Prof.s.p.sing. guj univ.talk. 16 sept 2021.final
Download as PPT, PDF0 likes74 views
The document discusses the diversity and biocatalytic potential of microorganisms from saline habitats, presented by Prof. Satya P. Singh at a workshop in September 2021. It covers various aspects including the exploration of extremophiles, their adaptability in extreme environments, and the biotechnological applications of these microorganisms in medicine, agriculture, and industry. The research emphasizes the need for further exploration of non-cultivable microorganisms and novel biocatalytic capabilities for environmental and industrial uses.
![Here below are the predicted Sequence from De novo. The predicted sequences are Blasted against the NCBI
nr bacterial protein databases. The top matches are listed under the pictures of the spectrums.
#1: OBS MASS: 1271.5388 Charge : 2
Predicted Seq: SVNSNLSVPEAR or VSNSNLSVPEAR
Blast report:
gi|90327884|gb|EAS44215.1| hypothetical protein P3TCK_11048 [Photobacterium profundum 3TCK]Length=609 Score = 27.8 bits (58), EUS EAS44215
609 aa linear BCT 23-MAR-2006
DEFINITION hypothetical protein P3TCK_11048 [Photobacterium profundum 3TCK].
ACCESSION EAS44215
VERSION EAS44215.1 GI:90327884
DBSOURCE accession AAPH01000006.1
KEYWORDS .
SOURCE Photobacterium profundum 3TCK
ORGANISM Photobacterium profundum 3TCK
Bacteria; Proteobacteria; Gammaproteobacteria; Vibrionales;
Vibrionaceae; Photobacterium.
REFERENCE 1 (residues 1 to 609)
AUTHORS Bartlett,D.H., Valle,G., Lauro,F.M., Vezzi,A., Simonato,F.,
100 200 300 400 500 600 700 800 900 1000 1100 1200 1300 1400 1500 1600 1700 1800 1900
M/z
0
100
%
Pandey_100506 MaxEnt 3 35 [Ev-149431,It50,En1] (0.050,200.00,0.200,1400.00,2,Cmp) 2: TOF MSMS 636.78ES+
SV N S N L SVPEAR bMax
R A E P V S L N S N VS yMax
472.27
y4
246.17
y2
187.12
b2
159.12
a2
455.25
301.17
b3
370.20
658.37
y6
571.34
y5
484.24
771.45
y7
667.33
885.51
y8
783.44
972.54
y9
955.50
1086.57
y10
1315.93
1141.84
1367.83](https://image.slidesharecdn.com/prof-210916194256/85/Prof-s-p-sing-guj-univ-talk-16-sept-2021-final-102-320.jpg)
![-2
-1.6
-1.2
-0.8
-0.4
0
0.4
0.8
1.2
1.6
2
240
237
234
231
228
225
222
219
216
213
210
207
204
201
Wavelength (nm)
[θ]
x
10
-4
deg
cm
2
dmol
-1
Native Enzyme Denatured 50
Denatured 50 1 M Denature 50 2M
-2
-1.6
-1.2
-0.8
-0.4
0
0.4
0.8
1.2
1.6
2
2
4
0
2
3
7
2
3
4
2
3
1
2
2
8
2
2
5
2
2
2
2
1
9
2
1
6
2
1
3
2
1
0
2
0
7
2
0
4
2
0
1
Wavelength (nm)
[θ]
x
10-4
deg
cm2
dmol-1
Native Enzyme Denatured 70
Denature 70 2M Denature 70 1M
a
b
(NaCl,% w/v) Analysis by K2D2
50˚C 70˚C
α helix β strand α helix β strand
Native 1.58% 24.49% 1.81 36.24
Denature 4.44% 44.17% 1.81 36.25
With 1M NaCl 3.95% 44.11% 1.77 36.09
With 2M NaCl 4.44% 44.17% 1.82 36.07
CD spectroscopy analysis of Ve2-20-91 Protease](https://image.slidesharecdn.com/prof-210916194256/85/Prof-s-p-sing-guj-univ-talk-16-sept-2021-final-105-320.jpg)
![0%
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
AL1 AL3 KH1 KH3 AL KH
Relative
abundance
(%)
Phylum
Others
Unclassified
[Thermi]
Crenarchaeota
Nitrospirae
Cyanobacteria
Euryarchaeota
OD1
Chloroflexi
Acidobacteria
1. Nirali Raiyani & S P Singh Raiyani, Nirali and Singh S.P. 2020, Extraction of
environmental DNA, construction of metagenomic libraries and functional screening of
enzymes from salt pan soil, Indian Journal of Geo-Marine Sciences, Accepted
(NISCARE, CSIR, IF 0.50),](https://image.slidesharecdn.com/prof-210916194256/85/Prof-s-p-sing-guj-univ-talk-16-sept-2021-final-133-320.jpg)
Prof.s.p.sing. guj univ.talk. 16 sept 2021.final
- 1. Exploration of diversity and biocatalytic potential of microorganisms from the saline habitats: Approaches and dimensions Presentation as the Invited Talk at the SKILL ( Scientific Knowledge and Intelligent Logic Laboratory Practices) –Workshop: September 2021, Held at the Department of Microbiology & Biotechnology, Gujarat University, Ahmedabad on 16 September 2021 Prof. Satya P. Singh UGC BSR Faculty (Formerly Professor & Head) UGC-CAS Department of Biosciences Saurashtra University, Rajkot, Gujarat, India Email: satyapsingh@yahoo.com satyapsingh125@gmail.com spsingh@sauuni.ac.in LinkedIn: https://www.linkedin.com/in/satya-singh-2285a5144/ ResearchGate: https://www.researchgate.net/profile/Satya_Singh5 Google Scholar: https://scholar.google.com/citations?hl=en&user=jiAzOcgAAAAJ UGC: https://vidwan.inflibnet.ac.in//profile/68903/Njg5MDM%3D ORICID Id https://orcid.org/0000-0002-7531-2872
- 2. The Framework of the Talk •Exploration & Limitations • Extreme Habitats and Extremophiles •Diversity based on Morphological/Cultural/Metabolic Traits • Diversity based on Molecular Traits •Biochemical & Genetic Characteristics of Enzymes •Metagenomics and non cultivable microorganisms
- 3. Microbes: The Master Chemists Anton van Leeuwenhoek Pasteur Watson &Crick Genetic Engineering & Molecular Biology Microbes Versatility Diversity Fast Growth Easy to manipulate Impact & Applications Medicine : Disease, Vaccines, Health& Hygiene Agriculture: Soil Fertility& disease Control Industries : Production of value based products Environment : Monitoring & Management
- 4. Domesticating Microbes Newer Applications Got into the Way •Central Dogma of Life: the fundamental Processes of Life •Ability to manipulate Genes and Genomes Biological factories & Expression of Foreign Genes •Tools to rapidly sequence the DNA and proteins •PCR •Search for New Microbial Potential •Access to Non-Cultivables
