin BSA, and 10 µL of 40
mM spermidine) into each of an ordered serial set (e.g., Nos. 1–8) of micro-
centrifuge tubes. Keep the microcentrifuge tubes on ice.
3. Chop each half DNA plug to fine pieces with a razor blade on a clean microscope
slide (assume each half DNA plug has a vol of 50 µL) and transfer these pieces
into a microcentrifuge tube containing 45 µL of restriction enzyme buffer on ice
with a spatula. Mix by tapping and incubate on ice for 30 min.
4. Make serial dilutions of restriction enzyme (HindIII, EcoRI, or BamHI, depend-
ing on which enzyme is selected for BAC library construction) with 1× restric-
tion enzyme buffer (e.g., 0.4, 0.8, 1.2, 1.6, 2.0, and 2.4 U/µL).
5. Add 5 µL of one enzyme dilution to each of the microcentrifuge tube in step 3.
Set up an uncut control, by not adding any enzyme, and a completely cut control,
by adding 50–60 U of enzyme. Mix by tapping and incubate on ice for 30 min to
allow for diffusion of the enzyme into the agarose matrix.
6. Incubate the microcentrifuge tubes in a 37°C water bath for 40 min.
7. Add 10 µL of 0.5 M EDTA, pH 8.0, to each microcentrifuge tube. Mix by tapping
and incubate on ice for at least 10 min to terminate the digestions.
8. Prepare a 14 × 13 cm CHEF agarose gel by pouring 130 mL of 1% agarose (in
0.5× TBE buffer) at about 50°C into a 14 × 13 cm gel casting stand (Bio-Rad).
Use two 15-well 1.5-mm-thick combs (Bio-Rad) bound together with tape for the
samples. Set aside several milliliters of 1% agarose (in 0.5× TBE buffer) at 65°C.

9. Load each sample from step 7 into the center wells of the agarose gel with a
spatula. Load the h ladder PGF marker into the wells on the two sides of the gel.
Seal the wells with the 1% agarose reserved at 65°C.
10. Run the gel at 1–50 s linear ramp, 6 V/cm, 14°C in 0.5× TBE buffer for 18–20 h.
11. Stain the gel with 0.5 µg/mL EtBr and take a photograph (see Note 7). Figure 3
shows an example for the partial digestions of DNA plugs with serial dilutions of
HindIII at 37°C for 40 min.
3.4.2. DNA Fragment Size Selection
1. Soak required number of plugs (e.g., 6 plugs) as in Subheading 3.4.1., step 1.
2. Prepare a buffer mixture and dispense it into a set of microcentrifuge tubes (12
microcentrifuge tubes for 6 plugs) as in Subheading 3.4.1., step 2.
3. Chop each half plug and treat the chopped plug pieces as in Subheading 3.4.1.,
step 3.
4. Make the restriction enzyme dilution that produced the most DNA fragments in
the range of 100–400 kb in the pilot partial digestion. For the batch of DNA plugs
used in Fig. 3, 0.8 U/µL HindIII dilution (4 U of HindIII per half plug when 5 µL
is used) was used for DNA fragment preparation.
5–7. Follow Subheading 3.4.1., steps 5–7, except that 5 µL of the same enzyme dilu-
tion prepared in step 4 is added to each of the microcentrifuge tubes in step 3.
8. Prepare a 14 × 13 cm CHEF agarose gel by pouring 130 mL of 1% agarose in
Fig. 3. Partial digestions of DNA plugs with serial dilutions of HindIII at 37°C for
40 min. DNA was separated on 1% CHEF agarose gel at 1–50 s linear ramp, 6 V/cm,
14°C in 0.5× TBE buffer for 20 h. The marker used is h ladder PFG.

14 Luo and Wing
0.5× TBE buffer at about 50°C into a 14 × 13 cm gel casting stand. Use a trimmed
comb made by taping together several teeth of two 15-well 1.5-mm-thick combs
to make a single well for the sample according to the sample vol.
9. Load the samples from step 7 into the well with a spatula. Load the h ladder PFG
marker into the individual wells on the two sides of the gel. Seal the wells with
1% agarose in 0.5× TBE buffer maintained at 65°C.
10. Run the gel at 1–50 s linear ramp, 6 V/cm, 14°C in 0.5× TBE buffer for 18–20 h.
11. Stain the two sides of the gel containing the marker and a small part of the sample
with 0.5 µg/mL EtBr and take a photograph with a ruler at one side (Fig. 4A).
12. Recover two gel fractions (first size-selected fractions: a and b) from the
unstained center part of the gel corresponding to 150–250 and 250–350 kb
located by a ruler (Fig. 4B).
13. Place the two gel fractions side by side (with a gap between them) on the top of a
14 × 13 cm gel casting stand with the orientation the same as in the original gel in
step 12. Pour 130 mL of 1% agarose in 0.5× TBE at about 50°C into the gel
casting stand to form a second gel encasing the two gel factions.
14. Run the gel at 4 s constant time, 6 V/cm, 14°C in 0.5× TBE buffer for 18–20 h.
15. Stain the two sides with 0.5 µg/mL EtBr, each containing a small part of one of
the two first size-selected fractions, and the center part that contains the small
parts of both first size-selected fractions. Take a photograph with a ruler at one
side.
16. For each first size-selected fraction (a and b), recover two gel fractions (second
size-selected fractions: a1 and a2, and b1 and b2) located by a ruler (Fig. 5). Gel
fractions are used immediately or stored at –20°C in 70% ethanol (see Note 5).
Fig. 4. An example for the first size selection of genomic DNA fragments. (A)
Staining the two sides of the gel and taking a photograph with a ruler. (B) Recovering
two gel fractions from the unstained center part of the gel corresponding to 150–250
and 250–350 kb located by a ruler.

3.5. BAC Library Construction
3.5.1. DNA Ligation
1. Transfer required amount of each 70% ethanol-stored fraction (e.g., one-third to
one-half fraction) into 1× TAE buffer (more than 20 vol) at 4°C the day before
use (see Note 8).
2. Electroelute high molecular weight genomic DNA at 4°C from fresh gel frac-
tions or 1× TAE buffer soaked 70% ethanol-stored fractions in 1× TAE buffer.
Either dialysis tubing (20) or Model 422 electro-eluter (18) can be used. Eluted
DNA should be used as soon as possible (use it the same day it is eluted). Always
use pipet tips with the tips cut off when manipulating high molecular weight
genomic DNA to avoid mechanical shearing.
3. Estimate the DNA concentration by running 5 µL of the eluted DNA along with
2 µL of serial dilutions of h DNA standards (1, 2, 4, 8, and 16 ng/µL) on a 1%
agarose minigel containing 0.5 µg/mL EtBr (for 10 min) and comparing the im-
ages under UV light.
4. Set up ligations: in each microcentrifuge tube, add 4 µL of 5 ng/µL vector and 84
µL of DNA eluted in 1× TAE containing up to 200 ng of high molecular weight
genomic DNA fragments. If the eluted DNA has a high concentration, dilute it
with sterilized water. Incubate the vector–genomic DNA fragment mixture at
65°C for 15 min, cool at room temperature for about 10 min, and add 10 µL of
10× T4 DNA ligase buffer and 2 µL of 3 U/µL T4 DNA ligase. Incubate the
ligations at 16°C overnight.
5. Heat the ligations at 65°C for 15 min to terminate the ligation reactions.
6. Transfer ligation samples into 0.1 M glucose/1% agarose cones (see Subheading
2.5.1.) to desalt for 1.5 h on ice (20) or transfer ligation samples onto filters
(Millipore) floating on 5% polyethylene glycol (PEG)8000 in Petri dishes set on
ice for 1.5 h as modified from Osoegawa et al. (15). Store the ligations at 4°C for
not more than 10 d.
Fig. 5. An example for the second size selection of genomic DNA fragments.

16 Luo and Wing
3.5.2. Test Transformation
1. Thaw ElectroMax DH10B T1 phage-resistant competent cells on ice and dispense
16 µL into prechilled microcentrifuge tubes on ice. Precool the electroporation
cuvettes on ice. Prepare SOC media and dispense 0.5 mL to each sterile 15-mL
culture tube. Label the microcentrifuge tubes, cuvettes, and culture tubes
coordinately.
2. Take 1 to 2 µL of ligated DNA from each ligation sample and mix it with the
competent cells by gentle tapping.
3. Transfer the DNA/competent cell mixture from each microcentrifuge tube into
precooled electroporation cuvettes. Electroporate on ice at 325 DC V with fast
charge rate at a low resistance (4 k1) and a capacitance of 330 µF. We did not
find a significant difference when different DC V between 300–350 V were
applied.
4. Transfer the electroporated cells from each cuvette into sterile 15-mL culture
tubes containing 0.5 mL SOC. Incubate the cultures at 37°C for 1 h with vigorous
shaking.
5. Plate 20 and 200 µL of each culture on 100-mm diameter Petri dish agar plates
containing LB with 12.5 µg/mL of chloramphenicol, 80 µg/mL X-gal, and 100
µg/mL IPTG. Incubate the plates at 37°C overnight.
6. Count the white colonies and determine the number of recombinant clones per
microliter of ligation. This number, the genome size, and the required genome
coverage will be considered to decide if the experiment should be continued. For
example, 3 parallel 100 µL ligations of 100 white colonies/µL with the expected
average insert size of 130 kb will result in about 9 genome coverages for rice
(genome size is 430 Mbp), but only 1.56 genome coverages for maize (genome
size is 2500 Mbp).
3.5.3. Insert Size Estimation
3.5.3.1. BAC DNA ISOLATION
Several automated methods, such as using an Autogen 740 (AutoGen) or
using a Quadra 96 (TomTec) can be used to isolate BAC DNA. A manuscript
for a detailed method for preparing BAC DNA with a Quadra 96 is in prepara-
tion by HyeRan Kim et al. Here we present a manual method adapted from the
Qiagen method.
1. Randomly pick white colonies with sterilized toothpicks and inoculate each into
2 mL of LB containing 12.5 µg/mL chloramphenicol in a sterile 15-mL culture
tube. Grow the cells at 37°C overnight with vigorous shaking.
2. Transfer each cell culture (about 1.5 mL) into a microcentrifuge tube and collect
cells at 16,000g (at room temperature or 4°C) for 10 min; remove supernatant.
3. Add 200 µL of P1. Mix the tubes with a vortex to resuspend pellets at room
temperature.

4. Add 200 µL of P2. Mix the contents gently but thoroughly by inverting the tubes
3 to 4 times. Stand the tubes at room temperature for not more than 3 min.
5. Add 200 µL of P3. Mix the contents gently but thoroughly by inverting the tubes
3 to 4 times. Stand the tubes on ice for 15 min.
6. Centrifuge the samples at 16,000g (at room temperature or 4°C) for 30–40 min.
7. Carefully transfer about 550 µL of each supernatant to a new microcentrifuge
tube containing 400 µL of isopropanol. Mix the contents gently.
8. Centrifuge the samples at 16,000g (at room temperature or 4°C) for 30 min.
9. Remove the supernatant. Add 400 µL of 70% ethanol and centrifuge the samples
at 16,000g for 10 min to wash the DNA pellets.
10. Remove the supernatant carefully with a pipet. Air-dry the DNA pellets, and
resuspend in 60 µL of TE buffer, pH 8.0.
3.5.3.2. BAC INSERT SIZE ANALYSIS
1. Dispense 11 µL of NotI digestion mixture (8.85 µL of water, 1.5 µL of 10× buffer,
0.15 µL of 10 mg/mL BSA, and 0.5 µL of 10 U/µL NotI) into each micro-
centrifuge tube or each well of a 96-well microtiter plate.
2. Add 4 µL of BAC plasmid DNA to each tube or each well. Spin the samples
briefly. Incubate the samples at 37°C for 3 h. Dispense 3 µL of 6× DNA loading
buffer (21) into each tube or each well. Spin the samples briefly.
3. Prepare a 21 × 14 cm CHEF agarose gel by pouring 150 mL of 1% agarose in
0.5× TBE buffer at about 50°C into a 21 × 14 cm gel casting stand. Use a 45-well
1.5-mm-thick comb for the samples.
4. Load DNA samples. Use MidRange I as the size marker.
5. Run the gel at 5–15 s linear ramp, 6 V/cm, 14°C in 0.5× TBE buffer for 16 h.
6. Stain the gel with 0.5 µg/mL EtBr. Take a photograph of the gel. Analyze the
insert sizes.
3.5.4. Bulk Transformation, Colony Array, and Library Characterization
If the test colonies meet the requirement for average insert size and empty
vector rate, transform all ligated DNA into ElectroMax DH10B T1 phage-
resistant competent cells. Pick individual colonies into wells of 384-well plates
containing freezing media manually or robotically (Q-Bot) and character-
ize the BAC library by insert size analysis of random clones. Store the BAC
library at –80°C.
4. Notes
1. pIndigoBAC536 has the same sequence as pBeloBAC11, except that the inter-
nal EcoR1 site was destroyed so that the unique EcoR1 site in the multiple clon-
ing site can be used for cloning, and a random point mutation was selected for in
the lac Z gene that provides darker blue colony color on X-gal/IPTG selection.
The GenBank® accession number for pBeloBAC11 is U51113.
2. CIP is active in many different buffers.

18 Luo and Wing
3. Plug preparation is a critical part of the work for plant BAC library construction.
Many failures are attributed to the plugs not containing enough megabase DNA.
To increase the DNA content in plugs, more starting material can be used, and
the resultant nuclei can be imbedded in fewer plugs. However, at least 25–35
plugs for each preparation are required for convenient subsequent manipulation.
The same batch of plugs should be used for pilot partial digestion and scaled
partial digestion for BAC library construction.
4. Do not grind the material to a complete powder, as novices in this field usually
do. Overgrinding reduces the yield of nuclei dramatically.
5. Allow to stand at room temperature for about 30 min or at 4°C overnight before
transferring to –20°C to avoid freezing the center part of the gel slices. Freezing
causes high molecular weight DNA to shear.
6. If the 70% ethanol-stored plugs are needed to be used the same day, soak them in
a large vol of sterilized distilled water (40 mL in a 50-mL Falcon tube) at room
temperature for 3 h with gentle shaking and several changes of sterilized distilled
water.
7. If the DNA in the completely cut control is not well digested (most of the DNA
fragments should be below 50 kb after complete digestion), rewash the DNA
plugs or use a different restriction enzyme. If a restriction condition to produce
most of the DNA fragments in the range of 100–400 kb is not found, because of
insufficient digestion or over digestion, repeat the pilot partial digestion with
higher or lower enzyme concentrations respectively.
8. Similar to Note 6, if the 70% ethanol-stored fractions are needed to be used the
same day, soak them in a large vol of 1× TAE buffer (40 mL in a 50-mL Falcon
tube) at room temperature for 3 h with gentle shaking and several changes of 1×
TAE buffer.
Acknowledgments
Jose Luis Goicoechea for BAC plasmid DNA preparation. We thank Dave
Kudrna for his critical reading and suggestions.
References
1. Burke, D. T., Carle, G. F., and Olson, M. V. (1987) Cloning of large segments of
exogenous DNA into yeast by means of artificial chromosome vectors. Science
236, 806–812.
2. Anderson, C. (1993) Genome shortcut leads to problems. Science 259, 1684–1687.
3. Zhang, H. B. and Wing, R. A. (1997) Physical mapping of the rice genome with
BACs. Plant Mol. Biol. 35, 115–127.
4. Shizuya, H., Birren, B., Kim, U.-J., et al. (1992) Cloning and stable maintenance
of 300-kilobase-pair fragments of human DNA in Escherichia coli using an F-
factor-based vector. Proc. Natl. Acad. Sci. USA 89, 8794–8797.
5. Woo, S. S., Jiang, J., Gill, B. S., Paterson, A. H., and Wing, R. A. (1994) Con-
struction and characterization of a bacterial artificial chromosome library of Sor-
ghum bicolor. Nucleic Acids Res. 22, 4922–4931.

