Power Point Presentation on Gene Expression and Regulation.ppt
- 1. The Central Dogma The central dogma states that information in nucleic acid can be perpetuated or transferred, but the transfer of information form into protein is irreversible.
- 2. Gene Expression and Regulation Genes Can Be Expressed with Different Efficiencies at Different Times and Environments
- 3. Translation • The conversion of the information in the language of a nucleid acid into the language of a protein • Translation of the RNA message (mRNA) into a polypeptide chain is catalyzed by the ribosome
- 6. The Genetic Code • Generally, the correspondance between the information stored in the language of nucleid acid and protein • Defines how the message is translated (”a nucleid acid –amino acid dictionary”) • More specifically, the correspondance between triplets of nucleotides in the mRNA (read from 5’ to 3’) and amino acids in protein (read from N-terminus to C- terminus)
- 7. Triplet code (why?) Codon = group of three consecutive nucleotides = triplet Start codon (in green) • AUG Stop codons (in orange) • UAA, UAG, UGA Redundant (usually the 3rd nucleotide), because 61 codons for 20 amino acids The Genetic Code 4n > 20, when n={3,4,5,...}
- 8. The Genetic Code Three Conceivable Kinds of Genetic Codes
- 9. Interpretation of the Code • The meaning of a codon that represents an amino acid is determined by the tRNA that corresponds to it • This requires base pairing between the codon in mRNA with the anticodon of the tRNA within the ribosome • The meaning of the termination codons is determined directly by the protein factors • Chemically similar amino acids are represented by related codons to minimize the effect of mutations • Identical in almost all living organisms (differences in the code of mitochondrial DNA)
- 10. Transfer RNAs (tRNAs) • Adaptor molecules that match amino acids to codons in mRNA • Any cell contains different types of tRNA molecules sufficient to incorporate all 20 amino acids into protein • Some tRNAs can recognise more than one codon • About 80 nucleotides in length
- 11. Structures of tRNAs All tRNAs share a general common structure that includes: • an anticodon triplet loop (pairs with mRNA codons) • an acceptor stem (to which the amino acid is attached)
- 13. Coupling of amino acids to tRNAs 1. The amino acid is accepted by the aminoacyl-tRNA synthetase enzyme and is adenylated 2. The proper tRNA is accepted by the enzyme and the amino acid residue is transferred to the 2’ or 3’ OH of the 3’-terminal residue of the RNA Individual synthetase for each amino acid and corresponding tRNA(s)
- 14. Reading frames 6 reading frames (a–f) in dsDNA (of course, only 3 in mRNA) ORF = Open Reading Frame From start codon to stop codon 5’ ATGTTTGCTGACGGTTTAACGGAAGGCGGAAACATGGCGAAGAAAAAACCAGTAGAAAAA 3’ ---------+---------+---------+---------+---------+---------+ 3’ TACAAACGACTGCCAAATTGCCTTCCGCCTTTGTACCGCTTCTTTTTTGGTCATCTTTTT 5’ a M F A D G L T E G G N M A K K K P V E K b C L L T V * R K A E T W R R K N Q * K K c V C * R F N G R R K H G E E K T S R K K ---------+---------+---------+---------+---------+---------+ d H K S V T * R F A S V H R L F F W Y F F e N A S P K V S P P F M A F F F G T S F f T Q Q R N L P L R F C P S S F V L L F
- 15. Structure of Prokaryotic mRNAs mRNA has also regions that do not encode for a protein Shine-Dalgarno sequence (SD) = Ribosome Binding Site (RBS) The first AUG after SD-sequence is interpreted as the start site of translation
- 16. Shine-Dalgarno Sequences Help to align ribosomes on mRNA to properly start translation Can base-pair with a sequence (ACCUCCUUA) contained in the ribosomal RNA
- 17. The Mechanism of Translation Initiation in Prokaryotes
- 18. The Mechanism of Translation Elongation in Prokaryotes (1) E = exit site P = peptidyl binding site A = aminoacyl binding site
- 19. The Mechanism of Translation Elongation in Prokaryotes (2) Binding of a specific amino acid tRNA to A site
- 20. The Mechanism of Translation Elongation in Prokaryotes (3) Peptide bond formation: chain transfer from peptidyl tRNA to aminoacyl tRNA
- 21. The Mechanism of Translation Elongation in Prokaryotes (4) Translocation of peptidyl tRNA from A site to P site. Ribosome moves one codon to the right, and the now uncharged tRNA moves from P site to E site.
- 22. The Mechanism of Translation Elongation in Prokaryotes (5) Ribosome is ready to start another cycle. The cycles will continue until a termination codon is reached.
- 23. The Mechanism of Translation Termination in Prokaryotes
- 24. The Two Steps of Decoding The genetic code is translated by means of two adaptors that act one after another
- 25. Energetics of Translation For a polypeptide of N residues, a minimum of 4N high energy phosphates (such as ATP or GTP) must be hydrolysed. Cellular peptide bond synthesis 160 kJ/mol. Peptide bond synthesis in dilute solutions 20 kJ/mol. Making a defined sequence of amino acids comes with an energy cost.
- 26. The Regulation of Protein Synthesis When translation is regulated, it is generally done at the initiation state: 1. The tertiary structure of the mRNA can prevent its attachment to the ribosomal subunit 2. Proteins may bind to the mRNA, blocking initiation 3. Anti-sense RNA may block initiation
Editor's Notes
- #1: Information is perpetuated be replication; a double stranded nucleic acid is duplicated to give identical copies. Information is expressed by a two stage process. 1. Transcription generates a single stranded RNA identical in sequence with one of the strands of the duplex DNA 2. Translation converts the nucleotide sequence of RNA into the sequence of amino acids