- 5. Limitations Microbial activities- limited by certain conditions Only fraction (1-5%) of the microbial world- Cultivable and hence explored and investigated Majority Applications under Natural Environmental Conditions- limited
- 6. Need of the Hour Exploration of newer habitats- Extremophiles in particular/Newer approaches of cultivation Evolving the known microbial potential: Gene shuffling and Directed evolution Evolving unique & novel biocatalytic capabilities for industrial & Environmental applications
- 7. Why Extreme Environments and Extremophiles??? Evolutional aspects Living fossils, Origin of Life, Life on other planets, Ultra extreme habitats on earth Biodiversity Extreme environments represent large proportion of the planet, Only Limited studies Commercial Aspects Metabolisms, Metabolites, Biomolecules- Polluted environments are extreme
- 8. Ultra- Extreme, Extreme, Moderately Extreme Environments Microbial diversity- static or variable ??? Ultra-Extreme Habitats Prevent growth of the majority of the microorganisms Harbor true extremophiles, Limited diversity- but static/stable Moderate-Extreme Habitats Not static, keeps changing, microbial diversity fluctuates
- 9. Adaptations to the Extremity At Various levels Cell Morphology Cell envelops & Appendages: CW, CM, Flagella, Capsule Membrane Transport Metabolism Structure & Stability of Macromolecules Thermodynamic adaptations
- 10. Adaptation to Extremely High Temperature •Adaptation to Extremely High Temperature: Genetically Encoded •Sequence Modifications : Replacing confirmationally constrained residues, such as glycine •Addition of Salt Bridges •Enhanced Hydrophobic Interactions •Additional Ion pairing and H-bonding •Improved core packing •Shortening of Loops
- 11. EXTREMOPHILES:MOLECUALR BIOLOGY Genomes, Genome Organizations and Gene Expressions Gene organization and regulation: Analogous genes is co-liner in archaea and eubacteria Functionally Related genes are organized in polycistronic transcriptional unit. Regulation of Gene Expression and Operons does not reflect the similarity with eubacteria. Chromosome structure: Archaea: single, circular DAN molecules Histone like proteins Relatively compact structure similar to eukaryal neculosome. DNA binding protein: HTa (DNA binding protein ) from Thermoplasma acidophilium. Sequence similarities to the HU family of eubacterial histone like protein Protecting DNA against thermal denaturation and degradation. Topoisomerase: A novel DNA topoisomerase activity (reverse gyrase) from thermophilic Archaea Catalyses positive super coiling Widely distributed among Archaea Role in the stabilization of DNA at high temperature. Mechanism of DNA replication Not completely known. In Archaea DNA polymerase from several thermophilc extensively characterized In-vitro DNA synthesis at high temperature like PCR and sequencing reaction.
- 16. The vivid red brine (teaming with halophilic archaebacteria) of Owens Lake contrasts sharply with the gleaming white deposits of soda ash (sodium carbonate). The picturesque Inyo Range can be seen in the distance.
- 18. HALOALAKLIPHILIC BACTERIA & ARCHAEBACTERIA Molecular Phylogeny: Extensive work is going on Halalakliphilic bacteria & archaea, mostly from soda lakes Biochemical basis of salt tolerance & dependence: Halobacterium salinarum, Salinibacter ruber Amino acid composition of bulk protein High intracellular salt levels Intercellular osmolytes Protein stability & salt dependence: Few enzymes are purified and characterized Salt dependence assessed- varies extensively Comparison of crude, purified and recombinant glucoglycerol phosphate synthase (Synchocystis sp.) Regulation of gene expression Salt dependent Gene expression Marine Cyanobacterium (Synechococcus sp ) Hegemann ,J. Bact., 2002 Denaturation & Protein folding Susceptibility of salt tolerant proteins to denaturants- some are highly resistant to urea denaturation Renaturation under in-vitro conditions Role of molecular chaperones in salt stress cellular conditions
- 19. Haloalkaliphilic bacteria & Archaebacteria Phylogeny, Diversity, Enzymatic potential Molecular Phylogeny 16S rRNA Sequencing DNA-DNA Hybridization Real Time PCR Diversity Based on: Morphology Gram Reaction Sugar Utilization Enzyme secretion Protein folding Studies on Growth & Enzyme Secretion as a function of: Salt PH Nutritional factor Purification& Characterization of alkaline Protease Effect of salt on pH and thermal stability Protein Denaturation & Renaturation Cloning & Sequencing of alkaline Protease Salt & Regulation of gene Expression Metagenomics of saline Habitats : Phylogeny & Retrieval of Novel genes for biocatalysts
- 22. Actinomycetes • Gram positive, high G+C % • Spore forming bacteria; having thin, long, branched mycelia. • About 40 families, 170 Generas, 2000 species • Thermophilic actinomycetes are omnipresent; but are widely found in compost and hay • Halophilic actinomycetes are less explored
- 23. Light and Electron microscopic examinations
- 24. Cultural characterization of actinomycetes
- 25. Comparative outline of the morphological features of the isolates Mit-1 RJT-1 RJT-2 Diu-1 Diu-2 Diu-3 Diu-4 Di-J-1 Mycelial structure filamentous + + + + + + + + Curved, hook Shaped mycelia - - + - - - - - Fragmentation + - - + - + - - Sporulation starts After…. 5 >9 6 7 >9 7 >9 >9 (days) Morphology of spores Shape Elongated - Oval Spherical - Elongated - - Surface Smooth - Smooth Smooth - Smooth - - Number in long chain - 4-5 8-10 - - 1-3 - chain