6. Choi, S. D., Creelman, R., Mullet, J., and Wing, R. A. (1995) Construction and
characterization of a bacterial artificial chromosome library from Arabidopsis
thaliana. Weeds World 2, 17–20.
7. Chen, M., Presting, G., Barbazuk, W. B., et al. (2002) An integrated physical and
genetic map of the rice genome. Plant Cell 14, 537–545.
8. Luo, M., Wang, Y.-H., Frisch, D., Joobeur, T., Wing, R. A., and Dean, R. A.
(2001) Melon bacterial artificial chromosome (BAC) library construction using
improved methods and identification of clones linked to the locus conferring
resistance to melon Fusarium wilt (Fom-2). Genome 44, 154–162.
9. Budiman, M. A., Mao, L., Wood, T. C., and Wing, R. A. (2000) A deep-coverage
tomato BAC library and prospects toward development of an STC framework for
genome sequencing. Genome Res. 10, 129–136.
10. Tomkins, J. P., Mahalingam, R., Smith, H., Goicoechea, J. L., Knap, H. T., and
Wing, R. A. (1999) A bacterial artificial chromosome library for soybean PI
437654 and identification of clones associated with cyst nematode resistance.
Plant Mol. Biol. 41, 25–32.
11. Yu, Y., Tomkins, J. P., Waugh, R., et al. (2000) A bacterial artificial chromosome
library for barley (Hordeum vulgare L.) and the identification of clones contain-
ing putative resistance genes. TAG 101, 1093–1099.
12. Couzin, J. (2002) NSF’s ark draws alligators, algae, and wasps. Science 297,
1638–1639.
13. Amemiya, C. T., Ota, T., and Litman, G. W. (1996) Nonmammalian Genomic
Analysis: A Practical Guide (Lai, E. and Birren, B., eds.), Academic Press, San
Diego, pp. 223–256.
14. Birren, B., Green, E. D., Klapholz, S., Myers, R. M., and Roskams, J. (eds.) (1997)
Analyzing DNA. CSH Laboratory Press, Cold Spring Harbor, NY.
15. Osoegawa, K., Woon, P. Y., Zhao, B., et al. (1998) An improved approach for
construction of bacterial artificial chromosome libraries. Genomics 52, 1–8.
16. Zhang, H. B., Woo, S. S., and Wing, R. A. (1996) Plant Gene Isolation (Foster, G.
and Twell, D., eds.), John Wiley & Sons, New York, pp. 75–99.
17. Choi, S. and Wing, R. A. (2000) Plant Molecular Biology Manual, 2nd ed.
(Gelvin, S. and Schilperoort, R., eds.), Kluwer Academic Publishers, Norwell,
MA, pp. 1–28.
18. Peterson, D. G., Tomkins, J. P., Frisch, D. A., Wing, R. A., and Paterson, A. H.
(2000) Construction of plant bacterial artificial chromosome (BAC) libraries: an
illustrated guide. J. Agric. Genomics 5, (http://www.ncgr.org/jag).
19. Strong, S. J., Ohta, Y., Litman, G. W., and Amemiya, C. T. (1997) Marked
improvement of PAC and BAC cloning is achieved using electroelution of pulsed-
field gel-separated partial digests of genomic DNA. Nucleic Acids Res. 25,
3959–3961.
20. Atrazhev, A. M. and Elliott, J. F. (1996) Simplified desalting of ligation reactions
immediately prior to electroporation into E. coli. BioTechniques 21, 1024.
21. Sambrook, J. and Russell, D. W. (eds.) (2001) Molecular Cloning: A Laboratory
Manual. CSH Laboratory Press, Cold Spring Harbor, NY.

Methylation Filtration 21
21
2
Constructing Gene-Enriched Plant Genomic Libraries
Using Methylation Filtration Technology
Pablo D. Rabinowicz
Summary
Full genome sequencing in higher plants is a very difficult task, because their genomes are
often very large and repetitive. For this reason, gene targeted partial genomic sequencing
becomes a realistic option. The method reported here is a simple approach to generate gene-
enriched plant genomic libraries called methylation filtration. This technique takes advantage
of the fact that repetitive DNA is heavily methylated and genes are hypomethylated. Then, by
simply using an Escherichia coli host strain harboring a wild-type modified cytosine restriction
(McrBC) system, which cuts DNA containing methylcytosine, repetitive DNA is eliminated
from these genomic libraries, while low copy DNA (i.e., genes) is recovered. To prevent clon-
ing significant proportions of organelle DNA, a crude nuclear preparation must be performed
prior to purifying genomic DNA. Adaptor-mediated cloning and DNA size fractionation are
necessary for optimal results.
Key Words
gene-enriched libraries, shotgun sequencing, Mcr, DNA methylation, retrotransposons, gene
discovery, repetitive DNA
1. Introduction
Highly accurate full genomic sequencing like that performed for example in
Saccharomyces cerevisiae (1) and Caenorhabditis elegans (2) has proven to be
an invaluable resource to accelerate all areas of biological research. In particu-
lar in plants, the Arabidopsis thaliana genome sequence has been deciphered,
meeting the highest standards of accuracy (3). Undoubtedly, the availability of
this information had an immense impact not only in the Arabidopsis commu-
nity, but in research in all other plant systems as well. Unfortunately, the pro-
duction of such a high quality genomic resource is not an easy task. It implies

22 Rabinowicz
a significant amount of sequence redundancy only achievable by producing a
huge number of sequence reads. Such reads are assembled and processed to
produce as long contiguous stretches as possible, called contigs. In order to
link these contigs in the right order and orientation, a large insert genomic
library (using bacterial artificial chromosome [BAC] or P1-derived artificial
chromosome [PAC] vectors) needs to be constructed, at least partially
sequenced, and physically mapped.
A major obstacle to obtain the complete and accurate sequence of a complex
(i.e., eukaryote) genome is the presence of large amounts of repetitive DNA.
This DNA is composed of satellite DNA, transposons and retrotransposons,
among other repeats, which often show a high degree of sequence conserva-
tion. For this reason, the computer software designed to assemble random
sequence reads fails to build correct contigs of repetitive sequences, usually
assembling most members of a repeat family in a single contig, regardless of
their actual location in the genome.
In the early 1980s by the time the idea of sequencing the human genome was
opened to discussion for the first time (4), Putney et al. (5) reported a method
that allowed to discover new genes simply by cDNA sequencing, later called
expressed sequence tag (EST) sequencing (6). This widely used technique
allows obtaining gene sequence information getting around the problem of
sequencing repetitive DNA. However, the EST approach has two main limita-
tions. The first is the redundancy of cDNA libraries. Some cDNAs are often
overrepresented and will be sequenced many times before a cDNA correspond-
ing to a weakly expressed gene is found. The second limitation is the partial
representation due to the tissue-specific and developmental regulation of gene
expression. Some genes are expressed only in certain tissues or cells, and some
are developmentally regulated. In order to recover the corresponding ESTs,
libraries from several different tissues and developmental stages need to be
constructed. Another although minor, disadvantage of EST sequencing is that
repetitive elements are often transcribed and thus included in EST collections.
One way to solve the problem of the redundancy is to use normalized librar-
ies (7). Normalization techniques are based on reassociation kinetics and have
been improved to avoid the elimination of members of gene families. How-
ever, it is not trivial to obtain a normalized library where representation is
acceptable. Regardless of these limitations, EST projects are being conducted
for many organisms and are a key tool for gene discovery, annotation of genes,
cross-species comparative analysis, and definition of intron–exon boundaries
among many other uses. In particular for plants, ESTs have been the alterna-
tive to full genome sequence, because the genomes of many plants, often
important crop species, are very large and repetitive. Usually, the genome size
(or subgenome size in the case of polyploids) correlates with the proportion of

repetitive DNA. It has been proposed that all diploid higher plant genomes
share essentially the same set of genes, called the “gene space” (8). Then, the
bigger the genome, the higher sequencing cost per gene, due to the amount of
nongenic (e.g., repetitive) DNA that needs to be sequenced before reaching a
gene.
The conservation of coding sequences across different species allows iden-
tifying genes simply by comparing two different genomes. Frequently, gene
modeling software fails to identify genes that can be spotted with this com-
parative genomics approach. Furthermore, once the complete genomic
sequence is obtained for one organism, it can be compared to a draft (lowly
redundant and discontinuous) sequence of a related organism. This approach
yields a lot of new information for both species under analysis. The additional
advantage of genomic vs cDNA sequencing in terms of representation makes
the lowly redundant genomic sequencing a cost-effective process. In the case
of plants however, the large genome sizes prevent the pursuit of full or even
draft genomic sequencing projects. For these reasons, alternatives to obtain
genomic sequences enriched in genes avoiding the repetitive DNA have been
developed. In maize for example, the very active transposon Mutator (9) shows
a strong bias to insert in low copy DNA (i.e., genes). By generating large
Mutator-induced insertional mutagenesis, it is possible to collect genomic
sequences flanking transposon insertion sites, which will mainly correspond to
genes (10). Although Mutator insertions may not be completely at random in
the genome, it can be a good complement to an EST project.
Another alternative for gene enriched genomic sequencing of plants is the
methylation filtration technique, which takes advantage of the fact that most of
the repetitive elements in plants are heavily methylated, while genes are
hypomethylated. Because of their methylation status, repeats are sensitive to
bacterial restriction-modification systems, in particular the Mcr system (11,12),
which includes two restriction enzymes: McrA and McrBC. McrBC recog-
nizes DNA containing 5-methylcytosine preceded by a purine (13). Restriction
requires two of these sites separated by 40–2000 nucleotides. Such recognition
sites are very frequent in any methylated genomic DNA. Thus, by the selecting
a mcrBC+ Escherichia coli host strain, repetitive DNA can be largely excluded
from genomic shotgun libraries, preserving the low copy DNA. Basically,
methylation filtration consists in shearing and size fractionation of genomic
DNA to select fragments smaller than the estimated size of the genes. Larger
fragments have a high probability of including some portion of repetitive DNA,
which would be methylated and thus counter-selected in the filtered library.
On the other hand, if fragments are too small, there are more chances to
recover small fragments of repetitive DNA with low GC content. Such frag-
ments may be poor in methylated sites susceptible to restriction by McrBC and

24 Rabinowicz
then can be frequently recovered in filtered libraries. The selected fragments
are then end-repaired and cloned into a standard sequencing vector. Subse-
quently, the ligation is introduced in a mcrBC+ E. coli host. The recombinant
clones isolated after plating are picked for automatic sequencing. The same
ligation mixture can be transformed into a mcrBC- E. coli strain to obtain an
unfiltered control library.
The technique works very well for maize (14), and there is evidence that it
works for many other plants (Rabinowicz and Martienssen, unpublished). The
advantage of methylation-filtered libraries vs cDNA and transposon insertion
libraries is that there is no bias towards a certain region of the genome or a
given fraction of the genes. It is possible though, that methylated genes are not
recovered in filtered libraries. However, gene methylation is often restricted to
defined regions of the gene, mainly the ends (15–17). This would allow to
clone at least most of the coding sequence of methylated genes. Furthermore,
genes that are regulated by methylation may become demethylated during dif-
ferent developmental stages. In these cases, the construction of methylation-
filtered libraries from a couple of developmental stages of a given plant would
likely overcome the problem. For larger scale projects, another problem is
posed by the cloning efficiency. In plants with very large genomes, repetitive
DNA may account for more than 90% of the nuclear DNA. Then, most of the
DNA is likely to be methylated leaving a very small fraction of the genome to
be recovered in methylation-filtered libraries. As a result, the number of
recombinant clones recovered after plating a filtered library may be <10% of
the number of clones obtained in the corresponding unfiltered control library.
Furthermore, the proportion of nonrecombinant background (blue colonies)
may become significant. The use of adaptors often improves the cloning effi-
ciency in addition to reduce the formation of chimerical clones. The cloning
protocol presented here uses three-nucleotide overhang adaptors and a com-
patible sticky-end vector made by filling in one nucleotide in the four-
nucleotide 5' overhang generated by a restriction nuclease (18). The advantage
of using three- vs four-nucleotide overhang is that the nonrecombinant back-
ground is highly reduced because the vector ends become incompatible.
2. Materials
2.1. Nuclear DNA Preparation
1. Isolation buffer 1 (IB 1): 25 mM citric acid (pH to 6.5 with 1 M NaOH), 250 mM
sucrose, 0.7% Triton® X-100, 0.1% 2-mercaptoethanol (see Note 1). IB 1 can be
prepared at a 5× concentration. 2-Mercaptoethanol should be added immediately
before usage.
2. Centrifuge tubes.
3. Liquid N2.

4. Blender.
5. Polytron (Brinkmann Instruments).
6. Two 15-cm wide funnels.
7. Ring stand and clamps.
8. Cheesecloth (Fisher Scientific).
9. 60-µm Nylon mesh (Millipore).
10. 500-mL Centrifuge bottles with rubber o-ring sealing cap (Nalgene).
11. Isolation buffer 2 (IB 2): 50 mM Tris-HCl, pH 8.0, 25 mM EDTA, 350 mM sor-
bitol 0.1% 2-mercaptoethanol.
12. 5% Sarkosyl.
13. 5 M NaCl.
14. CTAB solution: 8.6% CTAB (Sigma), 0.7 M NaCl.
15. Chloroform:octanol (24:1).
16. Isopropanol.
17. 70% ethanol.
18. 10 mM Tris-HCl, pH 8.0.
19. Glass rod with bent tip.
2.2. DNA Shearing and End-Repairing
1. Glycerol 50%.
2. 10× Nebulization buffer: 0.5 M Tris-HCl, pH 8.0, 150 mM MgCl2.
3. 14-mL Falcon® tubes (Becton Dickinson, cat. no. 35–2059).
4. Aero-mist nebulizer (CIS-US; cat. no. CA-209).
5. N2 gas cylinder with a regulator able to deliver 1–50 psi.
6. Three-sixteenths-inch internal diameter PVC tubing (Fisher Scientific).
7. Parafilm.
8. 5 M NaCl.
9. Ethanol.
10. 70% Ethanol.
11. SpeedVac® (Savant Instruments).
13. dNTPs 0.5 mM each (Roche Molecular Biochemicals).
14. T4 DNA polymerase (New England Biolabs).
15. T4 DNA polymerase buffer (New England Biolabs).
16. Klenow enzyme (Roche Molecular Biochemicals).
17. QIAquick™ polymerase chain reaction (PCR) purification kit (Qiagen).
18. T4 Polynucleotide kinase (PNK) (New England Biolabs).
19. T4 PNK buffer (New England Biolabs).
20. 100 mM ATP (Roche Molecular Biochemicals).
21. Equilibrated phenol:chloroform (1:1).

26 Rabinowicz
2.3. Adaptor Ligation
1. 200 µM Top adaptor oligonucleotide 5'[P]-TAGACGCCTCGAG.
2. 200 µM Bottom adaptor oligonucleotide 5'[OH]-CTCGAGGCGT.
3. 1 M NaCl.
4. T4 DNA ligase (Roche Molecular Biochemicals).
5. T4 DNA ligase buffer (Roche Molecular Biochemicals).
6. TEN buffer: 10 mM Tris-HCl, pH 7.5, 0.1 mM EDTA, 25 mM NaCl.
7. cDNA size fractionation columns (Invitrogen, Carlsbad, CA, USA).
2.4. Vector Preparation
1. Supercoiled pUC 19 DNA.
2. XbaI (Roche Molecular Biochemicals).
3. H buffer (Roche Molecular Biochemicals).
4. L buffer (Roche Molecular Biochemicals).
5. 10 mg/mL bovine serum albumin (BSA) (New England Biolabs).
6. 1 mM dCTP (Roche Molecular Biochemicals).
7. Klenow enzyme (Roche Molecular Biochemicals).
8. Calf intestinal phosphatase (CIP) (Roche Molecular Biochemicals).
9. CIP buffer (Roche Molecular Biochemicals).
10. 0.5 M EDTA.
11. Equilibrated phenol:chloroform (1:1).
12. QIAquick PCR purification kit.
13. Chloroform.
14. 5 M NaCl .
15. Ethanol.
16. 70% Ethanol.
2.5. Preparation of Electrocompetent Cells
1. SOB medium without magnesium: 20 g/L bacto-tryptone, 5 g/L bacto-yeast
extract, 2.5 mM KCl, and 0.5 g/L NaCl (pH 7.0 with NaOH, autoclaved).
2. 10% Glycerol (autoclaved).
3. Sterile 250-mL centrifuge bottles with rubber o-ring sealing cap.
4. Sterile 14-mL centrifuge tubes.
2.6. Electroporation
1. Electroporation cuvettes 0.1 cm (Bio-Rad).
2. Electroporator (Bio-Rad).
3. SOC medium: 20 g/L bacto-tryptone, 5 g/L bacto-yeast extract, 2.5 mM KCl, and
0.5 g/L NaCl (pH 7.0 with NaOH, autoclaved, sterile 2 M MgCl2, and 1 M glu-
cose are added to a final concentration of 10 and 20 mM, respectively, after cool-
ing down).
4. Sterile 14-mL centrifuge tubes.

5. Isopropyl `-D-thiogalactopyranoside (IPTG) 200 mg/mL.
6. 5-Bromo-4-chloro-3-indolyl-`-D-galactopyranoside (X-gal) 20 mg/mL in
dimethylformamide.
7. LB-ampicillin agar plates: 10 g/L bacto-tryptone, 5 g/L bacto-yeast extract, 10 g/L
NaCl (pH 7.0 with NaOH); agar is added to a final concentration of 1.5%, auto-
claved, cooled to 55°C, ampicillin is added to a final concentration of 100 µg/
mL, and plates are poured).
2.7. Ligation
1. Ligation buffer.
2. Ligase (Roche Molecular Biochemicals).
3. 10 mM NaCl.
4. QIAquick PCR purification kit.
2.8. Checking the Average Library Insert Size by Colony PCR
1. 10× PCR buffer (Qiagen).
2. dNTP mixture (10 mM each dNTP) (Qiagen).
3. Taq DNA polymerase 5 U/µL (Qiagen).
4. 10 µM M13/pUC sequencing (–40) primer (New England Biolabs).
5. 10 µM M13/pUC reverse sequencing (–24) primer (New England Biolabs).
6. 250 µL PCR tubes or 8-strips (MJ Research).
3. Methods
3.1. Nuclear DNA Preparation
Plastids are very abundant, not only in green tissues, and their DNA is
unmethylated. Thus, if chloroplast DNA is present in a DNA sample, it will be
selected during the filtering process. For this reason, it is important to purify
nuclei from the rest of the cell organelles before purifying the genomic DNA.
The protocol used here is a modification of those reported by Kiss et al. and
Wagner et al. (19,20).
1. In a cold room, prepare a ring stand with two funnels attached with clamps, one
on top of the other, so that the top funnel drains inside the bottom one. Cover the
upper funnel with four 30 × 30 cm layers of cheese cloth and the lower one with
one 30 × 30 cm layer of 60-µm nylon mesh. Put a 500-mL centrifuge bottle under
the lower funnel to collect the liquid.
2. Grind 50–100 g of frozen tissue in liquid N2 (see Note 2).
3. Transfer to a blender containing 6–8 vol of IB 1.
4. Homogenize 3× at maximum speed for 10 s each time.
5. Transfer to a plastic beaker and further homogenize 3× with a polytron, 5 s each
time (see Note 3).
6. Slowly pour the slurry into the top funnel.
7. When it stops dripping, squeeze the liquid out of the cheese cloth using gloves.

28 Rabinowicz
8. Centrifuge at 2000g for 15 min at 4°C.
9. Carefully discard the supernatant and resuspend the nuclear pellet in 0.1–0.5 vol
of IB 1.
10. Transfer to 14- or 50-mL centrifuge tubes and centrifuge at 2000g for 15 min at
4°C.
11. Resuspend in 5–20 mL of IB 2.
12. Add one-fifth vol of 5% Sarkosyl.
13. Mix gently and incubate 15 min at room temperature.
14. Add one-seventh vol of 5 M NaCl and mix gently.
15. Add one-tenth vol of CTAB solution preheated to 60°C.
16. Mix gently and incubate for 30 min at 60°C, mixing by inversion every 2–4 min.
17. Add 1 vol of chloroform:octanol and mix well by inversion (do not vortex mix).
18. Centrifuge at 6000g for 15 min at 4°C.
19. Transfer upper phase to a new centrifuge tube.
20. Add two-thirds vol of isopropanol and mix slowly by inversion.
21. Hook the DNA with a glass rod bent in the tip to help preventing the DNA from
falling off (see Note 4).
22. Wash the nuclear DNA by immersing the glass rod in 70% ethanol.
23. Air-dry the DNA for a few minutes.
24. Immerse the DNA in 0.5–1 mL 10 mM Tris-HCl, pH 8.0, and shake it quickly
until it falls off the glass rod.
25. Let the DNA resuspend overnight at 4°C.
3.2. DNA Shearing and End-Repairing
1. In a 14-mL Falcon centrifuge tube, mix 20 µg of nuclear DNA with 1 mL of 50%
glycerol and 0.2 mL of nebulization buffer. Add water up to a final vol of 2 mL.
2. Seal the bottom nebulizer inlet with parafilm.
3. Remove the nebulizer screw-cap and transfer the DNA mixture to the bottom of
the nebulizer.
4. Put the nebulizer cap and attach N2 gas tubing in the bottom inlet. Close the
upper nebulizer outlet with the Falcon tube cap.
5. While holding the cap, apply N2 gas at 8–10 psi for 2 min (see Note 5).
6. Remove the tubing and spin down the nebulizer 1 min at 1500g (see Note 6).
7. Precipitate the DNA with one-fiftieth vol of 5 M NaCl and 2 vol of ethanol.
8. Keep at –20°C overnight.
9. Centrifuge at 12,000g for 30 min at 4°C.
10. Add 3 mL of 70% ethanol and centrifuge at 12,000g for 10 min at 4°C.
11. Dry in speedVac (see Note 7) and resuspend in the necessary vol of 5 mM Tris-
HCl, pH 8.0, to reach a final vol of 100 µL after adding the reagents of the next
step.
12. Transfer to a 1.5-mL tube and add 10 µL of dNTPs (0.5 mM each), 20 U T4 DNA
polymerase, and 10 µL T4 DNA polymerase buffer.
13. Incubate 15 min at 30°C.
14. Add 6 U Klenow enzyme.

16. Clean up through a QIAquick column (see Note 8).
17. Elute with 50 µL of 10 mM Tris-HCl, pH 8.0 (EB buffer; Qiagen).
18. Collecting the liquid in the same tube, re-elute with the necessary vol of water to
reach a final vol of 100 µL after adding the reagents of the next step.
19. Add 5 U T4 PNK, 10 µL T4 PNK buffer, and 2 µL ATP 100 mM.
21. Add 100 µL of water and extract with 200 µL of phenol:chloroform by vortex
mixing and centrifuging at 12,000g.
22. Transfer the upper phase to a new tube and extract with 200 µL of chloroform by
vortex mixing and centrifuging at 12,000g.
23. Transfer the upper phase to a new tube and precipitate with one-fiftieth vol of 5 M
NaCl and 2 vol of ethanol.
24. Leave at –20°C overnight.
26. Add 400 µL of 70% ethanol and centrifuge at 12,000g for 10 min at 4°C.
27. Dry and resuspend in 20 µL of 10 mM Tris-HCl, pH 8.0.
3.3. Adaptor Ligation
1. In a 1.5-mL tube, mix 10 µL of top adaptor oligonucleotide and 10 µL of bottom
adaptor oligonucleotide (see Note 9).
2. Add 0.5 µL of 1 M NaCl.
3. Incubate 2 min at 75°C and anneal for at least 2 h by cooling down very slowly to
4°C.
4. In a new 1.5-mL tube, mix 10 µL of end-repaired DNA, 20 µL of annealed adap-
tor, 4 µL of T4 DNA ligase buffer, 10 U of T4 DNA ligase, and water to a final
vol of 40 µL.
5. Incubate 24 h at 12°C (see Note 10).
6. Add 60 µL of TEN buffer (see Note 11).
7. Place the size fractionation column in a support and remove first the top and then
the bottom cap (see Note 12).
8. Drain the liquid by gravity.
9. Wash the column by adding 800 µL of TEN buffer and allowing to drain com-
pletely.
10. Repeat the wash three more times.
11. Label 20 1.5-mL tubes and align them in a rack.
12. Add the adapted DNA to the upper frit of the column and allow to drain com-
pletely into the first 1.5-mL tube.
13. Add 100 µL of TEN buffer and collect the effluent in the second tube.
14. Add another 100 µL of TEN buffer and begin to collect a single drop per tube
until complete drain.
15. Repeat the last step until 18 drops have been collected.
16. Run 3 µL of each fraction in an agarose gel.
17. Pool the first three fractions where DNA can be detected in the gel (see Note 13).

30 Rabinowicz
3.4. Vector Preparation
1. In a 1.5-mL tube, mix 2 µg of pUC 19 DNA, 30 U of XbaI, 6 µL of buffer H, and
water up to 60 µL (see Note 14).
2. Incubate 2 h at 37°C.
3. Inactivate the enzyme incubating 20 min at 65°C.
4. Chill on ice and add 4 µL of buffer L, 2 µL of 10 mg/mL BSA, 4 µL of 1 mM
dCTP, 8 U of Klenow enzyme, and water up to a final vol of 100 µL.
6. Inactivate the enzyme incubating 15 min at 65°C.
7. Clean up the DNA through a QIAquick column.
8. Elute with 50 µL of 10 mM Tris-HCl, pH 8.0.
9. Re-elute in the same tube with 39 µL of water.
10. Add 10 µL of CIP buffer and 1 µL of 2 U/µL CIP.
12. Add 2 µL 0.5 M EDTA and incubate 15 min at 65°C.
13. Add 100 µL water.
14. Extract with 200 µL of phenol:chloroform.
15. Extract with 200 µL of chloroform.
16. Precipitate with one-fiftieth vol of 5 M NaCl and 2 vol of ethanol.
17. Leave overnight at –20°C.
19. Add 500 µL of 70% ethanol and centrifuge at 12,000g for 10 min at 4°C.
20. Dry and resuspend in 100 µL of 10 mM Tris-HCl, pH 8.0 (see Note 15).
3.5. Preparation of Electrocompetent JM107 or JM107MA2 Cells
This protocol was modified from the manual by Sambrook and Russell (21)
(see Note 16).
1. Use one JM107 or JM107MA2 colony from a fresh plate to inoculate 3 mL of LB
medium. Incubate at 37°C overnight with shaking.
2. Take 2 mL of the overnight culture to inoculate 500 mL of SOB medium without
magnesium. Incubate at 37°C shaking at 250–300 rpm until reaching an OD550 of
0.6–0.7.
3. Chill the culture on ice for 20 min and transfer to two 250-mL centrifuge bottles.
Centrifuge at 2500g at 4°C for 15 min.
4. Repeat the wash in 10% glycerol. Discard the supernatant and resuspend each
pellet in 10 mL of chilled 10% glycerol.
5. Transfer to two 14-mL centrifuge tubes.
6. Centrifuge at 2500g at 4°C for 15 min.
7. Resuspend both pellets in a total of 2 mL of chilled 10% glycerol.
8. Transfer 100 to 200-µL aliquots of the cells suspension to chilled sterile 1.5-mL
microcentrifuge tubes. Freeze the cells in liquid N2 and store at –70°C (see Note
17).

3.6. Ligation
1. In a 1.5-mL tube, mix 5–10 ng of vector, 10–100 ng of adapted and size fraction-
ated genomic DNA (step 17 from Subheading 3.3.), 1 µL of ligation buffer, 1 U
of ligase, and take to a final vol of 10 µL with water.
2. Incubate 16 h at 12°C.
3. Add 90 µL of 10 mM NaCl.
4. Clean up the reaction using a QIAquick column, eluting in 50 µL of 10 mM Tris-
HCl, pH 8.0.
3.7. Electroporation
1. Thaw electrocompetent cells in ice.
2. Mix 30 µL of cells with 1–3 µL of cleaned up ligation reaction in a chilled 1.5-
mL tube.
3. Transfer the mixture to a chilled 0.1-cm gap electroporation cuvette and
electroporate at 1.8 kV. Immediately add 750 µL of SOC medium and transfer to
a sterile 14-mL centrifuge tube.
4. Incubate cells at 37°C for 45 min with gentle shaking.
5. Plate aliquots of approx 200 µL of cells together with 50 µL IPTG and 50 µL
X-gal in LB-ampicillin plates.
6. Incubate overnight at 37°C.
3.8. Checking the Average Library Insert Size by Colony PCR
1. In a 1.5-mL tube, mix 60 µL of 10× PCR buffer, 30 µL of 10 µM M13/pUC
sequencing (–40) primer, 30 µL of 10 µM M13/pUC reverse sequencing (–24)
primer, 12 µL of dNTP mixture, 6 µL of 5 U/µL Taq DNA polymerase, and 462
µL of water (see Note 18).
2. Transfer 20 µL of the mixture to each of 30 250-µL PCR tubes.
3. Using an automatic pipet set in 5 µL, pick one white colony into the first PCR
tube and pipet up and down a few times.
4. Repeat the last step for the rest of the tubes using a new tip each time.
5. Put the tubes in a PCR machine under the following program: 5 min at 95°C, then
25 cycles of: 30 s at 95°C, 45 s at 55°C, 3 min 30 s at 72°C, 10 min at 72°C, then
forever at 4°C.
6. Run 10 µL of each reaction in an agarose gel.
7. Estimate the average insert size taking into account that the PCR fragments
include 30–60 bp of vector sequence in each end. The proportion of clones con-
taining repetitive DNA can be estimated as well (see Note 19).
4. Notes
1. For all buffers and solutions all Milli-Q® water (Millipore) is used.
2. When possible, it is preferable to use a tissue with low plastid content (i.e., maize
immature ears). This would reduce the chloroplast DNA contamination. If the
methylation status of a certain kind of gene is known to change with develop-
ment, it should be taken into account at the moment of choosing the tissue for
preparing DNA.