- 26. Light microscopic examinations (1000x) of isolates form Okha Madhi after Gram’s staining SEM analysis of actinomycetes from different sites demonstrating a) vegetative mycelia of OM-4; b, c, d) Sheikh, M., Rathore, D.S., Gohel, S.D. and Singh S.P. 2019. Indian Journal of Geo-Marine Sciences (CSIR-NISCARE), In Press Gohel, S. D. and Singh S.P. 2018. Geomicrobiology Journal, 35:9, 775-789 Thumar, J.T. and Singh S.P. 2011. Biotechnology Bioprocess Engineering, 16, 6:1180-1186
- 27. In situ observation of the isolates using slide culture technique
- 28. Cell morphology and Gram reaction Cultural characterization Pigmentation profile
- 29. 0 10 20 30 40 50 H2S Production Indole Oxidase Nitrate Catalase Urea Utilization MR VP Phenyl alanine Isolates Biochemical fingerprinting 0 5 10 15 20 25 30 35 Arabinose Rhamnose Xylose Raffinose Mannose Inositol Lactose Fructose Trehalose Cellobiose Maltose Mannitol Isolates Sugar utilization profile
- 30. 30 Production of NH3 from rhizospheric isolates from H. indicum and T.portulacastrum ( Paragi Jadav, M. Phil Thesis, Saurashtra University, 2020) (Paragi Jadav, Abstract Book, National Conference on National Conference on Innovations in Biological Sciences, 10 January 2020)
- 31. Solubilization of P from rhizospheric isolates from H. indicum and T.portulacastrum (Top) from L. stocksii and I.pes-caprea (Below) ( Paragi Jadav, M. Phil Thesis, Saurashtra University, 2020) (Paragi Jadav, Abstract Book, National Conference on National Conference on Innovations in Biological Sciences, 10 January 2020)
- 32. Antibiotics sensitivity & resistance profile Antimicrobial activity against pathogens Strains No. of antibiotics Resistant (a) Tested (b) MAR index (a/b) Ok-1 12 31 0.387 Ok-2 7 31 0.225 Ok-4 7 31 0.225 Ok-6 12 31 0.387 Ok-8 6 31 0.193 Ok-10 6 31 0.193 Ok-13 9 31 0.290 Ok-14 12 31 0.387 Ok-17 9 31 0.290 Ok-18 14 31 0.451 Ok-19 15 31 0.483 Ok-20 12 31 0.387 Ok-22 12 31 0.387 Ok-23 10 31 0.322 Ok-24 13 31 0.419 D-2 13 31 0.419 D-5 19 31 0.612 D-8 11 31 0.354 S-1 11 31 0.354 S-2 25 31 0.806 Sampling site wise MAR Indices Total strains (c) Aggregate antibiotic resistance score (a) No. of antibiotics tested (b) MAR index a/(b × c) Okha Port (15) 143 31 0.307 Dwarka beach (3) 43 31 0.462 Somnath beach (2) 36 31 0.580 MAR (Multiple Antibiotic Resistances) Indices of different marine actinomycetes Sharma, A.K. Kikani, B.A. and Singh S.P. 2020, Geomicrobiology Journal, DOI:10.1080/01490451.2020.1860165
- 33. Antibiotic sensitivity profile on the basis of mode of action (a: U- I, b: U- II and c: U- III)
- 34. Install PAST software 1) Creation of binary data sheet in PAST software • “Binary Matrix: ”Phenotypic data (Biochemical tests, Sugar utilization tests, Enzyme secretion, Antibiotic sensitivity profile) is converted to • Columns: Phenotypic tests, Rows: Isolates • Presence of phenotype: 1, Absence of phenotype: 0 2) Construction of phenogram • Select all cells with data • Select Multivariate analysis Select Cluster analysis Unweighted Pair Group Mean Averages (UPGMA) algorithm Jaccard Similarity measure Numerical taxonomy: Step for cluster analysis and phenogram construction
- 35. Nature | Vol 582 | 11 June 2020 | 301 ADVENTURES IN MICROBIOLOGY: Cultivability ???? Researchers designing technologies to find and grow microbes that have never before survived in the lab. By Amber Dance Chip to incubate pure cultures of microorganisms in soil
- 37. Molecular Approaches to study Actinomycetes Gohel, S. D. and Singh S.P. 2018. Molecular phylogeny and diversity of the salt-tolerant alkaliphilic actinobacteria inhabiting Coastal Gujarat, India. Geomicrobiology Journal, 35:9, 775-789 Dangar, K. G., Kalasava,A. B., Dave, A. V. and Singh S.P. 2018. Molecular diversity of Nocardiopsis alba sp. isolated from the coastal region of Gujarat, India. Journal of Cell &Tissue Research, 18(3) 6559-6570. Thakrar, F.J., Kikani, B.A., Sharma, A.K. and Singh S.P. 2018. Stability of alkaline proteases from haloalkaliphilic actinobacteria probed by circular dichroism spectroscopy. Applied Biochemistry and Microbiology (Russia), 54(6), 591-602 Sheikh, M., Rathore, D. S., Gohel, S. D. and Singh S.P. 2018. Marine actinobacteria associated with the invertebrate hosts: a rich source of bioactive compounds: A Review. (Invited contribution) Journal of Cell &Tissue Research, 18 (01), 6361-6374. Dwivedi, Purna, Sharma, A. K. and Singh, S.P. 2021. Biochemical properties and repression studies of an alkaline serine protease from a haloalkaliphilic actinomycete, Nocarpdiopsis dassonvillei subsp. albirubida OK-14. Biocatalysis and Agricultural Biotechnology, Accepted. 07 June 2021 (Elsevier; IF: 0.90) Rathore, D. R., Sheikh, M., Gohel G.D, and Singh, S.P. 2021. Genetic and phenotypic heterogeneity of the Nocardiopsis alba strains of sea water. Current Microbiology, 78: 1377-1387 (Springer; IF: 1.75), DOI: 10.1007/s00284-021-02420-0
- 38. primer sequence 1st step 2nd step 3rd step No. of cycles Expected bp denatura tion annealing extention U1 5’-AGAGTTTGATCCTGGCTCAG-3’ 94ºc - 10 min. 94ºC – 30s 72ºc – 10min 30 1500 bp AAGGAGGTGATCCAGCCGCA-3’ 56ºC – 30s 72ºC – 60s U2 5’ CCAGCAGCCGCGGTAATACG-3’ 94ºc – 5min 94ºc – 1min 72ºc – 10min 30 1000 bp 5’ ATCGGCTACCTTGTTACGACTTC 55ºc – 1min 72ºc – 1min N -F/R 5’-CGCATAGGGTGCTGGTGGAAAG-3’ 94ºc – 4min 94ºc – 30s 72ºc – 10min 30 1120 bp 5’-GAGGTCGGGTTGCAGACTTCG-3’ 56ºc – 30s 72ºc - 2min Strep B/E 5’-ACAAGCCCTGGAAACGGGGT-3’ 95ºc – 8min 95ºc – 1min 72ºc – 10min 30 520 bp 5’-CACCAGGAATTCCGATCT-3’ 54ºc – 40s 72ºc – 2min Strep B/F 5’-ACAAGCCCTGGAAACGGGGT-3’ 95ºc – 8min 95ºc – 1min 72ºc – 10min 30 1170 bp 5’-ACGTGTGCAGCCCAAGACA-3’ 58ºc – 40s
- 39. 0.8% agarose gel show PCR products of isolates from Okha Madhi amplified with (a) U1 primer at 52.3°C 55.3°C 59.4°C: lane-1 Medium range DNA ruler lane-2,3,4 OM-3, lane-5,6,7 OM-4 lane-8,9,10 OM-5 lane-11,12,13 OM-6 lane-14 Super Mix DNA ladder, lane-15,16,17 OM-8 lane-18,19,20 OM-9 lane-21,22,23 OM-11 (b) U2 primer at 52.7°C, 55.9°C, 59.2°C: lane-1 High range DNA ruler lane-2,3,4 OM-1 lane-5,6,7 OM-3 lane-8,9,10 OM-4 lane-11 Super Mix DNA ladder, lane-12,13,14 OM-6 lane-15,16,17 OM-7 lane-18 High range DNA ruler lane-19,20,21 OM-8 lane-22,23,24 OM-9 lane-25,26,27 OM-11
- 40. 0.8% agarose gel show PCR products of isolates Okha Madhi amplified with (a) StrepB/E (Lane 2-24) at 50.7°C, 53.9°C, 56.7°C and StrepB/F (Lane 26-28) at 54.1°C, 58.1°C, 60.0°C lane-1 High range marker (10 kb), lane-2,3,4 OM-3 lane-5,6,7 OM-4 lane-8 High range marker, lane-9,10,11 OM-5 lane-12 High range marker, lane-13,14,15 OM-8 lane-16,17,18 OM-9 lane-19,20,21 OM-10 lane-22,23,24 OM-11 lane-25: High range marker, lane-26,27,28 OM-2 (b) N F/R primer at 53.3°C, 56.4°C, 60.0°C lane-1 high range marker (10 kb), lane-2,3,4 OM-6 lane-5,6,7 OM-8 lane-8,9,10 OM-9 lane-11,12,13 OM-11 lane-14,15,16 OM-12
- 41. 0.8% agarose gel show PCR products of isolates from Okha Madhi amplified with (a) U1 primer at 52.3°C 55.3°C 59.4°C: lane-1 Medium range DNA ruler lane-2,3,4 OM-3, lane-5,6,7 OM-4 lane-8,9,10 OM-5 lane-11,12,13 OM-6 lane-14 Super Mix DNA ladder, lane-15,16,17 OM-8 lane-18,19,20 OM-9 lane-21,22,23 OM-11 (b) U2 primer at 52.7°C, 55.9°C, 59.2°C: lane-1 High range DNA ruler lane-2,3,4 OM-1 lane-5,6,7 OM-3 lane-8,9,10 OM-4 lane-11 Super Mix DNA ladder, lane-12,13,14 OM-6 lane-15,16,17 OM-7 lane-18 High range DNA ruler lane-19,20,21 OM-8 lane-22,23,24 OM-9 lane-25,26,27 OM-11 Gohel, S. D. and Singh S.P. 2018. Molecular. Geomicrobiology Journal, 35:9, 775-789
- 42. 0.8% agarose gel show PCR products of isolates Okha Madhi amplified with (a) StrepB/E (Lane 2-24) at 50.7°C, 53.9°C, 56.7°C and StrepB/F (Lane 26-28) at 54.1°C, 58.1°C, 60.0°C lane-1 High range marker (10 kb), lane-2,3,4 OM-3 lane-5,6,7 OM-4 lane-8 High range marker, lane-9,10,11 OM-5 lane-12 High range marker, lane-13,14,15 OM-8 lane-16,17,18 OM-9 lane-19,20,21 OM-10 lane-22,23,24 OM-11 lane-25: High range marker, lane-26,27,28 OM-2 (b) N F/R primer at 53.3°C, 56.4°C, 60.0°C lane-1 high range marker (10 kb), lane-2,3,4 OM-6 lane-5,6,7 OM-8 lane-8,9,10 OM-9 lane-11,12,13 OM-11 lane-14,15,16 OM-12
- 43. 16S rRNA amplification profile of isolates from A) Okha Madhi and B) Okha site U1 U2 StrepB/E StrepB/F N-F/R OK-1 OK-2 OK-3 OK-4 OK-5 OK-6 OK-7 OK-8 OK-9 OK-10 U1 U2 StrepB/ E StrepB/ F N-F/R OM-1 OM-2 OM-3 OM-4 OM-5 OM-6 Gohel, S. D. and Singh S.P. 2018. Molecular. Geomicrobiology Journal, 35:9, 775-789
- 44. Primer Denaturation Annealing Extension No. of cycles F243 & R513 94ºC - 5 min 94ºC-30s 56ºC-30s 72ºC-1min 72ºC-10 min 30 F984 & R1378 94ºC - 5 min 96ºC-45s 56ºC-30s 72ºC-2min 72ºC-10 min 35 U1F & R 94ºC-10 min 94ºC-30s 56ºC-30s 72ºC-1min 72ºC-10 min 30 U2F & R 94ºC-10 min 94ºC-30s 56ºC-30s 72ºC-1min 72ºC-10 min 30 NF & R 94ºC - 5 min 94ºC-30s 60ºC-30s 72ºC-1min 72ºC-10 min 30 PCR amplification conditions
- 45. 0 5 10 15 20 25 F243 & R513 F984 & R1378 U1F & R U2F& R NF & R Total no. of isolates 16S rDNA Based Profiling of the actinomycetes of water origin 16S rRNA gene amplification profile Sharma, A.K. Kikani, B.A. and Singh S.P. 2020, Geomicrobiology Journal, DOI: 10.1080/01490451.2020.1860165
- 46. Chemotaxonomic features Sharma, A.K. Kikani, B.A. and Singh S.P. 2020, Geomicrobiology Journal, DOI: 10.1080/01490451.2020.1860165
- 47. Amplified ribosomal DNA restriction analysis (ARDRA) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 1 2 3 4 5 6 7 A B Abbreviations: A: 1- Marker, 2-D2, 3-OK-24, 4-OK-4, 5-OK-17, 6-OK-18, 7-OK-8, 8-D8, 9-OK-19, 10-OK-13, 11- OK-22, 12-OK-20, 13-OK-1, 14-S1, 15-D-5 B: 1-Marker, 2-S2, 3-OK-23, 4-OK-10, 5-OK-2, 6- OK-6, 7-OK-14 (Left to right position) Sharma, A.K. Kikani, B.A. and Singh S.P. 2020, Geomicrobiology Journal, DOI: 10.1080/01490451.2020.1860165
- 48. Phylogenetic tree constructed by the neighbor-joining method conducted using BioEdit version 7.2.5 Sharma, A.K. Kikani, B.A. and Singh S.P. 2020, Geomicrobiology Journal, DOI:10.1080/01490451.2020.1860165
- 49. Step for constructing phylogenetic tree using MEGA software Step 1: Aligning sequences • Retrieve 16S rRNA gene sequences (FASTA files) of the isolates • Install MEGA X software • Make one combine FASTA file for all isolates • Open combined file on MEGA software: Go to Align (dropdown) --> Edit/Build Alignment --> Retrieve sequences from a file --> OK. • Select all sequence and Go to Alignment --> Align by ClustalW • After processing, go to Data --> Save Session. Step 2: Constructing the phylogenetic tree • Open the session previously saved. • Select the Neighbor-Joining method for tree construction. • Finally, it will show you the constructed tree. You can save the tree session.