32 Rabinowicz
3. The use of a Polytron can be omitted if the blender properly homogenizes the
tissue. In the case of hard tissue like pine needles, the Polytron may be necessary.
4. If the amount of starting material is small, DNA fibers may not be formed after
adding isopropanol. In this case, the DNA can be recovered by centrifugation at
12,000g for 30 min.
5. The nebulization time and pressure need to be calibrated. Aliquots of DNA can
be taken at different nebulization times and checked in agarose gels. The optimal
nebulization conditions should break down the DNA to fragments mainly
between 1 and 4 kbp.
6. As nebulizers are not designed for centrifugation, a rotor must be adapted to hold
them. For example, the Sorvall® GSA rotor (NEN® Life Science Products) can
be used if the bottoms of the wells are cushioned with paper towels.
7. The pellet is often loose and hard to see. It is advisable not to remove all the 70%
ethanol and dry it for a longer time in the SpeedVac.
8. If a phenol extraction followed by ethanol precipitation is performed instead of
the column clean up, a very hard to dissolve pellet is formed.
9. After annealed, the adaptor looks like this:
5'(P)-TAGACGCCTCGAG-3'
| | | | | | | | | |
3'-TGCGGAGCTC-5'
10. The 3-nucleotide overhang adaptor works very well. However, if necessary, clon-
ing efficiency can be improved by using a double adaptor method (22).
11. Instead of using a column, the DNA can be size-fractionated by agarose gel elec-
trophoresis. In this case, fragments ranging from 1–4 kbp must be eluted from the
gel. One disadvantage of this approach is that a melting step needs to be per-
formed by heating, which may denature the adaptor whose shorter oligonucle-
otide is not covalently linked. Using high quality low melting point agarose like
SeaPlaque GTG agarose (BioWhittaker Molecular Applications) and the
QIAquick gel extraction kit allows to melt the agarose at room temperature, which
helps to overcome the problem. Alternatively, the shorter oligonucleotide can be
added to the vector ligation reaction to improve the ligation efficiency.
12. To avoid the formation of bubbles inside the column, it is advisable to use a
needle to make a hole in the top cap before removing it.
13. Taking the first 3 to 4 fractions in which DNA can be observed in the agarose gel
usually works well. The next fractions may contain unligated adaptors and small
DNA fragments, although they are not visible in the sample loaded in the gel. If
no or few small insert clones are detected after estimating the library insert size
(see Subheading 3.8.), the inclusion of more elution fractions can be considered
for future construction of filtered libraries.
14. pUC 19 and XbaI are used as an example. Other vectors and restriction enzymes
can be used as well. However, the protocols must be adapted accordingly in terms
of selective antibiotic, adaptor sequence, host strain requirements, etc.
15. Before using a vector for library construction, some controls must be performed

by E. coli transformation: (i) vector with no ligase; (ii) self-ligated vector; and
(iii) vector ligated to a control insert. The first two controls should yield no or
very few blue colonies only. The third one should yield no or very few blue
colonies and a large number of white colonies. In this case, the control insert is
made by annealing the longer oligonucleotide used to make the adaptor and
another 13-mer oligonucleotide: 5'(P)-TAGCTCGAGGCGT-3'. When annealed
it looks like this:
5'(P)-TAGACGCCTCGAG-3'
| | | | | | | | | |
3'-TGCGGAGCTCGAT-(P)5'
16. JM107 (23) and JM107MA2 (24) are shown as examples of filtering and
unfiltering strains, respectively. Other strains can be used, e.g., DH5_-E
(mcrBC+) and DH10B (mcrBC-), both of which are available as electrocompetent
from Invitrogen. If commercial strains are used, the protocols should be adapted
to any special requirements of a particular E. coli strain. However, among
mcrBC+ strains, variations in filtering efficiency has been observed (14). Thus,
both the transformation and filtering efficiencies need to be considered when
choosing the strain to approach a large-scale methylation filtration project.
17. After a batch of competent cells is prepared, it must be tested by transforming a
known amount of supercoiled plasmid. Usually the transformation efficiency is
>1 × 1010 colonies/µg of plasmid DNA. Also, cells must be tested for any plas-
mid contamination by doing an electroporation without DNA, which should yield
no colonies in selective medium.
18. The amount of PCR mixture can be increased to compensate for pipeting errors
and to include some useful PCR controls like a blue colony, vector DNA, a water
control, single primer controls, etc. This is a robust PCR assay and any commer-
cially available PCR reagents should work as well as any combination of M13
forward and reverse primers. Instead of using PCR, insert sizes can be checked
by doing plasmid minipreps of white colonies and subsequent restriction enzyme
digestion and agarose gel electrophoresis.
19. An easy way to estimate the number of clones containing repetitive DNA is to
bind a number of clones to a hybridization membrane and hybridize it against
total labeled genomic DNA. In this labeled sample, only the repetitive DNA will
be present in high enough proportion to produce a hybridization signal. Low copy
DNA will be too diluted to show any hybridization. In this way, the high copy
DNA containing clones can be identified as hybridizing clones. The proportion
of high vs low copy clones can be compared to that in a control unfiltered library
to estimate the filtering efficiency of the cloning process. The unfiltered library
is constructed simply by transforming the same ligation mixture used for the
filtered library into a mcrBC- E. coli strain. The hybridization can be performed
on one to a few hundred clones from each library by colony hybridization (21).
For example, for maize, where 80–90% of the genome is composed of repetitive
DNA, a 5- to 10-fold decrease in the proportion of repetitive clones is expected in

34 Rabinowicz
a filtered vs a control library. There may be some variations due to the frequent
methylcytosine to thymine transition. This mutation occurs frequently in silent
repetitive DNA that is not under selective pressure. For this reason, some decayed
repeats can be recovered in filtered libraries. Sequencing and Basic Local Align-
ment Search Tool (BLAST) analysis (25) of a few hundred clones from each
library is an independent way to estimate how well the technique is working.
References
1. Goffeau, A., Barrell, B. G., Bussey, H., et al. (1996) Life with 6000 genes. Sci-
ence 274, 546–567.
2. The C. elegans Sequencing Consortium. (1998) Genome sequence of the nema-
tode C. elegans: a platform for investigating biology. Science 282, 2012–2018.
3. The Arabidopsis Genome Initiative. (2000) Analysis of the genome sequence of
the flowering plant Arabidopsis thaliana. Nature 408, 796–815.
4. Blattner, F. R. (1983) Biological frontiers. Science 222, 719–720.
5. Putney, S. D., Herlihy, W. C., and Schimmel, P. (1983) A new troponin T and
cDNA clones for 13 different muscle proteins, found by shotgun sequencing.
Nature 302, 718–721.
6. Adams, M. D., Kelley, J. M., Gocayne, J. D., et al. (1991) Complementary DNA
sequencing: expressed sequence tags and human genome project. Science 252,
1651–1656.
7. Bento Soares, M. and Bonaldo, M. F. (1998) Constructing and screening normal-
ized cDNA libraries, in Genome Analysis. A Laboratory Manual. Vol. 2. Detect-
ing Genes. (Birren, B., Green, E. D., Klapholz, S., Myers, R. M., and Roskams, J.,
eds.), CSH Laboratory Press, Cold Spring Harbor, NY, pp. 49–158.
8. Barakat, A., Matassi, G., and Bernardi, G. (1998) Distribution of genes in the
genome of Arabidopsis thaliana and its implications for the genome organization
of plants. Proc. Natl. Acad. Sci. USA 95, 10044–10049.
9. Chandler, V. L. and Hardeman, K. J. (1992) The Mu elements of Zea mays. Adv.
Genet. 30, 77–122.
10. Raizada, M. N., Nan, G. L., and Walbot, V. (2001) Somatic and germinal mobility
of the RescueMu transposon in transgenic maize. Plant Cell 13, 1587–1608.
11. Raleigh, E. A. and Wilson, G. (1986) Escherichia coli K-12 restricts DNA con-
taining 5-methylcytosine. Proc. Natl. Acad. Sci. USA 83, 9070–9074.
12. Dila, D., Sutherland, E., Moran, L., Slatko, B., and Raleigh, E. A. (1990) Genetic
and sequence organization of the mcrBC locus of Escherichia coli K-12. J.
Bacteriol. 172, 4888–4900.
13. Sutherland, E., Coe, L., and Raleigh, E. A. (1992) McrBC: a multisubunit GTP-
dependent restriction endonuclease. J. Mol. Biol. 225, 327–348.
14. Rabinowicz, P. D., Schutz, K., Dedhia, N., et al. (1999) Differential methylation
of genes and retrotransposons facilitates shotgun sequencing of the maize genome.
Nat. Genet. 23, 305–308.

15. Walker, E. L. and Panavas, T. (2001) Structural features and methylation patterns
associated with paramutation at the r1 locus of Zea mays. Genetics 159, 1201–
1215.
16. Walbot, V. and Warren, C. (1990) DNA methylation in the Alcohol dehydroge-
nase-1 gene of maize. Plant Mol. Biol. 15, 121–125.
17. Patterson, G. I., Thorpe, C. J., and Chandler, V. L. (1993) Paramutation, an allelic
interaction, is associated with a stable and heritable reduction of transcription of
the maize b regulatory gene. Genetics 135, 881–894.
18. Povinelli, C. M. and Gibbs R. A. (1993) Large-scale sequencing library produc-
tion: an adaptor-based strategy. Anal. Biochem. 210, 16–26.
19. Kiss, T., Toth, M., and Solymosy, F. (1985) Plant small nuclear RNAs. Nucleolar
U3 snRNA is present in plants: partial characterization. Eur. J. Biochem. 152,
259–266.
20. Wagner, D. B., Furnier, G. R., Saghai-Maroof, M. A., Williams, S. M., Dancik, B.
P., and Allard, R.W. (1987) Chloroplast DNA polymorphisms in lodgepole and
jack pines and their hybrids. Proc. Natl. Acad. Sci. USA 84, 2097–2100.
21. Sambrook, J. and Russell, D. W. (eds.) (2001) Molecular Cloning. A Laboratory
Manual. CSH Laboratory Press, Cold Spring Harbor, NY.
22. Andersson, B., Wentland, M. A., Ricafrente, J. Y., Liu, W., and Gibbs, R. A.
(1996) A “double adaptor” method for improved shotgun library construction.
Anal. Biochem. 236, 107–113.
23. Yanisch-Perron, C., Vieira, J., and Messing, J. (1985) Improved M13 phage clon-
ing vectors and host strains: nucleotide sequences of the M13mp18 and pUC19
vectors. Gene 33, 103–119.
24. Blumenthal, R. M., Gregory, S. A., and Cooperider, J. S. (1985) Cloning of a
restriction-modification system from Proteus vulgaris and its use in analyzing a
methylase-sensitive phenotype in Escherichia coli. J. Bacteriol. 164, 501–509.
25. Altschul, S. F., Madden, T. L., Schaffer, A. A., et al. (1997) Gapped BLAST and
PSI-BLAST: a new generation of protein database search programs. Nucleic
Acids Res. 25, 3389–3402.

RescueMu Protocols 37
37
3
RescueMu Protocols for Maize Functional Genomics
Manish N. Raizada
Summary
RescueMu is a modified Mu1 transposon transformed into maize to permit mutagenesis and
subsequent recovery of mutant alleles by plasmid rescue. RescueMu elements insert late in the
germline as well as in terminally dividing somatic (e.g., leaf) cells. Germinal insertions may
result in a mutant phenotype, and RescueMu permits recovery of 5–25 kb of transposon-flank-
ing genomic DNA without having to construct and screen genomic DNA libraries. Late somatic
insertions of RescueMu do not result in a visible phenotype, but they are instead used to con-
struct plasmid libraries of gene-enriched maize genomic DNA to facilitate the identification
and sequencing of the euchromatic portion of the maize genome. This is because maize leaves
contain abundant independent RescueMu somatic insertions, and 70–90% of these insertions
occur preferentially into genes and not repetitive DNA. This chapter describes detailed proto-
cols on how to obtain, generate, and use RescueMu for maize genomics, including resources
developed by the Maize Gene Discovery Project (MGDP) consortium available online at
ZmDB.
Key Words
Mutator, RescueMu, maize, genomics, transposon, genome survey sequence, plasmid res-
cue, techniques
1. Introduction
Mutator (Mu) is a large DNA transposon family in maize (see refs. 1,2 for
reviews). Traditionally, Mu has been used to create novel mutants randomly in
the search for new genes (forward mutagenesis) and to create saturating popu-
lations of transposon insertions useful for reverse-genetics screens. This is due
to several factors: first, 70–90% of Mu elements insert into genes (3), not into
the repetitive DNA fraction which constitutes >80% of the maize genome (4).
Second, heritable Mu insertions occur late in germinal cells resulting in sibling
progeny that carry independent insertions. Mu elements insert at a high fre-

38 Raizada
quency (10–6 – 10–4 per locus per generation), to both linked and unlinked loci
where they remain stable and transmissible through the germline. A mutant
caused by a Mu element rarely ever reverts to wild-type. In contrast, maize Ac/
Ds elements and En/Spm elements insert stochastically during maize develop-
ment, preferentially insert within a 5 cM region of the donor site and may
excise in subsequent generations (reviewed in ref. 1). Finally, because inher-
ited Mu elements are not lost and continue to duplicate, they amplify over gen-
erations, up to hundreds of copies per plant, unlike Ac/Ds transposons that are
inhibited by a negative feedback transposition control mechanism. Thus, ran-
dom gene-targeted Mu amplification permits saturation mutagenesis.
Each member of the Mu element family is defined as sharing a common
approx 215 bp terminal inverted repeat (TIR) to which the Mu transposase
binds (reviewed in ref. 1). MuDR is a 4.9-kb Mu element that encodes two
proteins required for transposition. The Mutator family was likely created by
internal deletion and recombination of MuDR resulting in at least eight non-
protein-coding subfamilies of smaller transposons (Mu1–Mu8), which are
incapable of autonomous transposition, but may transpose in the presence of a
functional MuDR element.
RescueMu2 and RescueMu3 (Fig. 1) are modified Mu1 elements into which
high-copy number bacterial plasmids conferring ampicillin resistance were
Fig. 1. Structure of the RescueMu vector. RescueMu consists of a plasmid inserted
into an intact Mu1 nonautonomous element. RescueMu is inserted downstream of a
CaMV 35S promoter in the 5' untranslated leader of maize Lc (Leaf Color) a transcrip-
tion factor of the R family required for anthocyanin production. Excision of RescueMu
can restore tissue pigmentation. Two elements, RescueMu2 and RescueMu3, differ by
the presence of unique 400 bp heterologous tags of Rhizobium DNA, and both are
present in the original RescueMu transgenic lines. The asterisk indicates that the inter-
nal BamHI site is present in RescueMu3, but absent in RescueMu2.

inserted (3). They differ only by the presence of an internal 400-bp sequence
tag derived from Rhizobium. These plasmids were stably co-transformed with
the pAHC20 plasmid into maize by biolistic transformation. pAHC20 is a plas-
mid encoding bar, which is a selectable marker gene that confers resistance to
the herbicide glufosinate/Basta (5). RescueMu transgenic lines must be crossed
to an active MuDR line to transpose (3).
RescueMu was constructed to accelerate the discovery and characterization
of Mu-mutagenized genes underlying mutant phenotypes of interest. Plasmid
rescue can now be used to recover 5–20 kb of Mu element flanking DNA in
plasmid form ready for DNA sequencing in only a few days (3), instead of
having to construct a genomic library from a mutant plant.
In addition to germinal insertions, research using RescueMu uncovered that
Mu elements also transpose at a very high frequency in terminally dividing
somatic cells (e.g., leaf cells) (3). Late somatic RescueMu/Mu insertions are
unlikely to cause a noticeable phenotype, and because they rarely occur in the
shoot apical meristem, they are usually not transmitted to the next generation.
However, the somatic behavior of RescueMu has created a novel resource for
the construction of bacterial libraries of euchromatic-rich maize genomic DNA
in plasmid form ready for DNA sequencing. This is because RescueMu somatic
insertions also occur preferentially into genes (3). Read-out DNA sequencing
from RescueMu elements recovered from a single leaf can rapidly identify sig-
nificant numbers of independent genes and gene-rich DNA sequence (3).
Because of the sensitivity of bacterial transformation and antibiotic selection,
RescueMu insertions contained in single small leaf sectors can be recovered in
Escherichia coli from a pool of plant material, filtering out all other maize
genomic DNA. These features permit RescueMu sequencing to be an alterna-
tive to expressed sequence tag (EST) sequencing for gene discovery while
offering several unique advantages: unlike EST sequencing, RescueMu may be
used to find poorly transcribed genes. Second, RescueMu may lead to the dis-
covery of large numbers of nontranscribed regulatory regions in maize located
near RescueMu insertions (3), something not possible by EST sequencing.
Finally, RescueMu sequencing from both the right and left borders allows more
transcribed sequence to be obtained, including complete 5' and 3' untranslated
regions. Whereas RescueMu plasmids can include up to 25 kb of genomic DNA
(3), alternative methods to isolate genomic DNA flanking Mu insertions such
as thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) using
Mu read-out primers (6,7) typically result in <500 bp of readable DNA
sequence.
The Maize Gene Discovery Project (MGDP) is a consortium of laboratories
headed by Virginia Walbot (Stanford University) that is employing RescueMu
on a large scale to accelerate the recovery of mutant-causing germinal

40 Raizada
RescueMu insertions and to construct libraries of RescueMu-mutagenized leaf
DNA for maize euchromatic DNA sequencing. The MGDP makes available
populations of RescueMu mutagenized seed, online descriptions of mutants,
and 96-well microtiter plate libraries of recovered RescueMu plasmids repre-
senting somatic and germinal insertions. Each plate library represents plas-
mids recovered from a field grid consisting of 48 rows and 48 columns (2304
RescueMu plants) (Fig. 2). Each well contains RescueMu plasmids recovered
from one row or one column (48 plants) in the grid. Each plant in the row or
column is sampled by taking leaf punches from a single leaf. However, each
plant is sampled twice, one leaf for the row sample and the second leaf for the
column sample. If a RescueMu-flanking genomic DNA sequence is recovered
in both a row and a column of a grid, the logical intersection identifies the
single plant in the grid as the donor of the common RescueMu allele. Because
each row and column are sampled from separate leaves, and because only a
germinal insertion would be expected to extend beyond a single leaf, then
double-sampling is used to distinguish between the more frequent late somatic
insertions (leaf sector) and the rarer germinal insertions (whole plant). The
MGDP makes available approx 100–500 bp read-out sequences from these
libraries, known as genome sequence surveys (GSSs), which may be queried
online at GenBank®, PlantGDB, or ZmDB. For online links, detailed informa-
tion, or to order materials, the reader is encouraged to visit the Web site of the
MGDP, known as ZmDB (www.zmdb.iastate.edu).
Fig. 2. Summary of RescueMu materials available from the MGDP.