- 50. Novel Lineages & Whole genome Sequences
- 51. Nowlan B., Dodia, M.S., Singh, S.P and Patel, B. K. C. 2006. Int J Syst Evol. Microbiol 56:1073-1077
- 52. TEM results fro Bacillus indiensis. a) Thin Film TEM. Bar represents 200nm. b) Thin Film TEM demonstrating Gram-positive cell wall. Bar indicates 50nm. c and d) Negative Stain TEM showing the rod shape of cell and flagella. Bar indicates 500nm
- 53. Phase contrast micrograph of strain KJ1-10-99T and strain KJ1-10-93T showing endospores formation Description of Desertibacillus haloalkaliphilus gen. nov. sp. nov.
- 56. Salient Features of Halophilic/Haloalkaliphilic Bacteria •Wide occurrence of the bacteria with variable level of salt tolerance and salt needs •The enzyme level- Varied levels from costal Gujarat •Homology based on 16 S rRNA gene sequencing indicated presence of some novel strains •Variation in optimum Salt, pH and temperature range for catalysis and for stability •Denaturation of proteins- Extremely resistant against denaturation •In-vitro protein folding: Renaturation varies and affected by pH, Salt, Temperature •Salt -Dependence thermo stability and temperature profile •Heterologous gene expression-Effect of salt •Metagenomics-Exploration of novel genes Ref: Dwivedi, Purna, Sharma, A. K. and Singh, S.P. 2021. Biocatalysis and Agricultural Biotechnology, 07 June 2021 (Elsevier; IF: 0.90) Kikani, B.A. and Singh, S.P. 2021.. Critical Reviews in Biotechnology, 2021 (Taylor & Francis; IF: 8.102) Rathore, D. R., Sheikh, M., Gohel G.D, and Singh, S.P. 2021. Genetic and phenotypic heterogeneity of the Nocardiopsis alba strains of sea water. Current Microbiology, 78: 1377-1387 (Springer; IF: 1.75), DOI: 10.1007/s00284-021-02420-0 Bhatt, H.B., Begum, M.A., Chintalapati, S., Chintalapati, V.R. and Singh, S.P. 2017. International Journal of Systematic & Evolutionary Microbiology (IJSEM), 67(11):4435-4442 (IF 2.1) Gohel, S. D. and Singh S.P. 2018. Molecular phylogeny and diversity of the salt-tolerant alkaliphilic actinobacteria inhabiting Coastal Gujarat, India. Geomicrobiology Journal, 35:9, 775-789 Nowlan B., Dodia, M.S., Singh, S.P and Patel, B. K. C. 2006. Int J Syst Evol. Microbiol 56:1073-1077 Dodia M. S., Rawal C. M., Bhimani H. G., Joshi R. H., Khare, S. K. and Singh, S. P. 2008. Journal of Industrial Microbiology & Biotechnology 35(2):121-132 Raval, V. Rawal, C.M., Pillai, S. and Singh S.P. 2014. Process Biochemistry 49 (6): 955-962 (IF 2.63) Dodia M. S., Rawal C. M., Bhimani H. G., Joshi R. H., Khare, S. K. and Singh, S. P. 2008. Journal of Industrial Microbiology & Biotechnology 35(2):121-132
- 58. Extra cellular enzyme detection Gohel, S. and Singh S.P. 2015. . International Journal of Biological Macromolecules (IJBIOMAC). DOI: 10.1016/j.ijbiomac.2014.08.008, Vol 74: 421-429 (IF 3.00). Gohel, S. and Singh S.P. 2013. International Journal of Biological Macromolecules (IJBIOMAC) 56: 20– 27 (IF 2.45). Gohel, S. and Singh S.P. 2012., J Chromatography- B,889– 890, 61– 68 (IF 2.9). Gohel, S. and Singh S.P. 2012. International Journal of Biological Macromolecules (IJBIOMAC) 50: 664– 671 (IF 2.45).
- 59. Isolateion from Differnt sites Okha 13 Jodiya 10 Diu 5 Mithapur 37 Enzyme producers from all site Amylase 3 None 9 Lipase 40 Protease 42
- 60. Mithapur Both (Protease and Lipase) 22 Amylase 1 None 3 Lipase 26 Protease 29 Okha Protease 4 Lipase 5 None 4 Amylase 1 Both (Protease and Lipase) 2 Protease 7 Amylase 0 None 1 Lipase 8 Both (Protease and Lipase) 6 Jodiya 6 Diu Protease 1 Lipase 1 None 3 Amylase 1 Both (Protease and Lipase) 0 Dodia, M. S., Joshi, R.H., Patel, R.K., Singh, S.P.. 2006 Brazilian Journal of Microbiology. 37:276-282
- 61. Enzymes from the Actinomycetes of Sea Origin (MoES Net Working Project, Govt. of India)
- 62. Representative photos of Alang isolates Sheikh M.A., Rathore D.S., Gohel S.D. and Singh S.P.(2019) Sheikh M.A., Rathore D.S., Gohel S.D. and Singh S.P. Ind J of Geo-Marine Sciences(2019)
- 63. Pre-monsoon Monsoon Profile of the Extracellular Enzyme Secretion : Marine Actinomycetes from Kachhigarhi Post-monsoon Amylase secretion is in majority followed by Protease and Lipases among all seasons Rathore, D. R., Sheikh, M., Gohel G.D, and Singh, S.P. 2021. Current Microbiology, 78: 1377-1387, DOI: 10.1007/s00284-021-02420-0
- 64. Enzyme Secretion by Winter isolates of the actinomycetes from Alang 0 10 20 30 40 50 60 Zone of hydrolysis(mm) Isolates Protease screening of Winter isolates 0 5 10 15 20 25 30 35 40 45 50 Zone of hydrolysis(mm) isolates Amylase screening of Winter isolates Sheikh M.A., Rathore D.S., Gohel S.D. and Singh S.P.(2019)
- 65. Enzyme screening of Summer isolates of the actinomycetes from Alang 0 5 10 15 20 25 30 35 40 45 AlS1 AlS2 AlS3 AlS4 AlS5 AlS7 AlS8 AlS9 AlS10 AlS11 AlS12 Zone of hydrolysis(mm) Name of isolates Protease screening of Summer isolates 0 5 10 15 20 25 30 35 AlS1 AlS2 AlS3 AlS4 AlS5 AlS7 AlS8 AlS9 AlS10 AlS11 AlS12 Zone of hydrolysis(mm) Name of isolates Amylase Enzyme screening of Summer isolates
- 66. Enzyme Secretion by Monsoon isolates of the actinomycetes from Alang 0 5 10 15 20 25 30 35 40 45 50 Zone of hydrolysis(mm) Name of isolates Protease Production by Monsoon isolates 0 5 10 15 20 25 30 AlM1 AlM3 AlM4 AlM5 AlM6 AlM7 AlM9 AlM10 AlM11 AlM12 AlM13 AlM14 AlM15 Zone of hydrolysis(mm) Name of isolates Amylase Production by Monsoon isolates
- 67. Extent of alkaline proteases production from sea water 0 100 200 300 400 500 S-20-9 S-15-9 D-15-9 D-20-91 Ve2-15-91 Ve2-10-10 Ve2-20-92 Isolates Activity (U/ml/min) Activity
- 68. Diversity among the Haloalkaliphilic bacteria with regards to the extent of protease production B 0 100 200 300 400 A H - 6 S j - 1 S j - 2 A 0 5 10 15 20 25 30 M i30-3 M i25-41 M i20-42 M i25-51 M i10-31 M i10-33 M i10-63 Protease activity (U/ml)
- 69. Isolates Alkaline Proteases Optimum pH Optimum Salt ,%(w/v) Activity Stability Activity Stability S3-20-5 9 9-9.5 10 0-10 Mi-15-4 8.5-10 9-10 0-15 0-10 Mi-15-3 9-9.5 9.5 0-15 0-10 Sj-1 9.5-11 7-11 0 0-20 Sj-2 10-11 7-11 0-1 0-10 AH-6 8.5-11 7-9.5 0-1 0-10 Ve1 10-11.5 9-10 0-0.5 0-1
- 70. Optimum salt requirement for Growth and Enzyme Secreation 0 5 10 15 20 25 30 35 0 5 10 15 20 25 Salt (%, w/v) Number of Isolates Optimum pH require for Growth and Enzyme Secreation 0 5 10 15 20 25 7 8 9 10 pH Number of Isolates Growth Enzyme secreation
- 71. Regulation of Enzyme Synthesis
- 72. 2016 Dec; 12: 40–51. Effect of amino acids on the repression of alkaline protease synthesis in haloalkaliphilic Nocardiopsis dassonvillei Amit K. Sharma and Satya P. Singh⁎ Repression of alkaline protease
- 73. 0 20 40 60 80 100 120 0 0.5 1 1.5 2 2.5 3 0 1 2 3 4 5 6 7 8 OM-6 0 100 200 300 400 500 600 700 0 0.5 1 1.5 2 2.5 3 0 1 2 3 4 5 6 7 8 OK-5 Growth (■) and protease production (■) among OM-6 and OK-5 isolates at increasing number of amino acids at 1% concentration of each Growth at 540nm Protease activity (U/ml/min) Protease activity (U/ml/min) Growth at 540nm Increasing number of amino acids Increasing number of amino acids 1. Phenylalanine, 2. Leucine 3. Methionine, 4. Tyrosine 5. Aspartic acid 6. Arginine 7. Histidine 8. Asparagine
- 74. Effect of combinations of amino acids on protease production 0 0.5 1 1.5 2 2.5 0 1 2 3 4 5 6 No. of amino acids Growth (A 540 ) 0 50 100 150 200 250 Activity (U/ml) Growth Activity 1) Phe ala 2) Phe ala + leu 3) Phe ala + leu + met 4) Phe ala + leu + met + tyr 5) Phe ala + leu + met + tyr + asp 6) Phe ala + leu + met + tyr + asp + arg
- 75. 0 0.5 1 1.5 2 2.5 C ontrol M et A la H is Tyr P he A rg Leu A sn Amino acids (1%, w/v) Growth (A 540 ) 0 20 40 60 80 100 120 140 Activity (U/ml) 0 0.5 1 1.5 2 2.5 Control Molasses Wheat flour Whey Crude source (1%, w/v) Growth (A 540 ) 0 30 60 90 120 150 Activity (U/ml) Growth (■) Activity (■) Effect of amino acids and crude nutritional sources on growth and protease production Amino acids Crude sources
- 76. Effect of cations and media on protease production 0 1 2 3 4 GB SB CMB SCB AB GA GAB GCB GGB Media Growth (A540) 0 25 50 75 100 125 150 Activity (U/ml) 0 0.5 1 1.5 2 2.5 KCl MnCl2 MgCl2 CaCl2 Cations (0.5 %, w/v) Growth (A540) 0 100 200 300 400 Activity (U/ml) Growth (■) Activity (■) cations Media