The first part of this chapter describes how to generate, recover, and analyze
novel RescueMu insertions in-house, including: (i) how to obtain and choose
RescueMu seed stocks; (ii) how to perform RescueMu plasmid rescues from
maize; (iii) how to select against contaminating plasmids using restriction
enzymes and filter hybridization techniques; and (iv) how to read-out and ana-
lyze sequence from recovered RescueMu elements. In Subheadings 2.8. and
3.8., I have included additional descriptions on how to request and use materi-
als generated by the MGDP in combination with these basic protocols.
2. Materials
2.1. Selecting RescueMu Plant Material to Generate Novel Insertions
1. Glufosinate ammonium/phosphinothricin-tripeptide (PPT)/Basta (Liberty® Her-
bicide; Aventis Crop Science).
2. Tween® 20.
2.2. Genomic DNA Isolation (see Note 4)
1. Chloroform.
2. Isoamyl alcohol.
3. Isopropanol.
4. 70% (v/v) Ethanol.
5. Water.
6. TE buffer: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA.
7. Prepare plasmid-free CTAB buffer: 100 mM Tris-HCl, pH 7.5/8, 2% (w/v)
CTAB, 1.4 M NaCl, 20 mM ethylene diamine tetraacetic acid (EDTA), pH 7.5/8,
1% (v/v) `-mercaptoethanol, 1% (w/v) sodium bisulfite. For 100 mL of CTAB
buffer, dissolve CTAB in 60 mL water by heating in a microwave for 20 s and
then add other components. Add `-mercaptoethanol just before use. Store at room
temperature or 4°C.
2.3. Plasmid Rescue
1. Enzymes needed: KpnI, RNaseA, BglII, EcoRI, T4 DNA ligase (Invitrogen).
2. ElectroMAX DH10B competent cells (>1010 colony-forming units [cfu]/µg)
(Invitrogen or LIFE Technologies).
3. 3 M Sodium acetate.
4. Buffer-saturated phenol, pH 8.0.
5. Chloroform.
6. Isoamyl alcohol.
7. 70% (v/v) Ethanol.
8. Water (plasmid-free).
9. SOC media (Invitrogen or LIFE Technologies).
10. DNA Electroporator and 0.1-cm cuvettes.
11. LB-carbenicillin (100 mg/L) Petri plates (see Note 9).

42 Raizada
2.4. Isolating DNA Fragments for DNA Hybridization Probing of
Rescued Colonies
1. Enzymes needed: PstI, SacI, XbaI, XhoI, BspHI.
2. Plasmids needed: pR, pBluescript® KS (Stratagene), pRescueMu2 and
pRescueMu3, pMR15 and pMR17 (see Note 13).
3. RescueMu probe amplification primers: (i) primer p173+155F GCGAATTC
GACAGCCGGCAGGGCATTC; (ii) T7 primer CGCGTAATACGACTCACT
ATAGGGC; and (iii) primer p192+130F TTCCTGCAGCGGCCGCGGATCAG.
2.5. Preparing Filters for Screening of Rescued Colonies
1. Whatman 3 MM filter paper (Whatman).
2. 0.5 M NaOH.
3. 1 M Tris-HCl (pH 7.5).
4. UV cross-linker (e.g., Stratalinker®; Stratagene).
5. India ink.
6. Nitrocellulose filters (e.g., NEN Colony/Plaque Screen).
7. 80°C Oven (if using nitrocellulose).
2.6. Confirming RescueMu Insertions Using Colony-Lift Hybridizations
1. Random primer labeling kit (e.g., DecaPrimeII; Promega).
2. 32P-_ [dCTP] (2000–3000 Ci/mmol) (Amersham Pharmacia Biotech).
3. NucTrap Push Columns (Stratagene).
4. 2× SSC, pH 7.0: 0.3 M sodium citrate, 0.3 M NaCl.
5. 10% (w/v) Sodium dodecyl sulfate (SDS).
6. 10 mg/mL Salmon sperm DNA.
7. Prehyb buffer: 1% (w/v) SDS, 2× SSC, 10% (w/v) dextran sulfate, 50% deion-
ized formamide, 3× Denhardt’s reagent (1% [w/v] Ficoll® 400, 1% [w/v] polyvi-
nylpyrrolidone, 1% [w/v] bovine serum albumin [Fraction V; Sigma]).
2.7. Analyzing and Sequencing of RescueMu Plasmids
1. Enzymes needed: KpnI, HindIII, EcoRI.
2. Sequencing primers: Mu3-R TGCTGTCTTGTGTCCGTTTTA and Mu3-L
AGCTGTCTCGTATCCGTTTTG.
2.8. Requesting RescueMu MGDP Materials
1. 96-Well plates of RescueMu plasmids, each recovered from a field grid of 48 ×
48 plants, may be purchased for $150 US at (www.zmdb.iastate.edu). Click on
Order Materials, then follow the Library Plate link.
2. Pictures and descriptions of visible mutants in each MGDP RescueMu field grid
may be found at the ZmDB Maize Phenotype Database (PhenotypeDB) at (http:/
/www.zmdb.iastate.edu/zmdb/phenotypeDB/index.htm). Selfed seed from these
grid plants are available from the Maize Genetics Cooperation-Stock Center
(http://w3.ag.uiuc.edu/maize-coop/mgc-home.html) (see Note 1). Send an e-mail

to maize@uiuc.edu indicating the RescueMu field grid letter, row, and column
numbers.
3. To screen RescueMu 96-well plasmid libraries by PCR to search for an insertion
into sequence of interest (reverse genetics), the right-side RescueMu read-out
primer (Mu1–R) is 5'-TAT TTC GTC GAA TCC GCT TCT-3', and the left-side
read-out primer (Mu1–L) is 5'-CAT TTC GTC GAA TCC CCT TCC-3'.
3. Methods
3.1. Selecting RescueMu Plant Material to Generate Novel Insertions
1. Request and select active RescueMu seeds (see Notes 1–3).
2. Confirm the presence of the RescueMu transgene via its linkage to plasmid
pAHC20 (5), which encodes resistance to the herbicide glufosinate/PPT/Basta.
To test for herbicide resistance, a 5-cm-diameter circle is made using a black
marker onto a leaf, which is then painted with 0.75% (v/v) glufosinate ammo-
nium (Liberty Herbicide, 18% [v/v] solution) containing 0.1% (v/v) Tween 20
using a Q-tip. Only plants that are non-necrotic, 5–7 d after herbicide applica-
tion, should be used.
3.2. Genomic DNA Isolation
1. Using plasmid-free solutions (see Note 4), isolate genomic DNA, preferably from
young leaves 1–5, using the urea extraction method (8) or the CTAB method
below (9). Both methods work well.
2. Grind 0.1–0.3 g of tissue to a fine powder in liquid nitrogen using a mortar and
pestle.
3. Add tissue to a 2-mL Eppendorf® tube containing 0.9 mL of CTAB buffer.
4. Vortex mix sample briefly and keep on ice until all samples are ground.
5. Incubate the tubes at 60°C for 30 min, then cool at room temperature 10 min.
6. Add 1 vol chloroform:isoamyl alcohol (24:1) and invert tubes continuously for
5 min.
7. Centrifuge the tubes 5 min in a microcentrifuge at >14,000g, then remove the
upper aqueous phase to a clean 2-mL Eppendorf tube.
8. Repeat steps 6 and 7. Transfer the upper, aqueous phase to a 1.5-mL Eppendorf
tube.
9. Add 1 vol isopropanol and invert the tubes gently until the DNA precipitates.
10. Either spool the DNA with the curled-by-flaming tip of a sterile Pasteur pipet or
minicentrifuge for 2 min at >14,000g.
11. Resuspend the DNA in 1 mL of 70% (v/v) ethanol. Incubate at room temperature
20 min.
12. Centrifuge the tube at >14,000g for 15 s, then air-dry the pellet.
13. Dissolve the DNA in 50–200 µL of TE. Incubate at 4°C to dissolve.
14. Store at –20°C until next step.

44 Raizada
3.3. Plasmid Rescue
1. Digest 10 µg of genomic DNA with 50 U of KpnI in the presence of RNaseA in a
vol of 150 µL, for 90 min at 37°C (see Notes 5 and 11).
2. Add 150 µL of phenol:chloroform:isoamyl alcohol (25:24:1), mix by inversion,
microcentrifuge at >14,000g, remove the upper aqueous phase to a fresh tube.
Repeat once (see Note 6).
3. Add 100 µL of chloroform, mix by inversion, microcentrifuge at >14,000g, and
remove upper aqueous phase to a fresh tube.
4. To precipitate the DNA, add one-tenth vol of 3 M sodium acetate, mix by tap-
ping, then add 2.5 vol of 95% ethanol.
5. Centrifuge for 20 min at >14,000g at 4°C.
6. Wash the pellet with 1 vol 70% (v/v) ethanol, then air-dry.
7. Dissolve in >20 µL water.
8. An optional BglII selection step (see Note 3) is performed as follows: digest
DNA with 30 U of BglII in a final vol of 100 µL for 1 h at 37°C. Extract once
with 1 vol of phenol:chloroform:isoamyl alcohol (25:24:1), then once with 1 vol
chloroform as in steps 2 and 3. Ethanol precipitate and wash with 70% (v/v)
ethanol as in step 4, but dissolve the final DNA pellet in >50 µL water.
9. Self-ligate at 14°C for 16 h with 10 U of T4 DNA ligase and 100 µL of fresh 5×
ligation buffer (Invitrogen or LIFE Technologies) in a final vol of 500 µL (see
Notes 7 and 10).
10. Extract the ligation mixture twice with 500 µL of phenol:chloroform:isoamyl
alcohol (25:24:1) and once with 500 µL of chloroform as in steps 2 and 3.
11. Precipitate the DNA by adding one-tenth vol of 3 M sodium acetate, mix by
tapping, then add 1 vol isopropanol. Invert.
12. Centrifuge 20 min, 14,000g, 4°C. Wash the pellet with 500 µL of 70% (v/v)
ethanol and air-dry.
13. Dissolve the pellet in 10 µL water.
14. For each sample, aliquot 1 mL of SOC medium in a 3 to 10-mL tube.
15. For electroporation, thaw 30–50 µL of ElectroMAX DH10B cells (>1010 cfu/µg
DNA) in an ice slurry exactly according to the manufacturer’s recommendations
(see Notes 8 and 10).
16. As the cells are thawing, aliquot 2 µL of DNA (approx 1 µg) per sample in a
separate Eppendorf tube and chill on ice (see Note 10).
17. When the cells are thawed, aliquot 30–50 µL of cells in each tube containing the
DNA and incubate on ice >1 min.
18. Just prior to each electroporation, pipet up the SOC media in a Pasteur pipet,
ready for pipeting into the cuvette immediately after electroporation. A delay of
only 20–30 s in the addition of SOC causes a significant decrease in transforma-
tion efficiency.
19. Electroporate exactly according to the instructions accompanying the competent
cells. For a Bio-Rad device, cells are placed in a 0.1-cm gap disposal cuvette
(Bio-Rad) set at 100 ohms, 2.5 kV, 25 µF, then discharged (time constant approx
2.3).

20. Immediately add 1 mL of SOC media into the cuvette, pipet up and down gently
once, then remove into the 3 to 10-mL tube.
21. Shake at 37°C for 1 h at 225–300 rpm to allow expression of the antibiotic resis-
tance gene.
22. To concentrate the cells, aliquot the SOC bacterial media into a 1.5-mL Eppendorf
tube, and microcentrifuge for 5 s at 14,000g at room temperature.
23. Remove the SOC and gently resuspend in 200 µL of fresh SOC.
24. Plate 20 and 180 µL of cells onto ampicillin–carbenicillin-containing LB plates
(see Notes 9 and 11).
3.4. Isolating DNA Fragments for DNA Hybridization Probing of
Rescued Colonies (see Note 12)
1. The RescueMu2-specific probe is obtained as a 520-bp XhoI-XbaI fragment from
pMR15 (see Note 13).
2. The RescueMu3-specific probe is obtained as a 478-bp XhoI-SacI fragment from
pMR17.
3. Alternatively, PCR may be used to amplify RescueMu2 and RescueMu3 probes.
To amplify RescueMu2, use 5' primer p173+155F and the 3' T7 primer. To
amplify RescueMu3, use the 5' primer p192+130F and the 3' T7 primer 3. PCR
cycle conditions are 94°C for 45 s, 50°C for 45 s, and 72°C for 60 s (30–35
cycles) in the presence of 2 mM MgCl2. PCR products should be purified on an
agarose gel.
4. Instead of using RescueMu-specific probes to detect new RescueMu insertions,
an ampicillin probe may also be used. It is isolated as a 1-kb BspHI fragment
from pBluescript KS+ and will detect both RescueMu plasmids.
5. Cauliflower mosaic virus (CaMV) 35S and maize R(Lc) probes should also be
isolated to be used to screen against the recovery of the original Lc::RescueMu
alleles after plasmid rescue (see Note 12). The CaMV 35S probe extends from
+7072 to +7565 (10) and is isolated as a XbaI-PstI fragment from plasmid pR
(11). The maize R(Lc) probe is isolated as an approx 800-bp PstI fragment from
pR (see Note 13).
3.5. Preparing Filters for Screening of Rescued Colonies
1. This is the Grunstein-Hogness method (12).
2. Chill bacterial plates at 4°C for >1 h.
3. Lay out 4 pieces of cellophane (each >15 × 15 cm). Label 1, 2, 3, and 4. Place a
square of Whatmann 3 MM blotting paper (>10 × 10 cm) beside, though not
touching, each piece of cellophane. Have a timer ready for each of the four sta-
tions. Have a bottle of India ink with a gauge needle ready.
4. Pipet 1 mL of 0.5 M NaOH onto each of cellophane 1 and 2, and 1 mL of 1 M
Tris-HCl buffer (pH 7.5) onto each of cellophane 3 and 4.
5. Use forceps to place a dry piece of nitrocellulose membrane onto each bacterial
plate, one at a time. Wait 2 to 3 min. During this time, use a unique dot pattern
and stab the membrane and LB with the India ink. This will be used to orient the