- 77. ALKALINE PROTEASE: PRODUCTION AND CATALYSIS UNDER NON-AQUEOUS CONDITIONS
- 79. Growth behavior of Mit-1 in the presence of Organic solvents Control Xylene Butanol Benzene
- 80. Comparison of specific enzyme production with complex medium and with organic solvent as the sole source of carbon (0.1%) Medium Specific enzyme Comparative production fold (Enzyme activity/growth) Complex medium 49 1.0 (gelatin broth) MM* + Butanol 2400 48.9 MM+ Xylene 1083 22.1 MM+ Acetone 268 5.5 MM+ Benzene 73.8 1.5 MM+ Ethanol 20.21 0.412
- 81. Purification & Characteristics of Proteases
- 85. Organisms Gene Bank Number Cultural characteristics Optimum pH (Range) Optimum Temperature ( Range) Optimum Salt (Range) Solvent tolerance Reference Haloalkaliphilic bacterium S- 15-9 GU059918 Round, opaque, smooth, regular 9.5-10.5 60 5-25% Methanol, Propanol,Xylene, n-hexane Joshi RH 2006 Haloalkaliphilic bacterium S- 20-9 EU118360 Round, opaque, smooth, regular 10.5 50-60 5-25% Methanol,Butanol Propanol,Xylene, n-hexane Joshi et al 2008 Haloalkaliphilic bacterium D- 15-9 HM047795 Round, opaque, smooth, regular 10 50-60 5-25% Methanol, propanol Joshi RH 2006 Oceanobacillus oncorhynchi D-20-91 HM047798 Round, opaque, smooth, regular 9.5-12.5 50-60 5-25% -- Joshi RH 2006 Haloalkaliphilic bacterium Ve2-10-10 HM047799 Round, opaque, smooth, regular 10.5 50-60 5-25% -- Joshi RH 2006 Oceanobacillus oncorhynchi Ve2-15-91 HM047796 Round, opaque, smooth, regular 9.5-13 50-60 5-25% Methanol, Butanol Propanol,n-hexane Joshi RH 2006 Oceanobacillus iheyensis Ve2- 20-92 HM047797 Round, opaque, smooth, regular 10-13 50-60 5-25% -- Joshi RH 2006 Haloalkaliphilic bacteria Ve2- 20-91 HM047794 Round, opaque, smooth, regular 8-10 50-90 5-25% n-heptane, toluene, benzene, chloroform, ethyl acetate, isopropyl alcohol, isoamyl alcohol Raval et al 2014 Haloalkaliphilic bacteria AH6 EU118361 Round, opaque, smooth, regular 8-13 50-60 0-4 M methanol, propanpl, hexane, heptanes, isooctane, dodecanes, decane and cuclohexane. Dodia MS 2005 Pandey and Singh 2013 Oceanobacillus sp. SJ1 GQ162111 Round, opaque, smooth, regular 10 50-60 5-25% Methanol, Butanol Propanol,n-hexane Pandey et al 2012 Bacillus pseudofirmus SJ2 EU090232 Round, opaque, smooth, 10 50-60 5-25% Methanol, Butanol Dodia MS 2005 Enzymatic Characteristics of Haloalkaliphilic bacteria
- 86. 0 100 200 300 400 500 600 37 50 60 70 80 90 100 Activity(U/ml) Temp(oC) Temperature optima OM-4 OM-6 OM-11 Okha-5 Okha-7 Mit7 Tata-5 Tata-13 0 50 100 150 200 250 300 350 400 450 500 OM-4 OM-6 OM-11 Okha-1 Okha-5 Okha-7 Mit-7 Tata-5 Tata- 13 Activity(U/ml) Optimum enzyme activity in different nine isolates Activity(U/ml) 0 100 200 300 400 500 600 700 7 8 9 10 11 Activity(U/ml) pH pH optima OM-6 OM-4 Okha-1 Okha-7 OM-11 Okha-5 Mit-7 Tata-5 Tata-13
- 87. 0 100 200 300 400 500 37 50 60 70 80 90 % Residual activity Temp (oC) OM-6 0 2 5 7 10 20 50 100 0 100 200 300 400 500 600 700 800 900 37 50 60 70 80 90 % Residual activity Temp (oC) OK-5 0 2 5 7 10 20 50 100 Effect of Ca2+ on temperature optima and enzyme activity of purified proteases from both OM-6 and OK-5 isolates at 0 - 100mM concentration
- 88. Effect of osmolytes, inhibitors, metal ions, oxidizing and reducing agents and surfactants Gohel, S. D., & Singh, S. P. (2013). Characteristics and thermodynamics of a thermostable protease from a salt-tolerant alkaliphilic actinomycete.International journal of biological macromolecules, 56, 20-27.
- 89. Effect of NaCl on Temperature Optima Ah-6 Alkaline Protease 0 50 100 150 200 250 0mM NaCl 0 50 100 150 200 250 300 Activity (u/ml/min) 500mM NaCl 0 50 100 150 200 250 1500mM NaCl 0 50 100 150 200 250 30 40 50 60 70 80 90 100 Temperature (0 C) 2000mM NaCl 0 50 100 150 200 250 300 200mM NaCl Dodia M. S., Rawal C. M., Bhimani H. G., Joshi R. H., Khare, S. K. and Singh, S. P. 2008. Journal of Industrial Microbiology & Biotechnology 35(2):121-132
- 90. Effect of salt on Temperature optima S-20-9 (seawater) 0 50 100 150 200 0mM NaCl 0 50 100 150 200 250mM NaCl 0 50 100 150 200 Activity (U/ml/min) 500mM NaCl 0 50 100 150 200 1000mM NaCl 0 50 100 150 200 2000mM NaCl 0 50 100 150 200 30 40 50 60 70 80 90 100 Temperature ( . C) 3000mM NaCl
- 91. 0 10 20 30 40 50 60 70 80 90 100 37°C 50°C 60°C 70°C 80°C 90°C Temperature % Relative activity 0 M 0.25 M 0.5 M 1 M 2 M 3 M Effect of NaCl on Ve2-20-91 Protease Temperature optima Raval, V. Rawal, C.M., Pillai, S. and Singh S.P. 2014. Process Biochemistry 49 (6): 955-962 (IF 2.63)
- 92. Effect Of ca +2 on temperature optima of Ah-6 Protease 0 200 400 600 800 1000 1200 1400 20 30 40 50 60 70 80 90 Temperature (0 C) Acivity (U/ml) 0mM Ca+2 5mM Ca+2 10mM Ca+2
- 93. Effect of NaCl on partialy prufied Protease activity at 37 o C 40 60 80 100 120 140 160 0 50 100 150 200 250 300 350 400 450 500 NaCl (mM) % of Residual Activity Gupta, A., Roy, I., Patel, R.K., Singh, S.P., Khare, S.K. and M.N. Gupta. 2005. Journal of Chromatography A 1075: 103-108