46 Raizada
X-ray film after hybridization with the bacterial plates to pick positive RescueMu
clones.
6. Transfer the filter onto cellophane 1 directly onto the pool of NaOH, colony-side
facing up. Incubate 2 min to lyse the cells.
7. Transfer onto cellophane 2 and again incubate for 2 min as in step 6. Briefly blot
onto Whatmann 3 MM paper to remove excess NaOH.
8. Transfer filter onto cellophane 3, directly onto solution of 1 M Tris-HCl, colony-
side up. Incubate 2 min. Briefly blot onto Whatmann paper.
9. Transfer onto cellophane 4 and repeat as in step 8. Blot onto Whatmann 3 MM
paper.
10. Immobilize DNA by UV cross-linking using manufacturer’s recommendations,
then place in an 80°C oven for 2 h. Store in a dry place until needed. Store the LB
plates at 4°C.
3.6. Confirming RescueMu Insertions Using Colony-Lift Hybridizations
1. Prepare 10–50 ng of radioactive probe DNA using a random prime labeling kit
(e.g., DecaPrimeII) and 32P-_ [dCTP]. Incubate at 37°C for >3 h, and then purify
on a NucTrap push column to remove unincorporated nucleotides.
2. In the first round of hybridization, to identify plasmid contamination (see Note
4), colonies should be hybridized to a mixture of the two RescueMu-specific
probes (See Subheading 3.4.) to confirm colony identity as described below.
3. Filters should be wetted in 2× SSC for 1 min, then prehybridized in Prehyb buffer
in the presence of 0.1 mg/mL single-stranded DNA (prepared by boiling a 10 mg/
mL stock of salmon sperm DNA for 5 min, then quick-chilled on ice). The filters
should be incubated for 30 min to 24 h at 42°C in a shaking tupperware container
or hybridization oven.
4. Following prehybridization, radiolabeled probe should be denatured by boiling
for 5 min with 50% (v/v) formamide, then quick-chilled on ice. The denatured
probe should be added directly to the filters in Prehyb buffer, and hybridization
carried out for 16–24 h at 42°C.
5. The hybridization solution should be removed and the filters washed in 0.2× SSC/
0.1% (v/v) SDS at 65°C (100–500 mL/10 filters) for 15 min, with 2 changes of
wash buffer. The filters should be wrapped in cellophane paper and exposed to
X-ray film for 6–24 h.
6. Using the India ink markings on the filters, the X-rays should be marked, allow-
ing them to be aligned with each original LB plate.
7. Positive colonies from the first hybridization screen should be picked with sterile
toothpicks, arrayed on duplicate LB plates (50–100/100-mm-diameter LB plate)
and numbered. The plates are then incubated overnight at 37°C.
8. This entire procedure (steps 1–7) should be repeated on the duplicate plates of
selected positive colonies in order to screen out colonies that represent recovery
of the original RescueMu/pAHC20 transgene array (see Note 12). Colonies from
the first plate should be hybridized to a mixture of CaMV 35S- and maize Lc(R)-
specific probes; colonies from the second plate should be hybridized again to the

mixture of RescueMu-specific probes. Colonies that are positive for the
RescueMu probes but negative for CaMV 35S and Lc(R), should then be chosen
for DNA sequencing.
3.7. Analyzing and Sequencing of RescueMu Plasmids
1. As a final check to confirm that the selected colonies represent true RescueMu
insertions, plasmid DNA should be isolated and digested with KpnI and HindIII.
If a plasmid corresponds to a new insertion, there should be at least one fragment
>4.7 kb (see Note 4). A comparison of restriction patterns of plasmids recovered
from the same plant may be useful in determining if the recovered plasmid repre-
sents a somatic or germinal insertion (see Note 14).
2. For cleaner sequencing of flanking genomic DNA, plasmids may first be linear-
ized with EcoRI, then repurified by ethanol precipitation.
3. For sequencing, the primers are located –122 bp from the outside edge of
RescueMu. The right TIR out primer is Mu3-R and the left border TIR out primer
is Mu3-L.
4. The first several bases will correspond to Mu1 TIR sequence, followed by novel
sequence. The first 9 bp immediately flanking TIR sequence should be dupli-
cated at both the left and right borders of RescueMu, which is a hallmark of Mu/
RescueMu transposition.
3.8. Using Existing RescueMu MGDP Resources
3.8.1. How to Query MGDP RescueMu Plasmid Library GSS Databases
1. The RescueMu GSS collection consists of tens of thousands of partial read-out
sequences from recovered RescueMu elements, representing both somatic and
germinal insertions in pools of maize leaves (Fig. 2) (see Note 15).
2. Go to (www.zmdb.iastate.edu) and click on the Search ZmDB button.
3. To search for a sequence of interest in the GSS collection, use the ZmDB Basic
Local Alignment Search Tool (BLAST). In the new page, specify GSS database,
enter the sequence, and then Run BLAST.
4. A ZMDB BLAST Results page will open to indicate if a successful alignment
was found.
5. In the Results Summary box, look for the word RescueMu under Description.
Click on the corresponding sequence name; this will open up a new page.
6. At the bottom of the new page, there will be a box to indicate if the RescueMu
GSS aligns with maize EST sequences. There will be a second box that indicates
which field grid library the GSS was obtained from (e.g., Library 1006 Grid G)
and the plant location within the grid (e.g., row 16).
7. Alternatively, RescueMu GSS sequences may also be accessed using GenBank®
National Center for Biotechnology Information (NCBI) by delimiting the search
to the dbGSS database or via the Plant Genome Database at (www.plantgdb.org).
PlantGDB permits other useful search options such as searching using a text iden-
tifier:

48 Raizada
a. In PlantGDB, specify GSS or GSS contig under Sequence and Zea mays.
b. A query results page will open and list any RescueMu sequences that match
the text.
c. Clicking on a sequence name will open up a new page that will indicate if the
RescueMu GSS is part of a larger GSS contig and/or aligns with maize ESTs.
8. To identify upstream and downstream sequences to the original query sequence,
look for overlapping ESTs or GSS contigs. For example, if RMTuc appears in the
Results page, click on the corresponding link. This will open up a new page speci-
fying that the GSS is part of a RescueMu tentative unique contig (RMTUC)
assembled by aligning overlapping RescueMu GSSs and displaying overlapping
EST sequences. For an example, go to (www.plantgdb.org), select Text Search,
type in myb, specify GSS contig and Zea mays, then hit Search.
3.8.2. How to Retrieve a RescueMu Genomic Plasmid from a MGDP
Grid Library for Further Sequencing
1. This section describes how to retrieve a plasmid encoding a GSS of interest from
a MGDP 96–well grid library of RescueMu recovered plasmids in order to
sequence further upstream or downstream. RescueMu GSS plasmids are not indi-
vidually distributed by the MGDP.
2. Perform a sequence similarity search against the RescueMu GSS collection (see
Subheading 3.8.1., steps 1–6).
3. In the Query Results page, note the grid origin of the GSS sequence (e.g., Grid
G).
4. To identify the precise location of the GSS in a 96-well plate and the direction of
the read-out sequence, locate the sequence identification (I.D.). Examples are
1006162C04.x2 1006 and 1008035A02.y1 1008 (see Note 15).
5. Purchase the correct 96-well RescueMu grid library plate online (see Subhead-
ing 2.8.).
6. After receiving the plasmid library, there are two methods to retrieve the GSS
plasmid of interest from the correct well, PCR, or bacterial colony hybridization.
7. To PCR amplify the entire maize genomic DNA insert flanking RescueMu (up to
25 kb):
a. Design a PCR primer specific to the GSS to amplify in the direction away from
RescueMu.
b. Synthesize a RescueMu read-out primer located on the opposite edge of the
genomic insert. For example, if the GSS is from an “x” (right TIR) sequence,
then the RescueMu read-out primer should correspond to the left TIR. The
RescueMu left primer is 5'-CACCGCCGTGCTGCCGTAGAGCG-3' and the
RescueMu right primer is 5'-CGCGTGACTGAGATGCGACGGAG-3'.
These are located >220 bp internal to the left or right edge of the RescueMu
element.
c. Use MasterAmp Extra Long DNA Polymerase with High Fidelity 2× Extra
Long PCR Premix 9 (Epicentre), 5 ng of library plate DNA, the GSS primer,
and the RescueMu primer.
d. Following an initial denaturation at 94°C for 1 min, perform 40 PCR cycles as

follows: 94°C for 15 s, 60°C for 30 s, and 68°C for 25 min. The long exten-
sion time is to amplify inserts up to 25 kb in length.
e. Additional details for PCR amplification may be found at (www.zmdb.
iastate.edu); click on the Protocols button and follow the PCR link.
8. For bacterial colony hybridization, transform the DNA from the correct well (e.g.,
C04 or A02) into E. coli strain DH10B and ensure that the colonies are well
separated (see Subheading 3.3., steps 14–24).
a. To screen colonies containing the GSS plasmid of interest, generate a DNA
probe corresponding to the GSS by PCR using the library well DNA or maize
genomic DNA as the template. Alternatively, request an overlapping EST
fragment (available online from ZmDB) to use as probe.
b. Follow Subheadings 3.5. and 3.6. to immobilize the bacterial colonies onto
nylon–nitrocellulose and to screen colonies using the radiolabeled probe.
c. Isolate plasmid DNA from positive colonies.
9. Confirm the identity of the recovered clone by DNA sequencing, and then design
specific DNA sequencing primers to sequence upstream and downstream of the
GSS.
10. For PCR cycle sequencing, consult (www.zmdb.iastate.edu); click on the Proto-
cols button and follow the Cycle Sequencing link.
3.8.3. How to Use an EST or Heterologous Sequence to Screen
RescueMu Libraries by Reverse Genetics
1. This section describes how to use a sequence (EST, heterologous sequence) with
no similarity in the online ZmDB GSS collection to screen RescueMu plasmid
libraries generated by the MGDP to identify a somatic or germinal insertion by
reverse-genetics.
2. Purchase 96-well RescueMu grid library plates online.
3. Synthesize the RescueMu read-out primers (Mu1-L and Mu1-R) (see Subhead-
ing 2.8.).
4. Design and synthesize two or more PCR primers for the sequence of interest,
both 5' to 3', one for the top strand and one for the bottom strand.
5. Perform a 96-sample PCR using the 4 PCR primers and use the following initial
conditions: 0.5 mM dNTPs, 2.5 mM Mg++, 0.8 µM of each specific primer, 4.0
µM of each RescueMu primer, 2 U Taq DNA polymerase and 5 ng library plate
DNA. Denature 95°C for 5 min, then amplify for 40 cycles (95°C for 30 s, 55°C
for 30 s, then 72°C for 2 min), followed by a single extension at 72°C for 5 min.
6. Consult (www.zmdb.iastate.edu) for a grid-specific list of positive control
PCR primers and other recommendations. Click on RMu Libraries and then
Screening.
7. Sequence the fragment to confirm its identity.
8. If the insertion of interest is found in both a row well and a column well, this
indicates a likely germinal insertion event and pinpoints the exact plant. Note the
grid letter, row and column number to request seed from the Maize Genetics
Cooperative-Stock Center (see Note 1).

50 Raizada
3.8.4. How to Screen the MGDP RescueMu PhenotypeDB to Obtain a
Mutant of Interest
1. Grids of 48 × 48 RescueMu plants have been screened by the MGDP for visible
mutant phenotypes and descriptions are available online (see Subheading 2.8.).
Mutants may be caused by either RescueMu, but more likely by background Mu/
MuDR elements. Go to the PhenotypeDB index page at (www.zmdb.iastate.edu/
zmdb/phenotypeDB/index.htm).
2. For relative mutation frequencies in each grid, consult the Grid Summary Table.
3. Begin the search by taking the Interactive PhenotypeDB Tutorial.
4. Choose one of three search tools. To search using a specific phenotype, for
example a Knotted adult leaf, then use the Phenotype Lists search engine. To
search by general category, for example all adult leaf mutants, then use the
Mutant Browser. To search by a specific location within a grid, use the Location
Search engine.
5. Hit Start Search.
6. In the Query Results page, the column and row of each mutant is listed. Click on
the corresponding Grid letter; this opens up the PhenotypeDB Search Details
page, which is a summary card of the scoring details.
7. At the bottom of the PhenotypeDB Search Details page, there are links to all the
RescueMu GSSs recovered from the row and column pool that contained the
mutant plant.
8. Use the grid, row, and column information to request selfed seed from the Maize
Genetics Cooperation Stock Center (see Subheading 2.8. and Note 1).
9. Once seed have been received, the user may wish to backcross to create an
isogenic background. RescueMu seed populations are in a mixed genotype, typi-
cally A188 > W23 > Robertson > K55 > Freeling > B73. For more details, go to
(www.zmdb.iastate.edu), open the RescueMu Index menu on the right side and
choose RescueMu Tagging Populations.
3.8.5. How to Use a RescueMu GSS to Identify a Corresponding Mutant
Phenotype
1. Perform a BLAST search in ZmDB. Select the GSS database (see Subheading
3.8.1.).
2. In the Results Summary page, note whether the GSS appears as a single hit or
multiple hits in the same library grid (indicated by the first 4 or last 4 letters
under Description). Determine the row or column source of each GSS (see Sub-
heading 3.8.1., steps 3–6).
3. If the GSS appears as only a single hit within any one grid, then proceed with
step 3. For multiple hits, go to step 4.
a. There is a high probability that the RescueMu GSS corresponds to a somatic
insertion, with no phenotype.
b. To determine if the GSS instead corresponds to a germinal insertion, pur-
chase the corresponding 96-well RescueMu grid library plate (see Subhead-
ing 2.8.).

c. To screen the 96-well plate for a RescueMu germinal insertion, use a
RescueMu read-out primer and a primer to the GSS of interest to screen by
PCR using steps 3–7 in Subheading 3.8.3. If the GSS of interest is found in
both a row and column sample, then proceed to step 6.
d. If the GSS of interest is not found in both row and column samples, it is
possible that a germinal insertion does exist, but was not retrieved during
plasmid rescue in both row and column pools. To proceed, request RescueMu
seed for all of the 48 plants in the row or column pool of the GSS. After
growing these progeny, isolate leaf genomic DNA (Subheading 3.2.), then
use PCR to screen leaves for the GSS-specific RescueMu insertion by follow-
ing Subheading 3.8.3., steps 3–7. If an insertion is found, it is likely to be
germinal, and thus, proceed to step 7 of this section.
4. If multiple GSSs are retrieved, then click on the Sequence code of each GSS. At
the bottom of each new page, note the Grid letter and Row/Column location.
5. If the multiple GSSs belong to only a row(s) or column(s) within a grid, but not
both, then proceed with step 5. If the GSSs belong to both a row and column
within a grid, then go to step 6.
a. As the number of duplicate GSSs in only a row or column sample increases,
the probability that the GSSs correspond to a germinal insertion increases.
b. To determine if the GSS instead corresponds to a germinal insertion, pur-
chase the corresponding 96-well RescueMu grid library plate (see Subhead-
ing 2.8.).
c. To screen the 96-well plate for a RescueMu germinal insertion, use a
RescueMu read-out primer and a primer to the GSS of interest to screen by
PCR using steps 3–7 in Subheading 3.8.3. If the GSS of interest is found in
both a row and column sample, then proceed to step 6.
6. If the GSSs correspond to a row and column within a grid, then request seed for
the RescueMu plant at the field grid intersection (Fig. 2).
7. Search for a visible phenotype in PhenotypeDB using Location Search by enter-
ing the Grid letter, Row, and Column numbers (see Subheading 3.8.4.).
8. Isolate genomic DNA from the candidate plant(s) and confirm the presence of a
RescueMu germinal insertion by PCR using the appropriate RescueMu read-out
primer and a gene-specific primer (see Subheading 3.8.3., steps 3–6).
9. Perform a segregation analysis of the progeny by PCR to determine if the
RescueMu allele cosegregates with the mutant phenotype.
3.8.6. How to Identify a RescueMu Insertion Responsible for a MGDP
Mutant Phenotype
1. In the initial MGDP RescueMu grids, most mutants are caused by MuDR/Mu
elements, not RescueMu (see Note 2d).
2. Use PhenotypeDB to locate the Grid letter, row and column numbers of the
mutant (see Subheading 3.8.4.).
3. At the time of this protocol submission, the RescueMu GSS database could not be
searched by row or column location. Instead, there is a link in PhenotypeDB

Exploring the Variety of Random
Documents with Different Content

Fig. 65.—Map showing the distribution of cheese factories in the
principal cheese-producing states.
Arizona 3 New Hampshire 2
California 93 New York 995
Colorado 8 North Dakota 3
Connecticut 2 Ohio 111
Delaware 1 Oklahoma 1
Illinois 50 Oregon 42
Indiana 13 Pennsylvania 106
Iowa 25 South Dakota 1
Kansas 1 Utah 8
Maine 5 Vermont 35
Michigan 196 Virginia 3
Minnesota 74 Washington 15
Missouri 4 West Virginia 1
Montana 1 Wisconsin 1720
Nebraska 1 ——
3520
302. Total production of cheese in the United States.—The following
figures (Table XX) compiled by the United States Census show the total
production of cheese and the amount made on farms and in factories in the
United States by ten-year periods:
TABLE XX
Showing the Total Production of Cheese and Part Made on Farms and in Factories in the United States
by Ten-year Periods
1849 Total 103,663,927 pounds
1859 Total 105,535,893 pounds
1869 Total 162,927,382 pounds

Fig. 66.—Showing the cheese
factories in the Pacific coast
states.
1879 Total 243,157,850 pounds
1889 On farms 18,726,818 pounds
In factories 238,035,065 pounds
Total 256,761,883 pounds
1899 On farm 16,372,330 pounds
1909 On farms 9,405,864 pounds
Comparing the figures of 1899 with those of
1909, it is seen that the total production of
cheese in the United States increased 22,187,539
pounds, or an increase of 7.4 per cent in 1909
over 1899. During the same years the amount
made on the farms decreased 6,966,454 pounds,
or a decrease of 42.6 per cent, while the amount
made in factories increased 29,153,933 pounds
or 10.3 per cent.
303. Rank of the leading cheese-producing
states.—The rank of the leading cheese states
according to the number of factories in 1914
was: Wisconsin 1720, New York 995, Michigan
196, Ohio 111, Pennsylvania 106.
The table on the opposite page (Table XXI)
shows the amount of cheese produced by the
five states with the largest number of factories.
This table indicates that New York led in the
production of cheese until some time between
1899 and 1909. This is probably because, New
York having so many cities, the demand for
market milk is so large that it is sold as such
instead of being manufactured into cheese.
There is about the same number of milch cows
in New York and Wisconsin. However, Wisconsin
is credited with more cheese in 1909 than New York ever produced and this
output probably will increase, as there are considerable areas of undeveloped
agricultural land in Wisconsin. It is also interesting to note that Ohio is falling off
in cheese production. This may be due to the increased demand for market milk.
On the other hand, production has increased in Pennsylvania.

TABLE XXI
Showing the Amount of Cheese Made in five Leading States by Ten-year Periods
State Year 1859 Year 1869 Year 1879 Year 1889 Year 1899 Year 1909 Year 1914
Amount in
pounds
Amount in
pounds
Amount in
pounds
Amount in
pounds
Amount in
pounds
Amount in
pounds
Amount in
pounds
from
factories
only
Wisconsin 1,104,300 3,288,581 19,535,324 54,614,861 79,384,298 148,906,910 205,920,915
New York 48,548,289 100,776,012 129,163,714 124,086,524 130,010,584 105,584,947 97,614,024
Michigan 1,641,897 2,321,801 3,953,585 5,370,460 10,753,758 13,673,336 13,267,145
Ohio 21,618,893 24,153,876 32,531,683 22,254,054 19,363,528 12,473,834 8,717,996
Penn. 2,508,556 2,792,676 8,966,737 5,457,897 11,124,610 12,676,713 14,808,573
304. Exportation and importation of cheese by the United States.—The
accompanying table shows the exports and imports of cheese from 1851 to 1916
and their values, in so far as the figures are available.
Fig. 67.—Showing relationship of total production, exports and
imports of cheese.
One noteworthy item in Table XXII is that the exports have gradually decreased
and imports increased. This is probably because immigrants have demanded the
cheeses of their native country which were not made in America. The exports for
the years 1915 and 1916 are interesting as they show the effect of the war on the

cheese industry, the imports being gradually decreased and the exports greatly
increased.
TABLE XXII
Showing the Imports and Exports of Cheese by the United States from
1851-1916

Year Imports Exports
Amount in pounds Value in dollars Amount in pounds Value in dollars
1851 603,398 —— 10,361,189 ——
1852 514,337 —— 6,650,420 ——
1853 874,949 —— 3,763,932 ——
1854 969,417 —— 7,003,974 ——
1855 1,526,942 —— 4,846,568 ——
1856 1,384,272 —— 8,737,029 ——
1857 1,400,252 —— 6,453,072 ——
1858 1,589,066 —— 8,098,527 ——
1859 1,409,420 —— 7,103,323 ——
1860 1,401,161 —— 15,515,799 ——
1861 1,090,835 —— 32,361,428 ——
1862 594,822 —— 34,052,678 ——
1863 545,966 —— 42,045,054 ——
1864 836,127 —— 47,751,329 ——
1865 985,362 —— 53,154,318 ——
1866 —— —— 36,411,985 ——
1867 1,738,657 —— 52,352,127 ——
1868 2,997,994 —— 51,097,203 ——
1869 —— —— 39,960,367 ——
1870 —— —— 57,296,327 ——
1871 —— —— 63,698,867 ——
1872 —— —— 66,204,025 ——
1873 —— —— 80,366,540 ——
1874 —— —— 90,611,077 ——
1875 —— —— 101,010,853 ——
1876 —— —— 97,676,264 ——
1877 —— —— 107,364,666 ——
1878 —— —— 123,783,736 ——
1879 —— —— 141,654,474 ——
1880 —— —— 127,553,907 ——
1881 —— —— 147,995,614 ——
1882 —— —— 127,989,782 ——
1883 —— —— 99,220,467 ——
1884 6,243,014 —— 112,869,575 ——
1885 6,247,560 —— 111,992,990 ——
1886 6,309,124 —— 91,877,235 ——
1887 6,592,192 —— 81,255,994 ——
1888 8,750,185 —— 88,008,458 ——
1889 8,207,026 —— 84,999,828 ——
1890 9,263,573 —— 95,376,053 ——
1891 8,863,640 —— 82,133,876 ——
1892 8,305,288 —— 82,100,221 ——
1893 10,195,924 —— 81,350,923 ——

1894 8,742,851 —— 73,852,134 ——
1895 10,276,293 —— 60,448,421 ——
1896 10,728,397 —— 36,777,291 ——
1897 12,319,122 —— 50,944,617 ——
1898 10,012,188 —— 53,167,280 ——
1900 13,455,990 —— 48,419,353 ——
1901 15,329,099 —— 39,813,517 ——
1902 17,067,714 $2,551,366 27,203,184 $2,745,597
1903 20,671,384 3,183,224 18,987,178 2,250,229
1904 22,707,103 3,284,811 23,335,172 2,452,239
1905 3,379,600 3,284,811 10,134,424 1,084,044
1906 27,286,866 4,303,830 16,562,451 1,940,620
1907 33,848,766 5,704,012 17,285,230 2,012,626
1908 5,586,706 5,704,012 8,439,031 1,092,053
1909 35,548,143 5,866,154 6,822,842 857,091
1910 40,817,524 7,053,570 2,846,709 441,017
1911 45,568,797 7,053,570 10,366,605 1,288,279
1912 46,542,007 8,807,249 6,337,559 898,035
1913 49,387,944 9,185,184 2,599,058 441,186
1914 63,784,313 11,010,693 2,427,577 414,124
1915 50,138,520 9,370,048 55,362,917 8,463,174
1916 30,087,999 7,058,420 44,394,301 7,430,089
The graph (Fig. 67) represents the total production and the exports and imports
of cheese into the United States.
305. Average yearly price of cheese.—The following table shows the average
yearly price of Cheddar cheese in the United States:
TABLE XXIII
Showing the Average Yearly Price of
Cheese, 1892-1916

Year Cents
1892 9.4
1893 9.4
1894 9.7
1895 9.1
1896 8.4
1897 9.1
1898 8.6
1899 8.6
1900 10.2
1901 9.9
1902 11.9
1903 11.9
1904 10.5
1905 10.7
1906 11.7
1907 11.6
1908 12.9
1909 12.6
1910 15.5
1911 12.4
1912 14.2
1913 17.0
1914 17.1
1915 15.3
1916 16.7
The graph (Fig. 68) shows that the average yearly price has increased from 9.4
cents a pound to 16.7 cents.

Fig. 68.—Average yearly price of cheese.
306. Canadian cheese statistics.—The following statistics show the
development of the industry in Canada. The figures in Table XXIV show the
number of cheese factories, the amount of milk received and the total production
in Canada.
Table XXIV indicates that the number of cheese factories has decreased but that
the production has increased. Because of the scarcity of figures, conclusions
would not be accurate.
The figures in Table XXV of the exports and imports show that the exports
gradually decreased and the imports increased. If the production has increased,
as shown in Table XXIV, more cheese must be consumed by the Canadians. The
effect of the war is probably seen in the year 1916, when the imports are
decreased and the exports increased.
TABLE XXIV
Showing the Number of Cheese Factories, Amount of Milk Received
and the Factory Production of Cheese

Year Number of Cheese Factories Pounds of Milk Delivered
Factory Production of
Cheese
1900 —— —— 220,833,269
1907 —— —— 204,788,583
1910 2291 —— 199,904,205
1915 1871 1,501,946,221 183,887,837
1916 1813 1,503,997,215 192,968,597
TABLE XXV
Showing the Amount and Value of Canadian Exports and Imports of
Cheese

Year Number of Cheese Factories Pounds of Milk Delivered
Amount in Pounds Value in Dollars Amount in Pounds Value in Dollars
1880 40,368,000 $3,893,000
1890 94,260,000 9,372,212
1900 185,984,000 19,856,324
1910 180,859,000 21,607,692 683,778 ——
1911 181,895,000 20,739,507 866,653 ——
1912 163,450,000 20,888,818 919,189 ——
1913 155,216,000 20,697,000 1,495,758 ——
1914 144,478,000 18,866,000 1,512,108 ——
1915 137,601,000 19,213,000 1,162,456 ——
1916 168,961,000 —— 971,821 ——
If the total population of the United States is figured at 100 million and the
difference between the exports and imports found and added to the total
production, it shows that the average person must consume about three and one-
half pounds of cheese in a year.
In the past few years there has been considerable demand for more of the
foreign cheeses, such as Camembert and Roquefort.
307. Introduction of cheese-making into new regions.—The manufacture
of Cheddar cheese is being encouraged in new regions, in the Alleghany
Mountains, in Virginia, West Virginia, North Carolina, Tennessee and in the
western states. There has also sprung up a considerable demand for the lactic
acid group of cheeses, especially Neufchâtel and Cottage, so that while the
cheese industry may decline in certain sections, the total production will probably
increase. In the proper locations or sections, the cheese industry has a very
bright future. The development of the skimmed-milk cheeses will undoubtedly be
given considerable attention in the next few years.
References
N. Y. Dept. Agr. Bul. 54, The Dairy Industry in New York State.
N. Y. Produce Rev. and American Creamery.
Vol. 34, No. 3, page 108.
Vol. 37, No. 16, page 684.
Vol. 37, No. 16, page 666.
Vol. 37, No. 9, page 411.
Vol. 33, No. 11, page 482.
Vol. 36, No. 23, page 1078.
Wis. Exp. Sta. Rept. 1897, pages 113-149.

U. S. Census.
U. S. Dept. Agr. Year Books.
Bureau of Foreign and Domestic Commerce.
Statistical abstract of the U. S.
Canadian Dept. Agr. 1915, Report of the dairy and cold storage commissioner.
Dominion of Canada, Census and Statistics office, Rept. 1915.

CHAPTER XIX
TESTING
In connection with marketing, a certain amount of testing of the products should
be practiced, to determine exactly the results and grades of products. This
includes the testing of the whole milk, whey and cheese for fat, the milk for
casein, and the cheese for moisture. In factories in which the milk is bought on
the fat basis, it is necessary to test each patron's milk for fat. If there is a cheese-
moisture law in the state, it is necessary to test for moisture. The whey should be
tested to learn the loss of fat in the manufacturing process and to ascertain
whether the losses have been reduced to the minimum.
308. The fat test.—The test commonly used to determine the fat in milk is
known as the Babcock. The principle of this test is as follows: Fat exists in the
form of very small globules. Because the fat globules are lighter than the other
milk constituents, under the influence of the force of gravity most of them rise to
the surface. There, mixed with the other milk substances, these globules form a
layer of cream. Babcock found that by adding to the milk sulfuric acid of proper
strength and temperature, the casein, the milk-sugar and the albumin are
decomposed and the sticky quality of the milk is destroyed. The acid does not
decompose the fat but leaves it free to come to the surface of the mixture. Under
centrifugal force, this fat is quickly brought to the surface. By using a known
quantity of milk and having a scale graduated in percentage of the amount of
milk, the percentage of fat can be determined. Fig. 69 shows the necessary
equipment.

Fig. 69.—Apparatus necessary to test milk and whey for fat and
total solids.
There are three kinds of bottles employed in making the test, one with a very
large neck which is used when testing materials high in fat-content such as
cream, butter and cheese. This is generally called a cream-test bottle. It is
graduated from 0 to 50 per cent. When testing materials with a small amount of
fat such as whey, skim-milk and buttermilk, a test bottle with two necks is used,
one with a small bore for the fat and the other neck with a larger bore to add the
milk, acid, water. It is graduated from 0 to 0.5 of 1 per cent. There is a third
bottle between the other two to test whole milk. This is known as a whole-milk
bottle. It is graduated from 0 to 8 per cent. All of the glassware should comply
with the laws.
309. Sampling the milk.—One of the most important parts of testing is to
obtain a fair sample of the milk. The milk to be tested may be in a vat or in a
farmer's can or a composite sample jar. If the milk is bought on the fat basis, that
of each patron is not tested daily, but a small quantity, about half an ounce, is
taken each day and placed in a jar; this is known as a composite sample. It is the
usual practice to number the patrons and have a sample bottle for each patron
with his number on it. Some substance must be added to preserve the milk and
to keep it from souring or coagulating. It is difficult to secure a fair sample of sour
milk. A wide-mouthed jar is preferred for keeping milk samples. This must be kept
closed to prevent evaporation. Each day when milk is added to the composite
sample, the bottles should be shaken to prevent the cream drying. Composite
samples are tested at least twice a month. The milk may be mixed to obtain a fair
sample, by stirring in the vat or by pouring from one bottle to another. Vigorous
shaking should be avoided as this is likely to cause churning. One should see that
all the cream is removed from the sides of the sample bottle and that it is evenly

distributed through the milk. The sample of milk is now measured out with the
pipette. This is graduated to deliver 18 grams of milk, and holds 17.6 c.c. Hold the
pipette between the thumb and second finger of the right hand with the tip below
the surface of the milk, draw the milk by suction with the lips until it is filled well
above the graduation. Quickly place the forefinger over the opening and at right
angles to the pipette. By gently and carefully raising the forefinger, allow the milk
to run down until the surface is exactly level with the graduation. To obtain an
accurate reading, the pipette should be on a level with the eye. Then with the left
hand, hold the milk test bottle in a slanting position and place the tip of the
pipette into it about one-third of an inch and at a slight angle. Now let the milk
slowly flow down the side of the neck of the bottle, making certain that none is
blown out by the escaping air. When all has run out of the pipette, blow out the
drop which remains in the tip. Then measure out another sample in the same
way, as the test should be made in duplicate.
310. Adding the acid.—The sulfuric acid should have a specific gravity between
1.82 and 1.83. It should be kept in glass-stoppered bottles or carboys to prevent
the absorption of moisture from the air, which will reduce its strength. Acid that is
too strong might burn the fat. The acid is a strong poison and will burn if it comes
in contact with the flesh or the clothing. In such case, it should be removed by
washing with plenty of water. An alkaline substance such as ammonia or
bicarbonate of soda should be applied to remove any acid not washed away.
The acid measure holds 17.5 c.c. and it should be filled to the graduation. Then
this acid should be added to the test bottle. The bottle should be held at an angle
and slowly rotated so that the acid will rinse down any milk remaining in the neck
of the bottle. Immediately mix the acid and milk by whirling the body of the bottle
in a circle five or six inches in diameter. The mixture should not be allowed to go
into the neck of the bottle while mixing. Continue shaking for about a minute
after all the curd has disappeared. One should avoid pointing the neck of the
bottle toward any person in the mixing operation. The acid unites with all the milk
substances except the fat and generates much heat.
311. Centrifuging.—There are two machines in common use for centrifuging,
one that runs by mechanical power and the other smaller and runs by hand. If
the machine and atmosphere are very cold, the apparatus can be warmed by
placing hot water in it. This is not necessary in a steam machine. In a factory
where there are a number of samples to test, a power machine is usually
employed. In this machine there are pockets or cups in which to set the test
bottles. The machine or disk must be balanced by placing bottles in opposite
pockets. These pockets are hinged so that when standing still the bottle is in an
upright position and when the centrifuge is running, it is in a horizontal position.
The machine should then be covered and started running. It should be run at the

speed indicated. After five minutes, stop the machine and fill the bottles with
boiling water up to the neck. This can be done without taking the bottles out of
the machine. A pipette or slender-spouted vessel may be used to add the water.
Whirl the bottles two minutes, then add more boiling water to bring the fat
column into the graduated part of the neck of the bottle. Then whirl one minute.
The test should be read at once or the bottles kept at a temperature of 130° to
140° F. until ready to read.
312. Reading the test.—To read the test, subtract the reading at the bottom of
the fat column from that at the highest point. The curved meniscus which always
forms at the top of the fat column should be included in the reading. Duplicate
samples should not vary more than O.2 of 1 per cent. Standard Babcock test
bottles and pipettes should always be used. In some states the agricultural
experiment stations examine all glassware and mark it to make certain that it
conforms to the requirements of the state law. In New York, glassware found to
be correct is branded "S. B.," which means State Brand. In some states a person
must have a license to test milk or cream, when it is paid for on the fat test. Such
a person must pass an examination to show that he understands the test before a
license, will be granted. The license may be revoked if the work is not honestly
performed.
313. Testing whey for fat.—Because of the small amount of fat in whey, it is
difficult to obtain a representative sample. The best way, if the entire amount
cannot be placed in a vat and stirred, is to catch a little of the whey at intervals as
it is being drawn from the vat. The sample to be tested is measured with the
pipette the same as the milk and placed in the skimmed-milk test bottle. The
same acid is used to test whey as to test milk but because there are not so many
solids to destroy, not so much is used. If as much acid is used with whey as with
milk, it will burn the fat and so interfere with the reading of the test. Just enough
acid is added to destroy the milk substances except the fat, or enough to turn the
contents of the test bottle dark brown. This usually requires filling the acid
measure one-quarter of an inch under the graduation. The remainder of the test
is the same as for whole milk.
314. Testing cheese for fat.—The sample of cheese to test for fat is obtained
by removing the sample with a cheese-trier. This sample is called a "plug."
Different plugs from the same cheese will test various percentages of fat so that it
is difficult to secure a representative sample. The usual practice is to take three
plugs, one near the center, another near the outside and the third between the
first two. The plugs should be put into glass-stoppered bottles to prevent the
evaporation of moisture. These plugs are then chopped up very fine. It is of
course impossible to measure the cheese as with milk and whey, but it is weighed
(Fig. 70). If the cheese is soft it can be stirred with a spatula until well mixed. A

soft cheese usually sticks to the neck of the test bottle. After being weighed, it
can be dissolved in a little sodium hydroxide and poured into the bottle. Different
amounts may be used, commonly 4½ or 6 grams, but 6 grams is to be preferred.
This is placed in the Babcock cream bottle since there will usually be more fat
than can be read in a milk bottle. After the material has been placed in the test
bottle, about two-thirds of an acid-measure of warm water is added to assist in
dissolving the cheese.
Fig. 70.—Apparatus necessary to test cheese for fat.
The acid is added the same as with the milk. If all the cheese particles are not
destroyed, and therefore do not disappear, a little more acid will complete the
solution. Centrifuging is performed as with the milk.
315. Reading the test.—In a cream-test bottle the neck is so much wider that
there is a much larger meniscus. In order to obtain an accurate result, the
meniscus should be removed. This is done by carefully adding a substance called
glymol, which is a mineral oil colored red. Usually about one-quarter of an inch of
glymol is added to the fat column. This should not mix with the fat. The bottles
should be placed in a hot water bath 135° to 140° F. for four minutes before
reading. The temperature at reading should be 135° to 140° F. The reading is
then taken from the bottom of the fat column to the line between this and the
glymol. The bottle is graduated for 18 grams of material, but as only a part of 18
grams of cheese was used for the test, the reading should be multiplied by the
part of 18 grams used. For example, suppose 6 grams of cheese were used and
the test read 12 per cent fat. Since 6 is one third of 18, the actual percentage of
fat is 3 times 12, or 36 per cent.

Fig. 71.—A
Quevenne
lactometer.
316. The Hart134
casein test was devised to determine the percentage of
casein in milk. A special test bottle and centrifuge are necessary. The method of
making the test is as follows: Place 2 c.c. of chloroform in the casein test tube,
add 20 c.c. of a 0.25 of 1 per cent solution of acetic acid at a temperature of 65°
to 75° F. This solution of acetic acid is made by diluting 10 c.c of glacial acetic
acid with 100 c.c. of water, then dilute 25 c.c. of this solution to 1000 c.c. with
water; 5 c.c. of milk at a temperature of 65° to 75° F. is then run into the bottle.
The bottle is then covered with the thumb and inverted and the mixture shaken
vigorously for exactly twenty seconds. It is then centrifuged within twenty
minutes at a speed of 2000 revolutions a minute. The bottle should
stand ten minutes before reading the percentage of casein. There
are other tests for casein but they are very complicated.
317. Solids in the milk.—Because not only the fat but all the
solids are utilized in cheese-making, it is important to know the
amount of the solids in the milk. This is ascertained by determining
the specific gravity of the milk and knowing the fat-content; the
solids not fat can then be calculated.
318. The lactometer.—The specific gravity of liquids is measured
by an instrument called a hydrometer. Its use is based on the fact
that when a solid body floats in a liquid, it displaces a volume of
liquid equal in weight to its own. Hydrometers are in many cases so
made that the specific gravity can be read at the point where the
scale is even with the upper surface of the liquid. A hydrometer that
is especially adapted to milk is called a lactometer. There are two
lactometers in common use, the Quevenne and the Board of Health.
The Quevenne lactometer.—This is a long slender hollow piece of
glass weighted at the bottom to make it float in the milk in an
upright position (Fig. 71). The upper end is slender and contains the
scale. This scale is graduated from 15 at the top to 40 at the
bottom. Each reading on the scale corresponds to the point marked
specific gravity on a hydrometer, except that the figures are not
complete. For example, 15 on the Quevenne scale means a specific
gravity of 1.015; a reading of 30 on the Quevenne scale means a
specific gravity of 1.030, and so on. The Quevenne lactometer is
graduated to give correct results at a temperature of 60° F. The milk should be at
this temperature. If the temperature is below or above this, a correction must be
made to the reading. The temperature should not be more than 10 degrees
above or below 60° F. The correction for each degree in variation of temperature
can be made by adding 0.1 or subtracting 0.1 from the lactometer reading, as the
case may be. If the temperature is above 60° F., the correction is added to the

Fig. 72.—A
Board of
Health
lactometer.
lactometer and if it is below 60° F., the correction is subtracted
from the lactometer reading. The reading should be taken when
the lactometer is floating free in the milk. The scale is read
exactly at the surface of the milk. The better lactometers have a
thermometer with the scale just above or opposite the lactometer
scale.
The Board of Health lactometer.—This is very similar to the
Quevenne lactometer except that the scale is graduated from 0 to
120 (Fig. 72). The point on the scale of the lactometer that floats
at the surface in water is represented by 0, and 100 represents
the specific gravity of 1.029. On the Board of Health lactometer,
the 100 degrees or divisions from 0 to 100 equal 29 divisions on
the Quevenne. Therefore, one division on the Board of Health
equals 0.29 of a division on the Quevenne. To convert Board of
Health reading to Quevenne, multiply by 0.29 and to convert
Quevenne to Board of Health, divide by 0.29. The correction for
temperatures above or below 60° F. is made the same as with the
Quevenne, except 0.3 is added or subtracted from the reading
instead of 0.1 as with the Quevenne.
319. Calculating the solids not fat in the milk.—When the
lactometer reading and fat-content of the milk are known, there
are several formulas for calculating the solids not fat. In the
following formulas, L equals Quevenne lactometer reading at 60°
F., and F equals the percentage of fat in the milk:
L + 0.7 F
———— = S.N.F
5
L + F
———— = S.N.F
4
L
— + 0.2 F + 0.14 = S.N.F
4
320. Testing cheese for moisture.135
—There are two methods of testing
cheese for moisture. The following is a simple test devised by H. C. Troy:
The ordinary butter moisture test, in which a metal cup is heated over a flame,
cannot be used for determining the percentage of water in cheese because the

high temperature developed in operating that test drives from the cheese other
substances with the water. Also, particles are lost by spattering when the cheese
is heated with any degree of rapidity in the shallow butter-moisture cups. To
overcome these difficulties, the new method here described has been developed
for the purpose of determining the percentage of moisture in cheese. The
apparatus consists of:
1 double-walled copper drying cup
1 centigrade thermometer registering to 200°
1 alcohol lamp
1 tripod
1 special flask
1 scales sensitive to 0.01 gram
1 set of weights, 0.01 to 100 grams
The body of the copper drying cup may be made in two parts. One of the parts is
a jacket that forms the outer wall of the apparatus. It has a flat bottom 4½
inches in diameter, and the perpendicular wall is 4½ inches in height. The inner
part of the cup must have a flat bottom 2¾ inches in diameter and a side wall
3¾ inches high. A flange attached to the upper rim of the inner part extends out
at right angles to the cup wall and forms a cover for the space between the walls
when the two parts are put together. The flange is bent down around its outer
edge to make it fit snugly over the upper rim of the outer jacket. It thus holds the
inner cup securely in place, leaving a space about ¾ inch wide for oil between
the walls and bottoms, and permits the apparatus to be taken apart readily. A
circular opening about ½ inch in diameter is made through the flange to permit
the insertion of a thermometer for taking the temperature of the oil or the melted
fat which is used in the space between the walls. Lard or tallow serves best for
use in this space; a readily inflammable oil should not be employed. The
thermometer may be permanently held in place by passing it snugly through a
hole bored in a cork, the cork being then fitted into the hole through the flange. A
flat metal cover is placed on the cup when making a test. This cover has a hole
through the center just large enough to permit the neck of the drying flask to
extend up through it. The cover assists in keeping the body of the flask at a
constant temperature by preventing the entrance of cold air currents. The
thermometer should register changes in temperature between zero and 200° C.
The alcohol lamp should yield a flame about ¼ inch in diameter and ¾ inch high.
The tripod should be about 6 inches high and of proper diameter at the top to
support the oil bath.
An ordinary flat-bottom glass Erlenmeyer flask, of such a diameter as to fit neatly
into the oil-bath cup, may be used to hold the cheese during the drying
operation; but a special glass flask serves better. It is made with a flat bottom 2½

inches in diameter, which will fit into the cup of the drying apparatus. The side
walls of this flask should be perpendicular for about 1 inch, when they should
begin to slope in toward the base of the neck, which should be located about 2
inches above the bottom. The neck of the flask should be 1 inch in diameter, with
perpendicular walls, and its length should give the flask a total height of 4¾
inches. When the apparatus (Fig. 73) is put together for the first time, the melted
fat or oil may be placed in the outer jacket and the inner cup may then be fitted
into position, or the parts may be put together first and the oil then poured into
the space between the cup walls through the opening where the thermometer is
to be placed. The oil should fill the space to within an inch of the top. The cork
through which the thermometer has been passed is then fitted into the opening.
The thermometer bulb should be placed in the oil about half an inch above the
bottom of the outer jacket. The apparatus is then placed on the tripod over the
alcohol lamp. A flame ½ inch in diameter and ¾ inch high will give sufficient heat
to hold the bath at the proper temperature. The temperature may be regulated
by raising or lowering the lamp or by changing the size of the flame by adjusting
the wick. Hundreds of tests may be run without taking the apparatus apart or
changing the oil. The copper drying cup can be made by any tinsmith. The other
parts may be ordered through any dairy or chemical supply company.
Fig. 73.—Apparatus necessary to test cheese for moisture.
In operating the test, the alcohol lamp is first lighted, so that the oil bath may be
warming while the test sample is under preparation. A representative sample of

the cheese, which may be taken with a cheese-trier and held in a glass-stoppered
sample jar, is then cut into particles about the size of kernels of wheat without
removing it from the jar. This may be accomplished with an ordinary table knife
that has had the end squared and sharpened. The clean dry flask is then
accurately balanced on the scales and a 5-gram weight is placed in the opposite
scale pan. Particles of cheese from the prepared sample are put into the flask
until the scales comes to an exact balance. Great care should be taken to avoid
loss of moisture from the cheese in the preparation of the sample.
With the thermometer in the oil bath registering between 140° and 145° C. (or
between 284° and 293° F.), the flask is placed in the cup of the oil bath and the
flat disk-shaped cover is adjusted over the apparatus. The flask should remain in
the bath for fifty minutes, the temperature being kept between 140° and 145° C.
all the time. The flask is then removed, covered and allowed to cool to room
temperature in a dry place. It is then weighed, and the quotient obtained by
dividing the loss in weight by the original weight, multiplied by 100, gives the
percentage of water in the cheese. The following shows the method of
computation:
Problem: Five grams of cheese was heated until the water contained in it was
evaporated. The remaining substance weighed 3.15 grams. What percentage of
water did the cheese contain?
Answer: 5.00 - 3.15 = 1.85
1.85 ÷ 5 = 0.37
0.37 ✕ 100 = 37 (percentage of water in cheese)
A butter-moisture scales with an extra 5-gram weight may be used for weighing
out the 5 grams of cheese. If the scales indicates the amount of moisture in 10
grams of butter by percentage graduations on its beam or by percentage weights,
then it will be necessary to multiply by 2 the percentage indicated by such scales
or percentage weights when only 5 grams of cheese is used.
The moisture may be determined by weighing out a small sample of cheese and
drying it in an oven and calling the loss moisture. Many such ovens have been
devised.
New York and Wisconsin have laws limiting the amount of water which may be
incorporated in Cheddar cheese. New York places the limit at 39 per cent and
Wisconsin at 40 per cent. If the moisture-content is above this, the cheese must
be branded adulterated.

Welcome to our website – the perfect destination for book lovers and
knowledge seekers. We believe that every book holds a new world,
offering opportunities for learning, discovery, and personal growth.
That’s why we are dedicated to bringing you a diverse collection of
books, ranging from classic literature and specialized publications to
self-development guides and children's books.
More than just a book-buying platform, we strive to be a bridge
connecting you with timeless cultural and intellectual values. With an
elegant, user-friendly interface and a smart search system, you can
quickly find the books that best suit your interests. Additionally,
our special promotions and home delivery services help you save time
and fully enjoy the joy of reading.
Join us on a journey of knowledge exploration, passion nurturing, and
personal growth every day!
ebookbell.com

Plant Functional Genomics Methods And Protocols 1st Edition Erich Grotewold

More Related Content

Similar to Plant Functional Genomics Methods And Protocols 1st Edition Erich Grotewold (20)

Recently uploaded (20)

Plant Functional Genomics Methods And Protocols 1st Edition Erich Grotewold