- 94. Urea Denaturation(8M) among haloalkaline proteases Undialyzed Enzyme 0 20 40 60 80 100 control 0 1 2 24 48 72 96 Time(Hrs) % Residual Activity (U/ml/min) S-20-9 S-15-9 D-15-9 D-20-91 Ve2-10-10 Ve2-15-91 Ve2-20-92 Dialysed Enzyme 0 20 40 60 80 100 Control 0 10 20 30 60 120 Time(min) % Residual Activity (U/ml/min) S-20-9 S-15-9 D-15-9 D-20-91 Ve2-10-10 Ve2-15-91 Ve2-20-92
- 95. Effect of NaCl on Denaturation Kinetics Of Ah-6 Protease 0 20 40 60 80 100 120 0 20 40 60 80 100 120 140 160 180 Time (h) %, Residual Activity dialysed 0mM NaCl 500mM NaCl 1000mM NaCl 2000mM NaCl Dodia M. S., Bhimani H. G., Rawal C. M., Joshi R. H., and Singh, S. P. 2008. Bioresource Technology 99:6223- 6227
- 96. Thermodynamics of the Enzyme Catalysis and Denaturation
- 97. Isolates T (oC) 0 M NaCl 2 M NaCl 4 M NaCl 30% Na-glutamate Kd ( ×10-3) t1/2 (min) Kd ( ×10-3) t1/2 (min) Kd ( ×10-3) t1/2 (min) Kd ( ×10-3) t1/2 (min) OM-6 37 1.24 558.98 0.73 949.51 0.51 1359.11 0.42 1650.35 50 4.94 140.31 2.52 274.62 0.91 761.70 0.73 949.51 60 27.51 25.19 10.92 63.47 1.68 412.58 1.14 608.02 70 35.86 19.32 27.29 25.39 10.75 64.47 2.41 287.61 80 41.09 16.86 33.30 20.81 28.50 28.50 8.66 80.04 OK-5 37 1.55 447.19 1.47 471.52 1.08 641.80 0.99 700.14 50 2.30 301.36 2.01 344.84 1.20 577.62 0.826 839.16 60 19.15 36.19 2.37 292.46 1.69 433.21 0.77 900.19 70 22.4 30.94 18.38 37.71 6.23 111.25 2.50 277.25 80 37.2 18.63 24.31 28.51 8.29 83.61 4.11 168.64 Deactivation rate constant (Kd) and Half life (t1/2) of OM-6 and OK-5 purified proteases in presence of 0 M NaCl, 2 M NaCl, 4 M NaCl and 30% Na- glutamate at the range of 37oC-80oC temperature 1. Decrease in favorable electrostatic repulsion 2. Halophilic enzymes have high –ve charge with hydrated groups shielded by high salt that avoids unfolding and maintain solubility of proteins 3. Lowering NaCl decrease stability of enzyme suggesting low water activity resulting from high salt conc. required for conformational stability of enzyme 4. Effect of salt on stabilizing enzyme is related not only to the salt/solute conc but also to the type of salt/solute
- 98. Isolates OM-6 OK-5 Treatment ∆H* (KJ/mole) ∆S* (J/mole) E (KJ/mole) ∆H* (KJ/mole) ∆S* (J/mole) E (KJ/mole) 0 M NaCl 111.26 57.03 113.92 71.33 -69.99 74.08 2 M NaCl 96.91 6.48 99.57 62.59 -152.72 65.34 4 M NaCl 41.34 -175.17 44.01 44.91 -160.12 47.66 30% Na-glutamate 34.47 -196.37 37.14 29.23 -211.83 31.97 Strains OM-6 OK-5 T (oC) ∆G* (KJ/mole) for deactivation of protease ∆G* (KJ/mole) for deactivation of protease 0 M NaCl 2 M NaCl 4 M NaCl 30% Na- glutamate 0 M NaCl 2 M NaCl 4 M NaCl 30% Na- glutamate 37 93.27 94.63 95.56 96.06 92.69 92.83 93.62 93.85 50 93.58 94.38 98.12 98.71 95.63 95.99 97.38 98.38 60 91.80 94.36 99.54 101.62 92.81 98.59 99.68 101.70 70 93.89 94.67 97.32 101.59 95.23 95.79 98.88 101.48 80 96.31 96.93 99.85 100.88 96.60 97.85 101.01 103.07 ∆H*, ∆S* and activation energy for OM-6 and OK-5 proteases deactivation ∆G* for deactivation of OM-6 and OK-5 proteases 1. Low values of ∆H and ∆S reveled higher thermal stability of protease 2. –ve values of ∆S indicated ordered transition state of protease 3. ↑ salt/solute ----- stable conformation of protease ---- decreased entropy of unfolding ---- thermodynamic 4. ↑ ∆G ----- thermal stability of protease ---- ↑ free energy --- as enzyme could resist against unfolding of its transition state
- 99. NaCl (M) Kcat ( sec-1 ) 370 C 500 C 600 C 700 C 800 C 0.0 6.18 3.36 0.45 0.234 0.0 0.5 4.08 9.30 10.26 5.82 3.78 1.0 1.98 5.64 7.62 11.28 9.6 1.5 0.66 4.08 4.92 9.90 4.8 2.0 0.12 2.28 3.00 7.32 3.42 Effect of NaCl on the catalytic constant Kcat (sec-1) of purified AH-6 protease Dodia M. S., Rawal C. M., Bhimani H. G., Joshi R. H., Khare, S. K. and Singh, S. P. 2008. Journal of Industrial Microbiology & Biotechnology 35(2):121-132
- 100. CaCl2 (mM) Kcat ( sec-1 ) 370 C 500 C 600 C 700 C 0.0 4.86 3.24 0.66 0.84 2.0 4.92 10.02 5.16 1.44 5.0 4.98 8.1 5.88 1.56 8.0 4.2 7.32 5.16 1.62 10.0 3.3 6.72 3.54 1.32 Effect of Ca+2 on the catalytic constant Kcat (sec-1) of purified AH-6 protease
- 101. Structure & Function analysis of the enzymes
- 102. Here below are the predicted Sequence from De novo. The predicted sequences are Blasted against the NCBI nr bacterial protein databases. The top matches are listed under the pictures of the spectrums. #1: OBS MASS: 1271.5388 Charge : 2 Predicted Seq: SVNSNLSVPEAR or VSNSNLSVPEAR Blast report: gi|90327884|gb|EAS44215.1| hypothetical protein P3TCK_11048 [Photobacterium profundum 3TCK]Length=609 Score = 27.8 bits (58), EUS EAS44215 609 aa linear BCT 23-MAR-2006 DEFINITION hypothetical protein P3TCK_11048 [Photobacterium profundum 3TCK]. ACCESSION EAS44215 VERSION EAS44215.1 GI:90327884 DBSOURCE accession AAPH01000006.1 KEYWORDS . SOURCE Photobacterium profundum 3TCK ORGANISM Photobacterium profundum 3TCK Bacteria; Proteobacteria; Gammaproteobacteria; Vibrionales; Vibrionaceae; Photobacterium. REFERENCE 1 (residues 1 to 609) AUTHORS Bartlett,D.H., Valle,G., Lauro,F.M., Vezzi,A., Simonato,F., 100 200 300 400 500 600 700 800 900 1000 1100 1200 1300 1400 1500 1600 1700 1800 1900 M/z 0 100 % Pandey_100506 MaxEnt 3 35 [Ev-149431,It50,En1] (0.050,200.00,0.200,1400.00,2,Cmp) 2: TOF MSMS 636.78ES+ SV N S N L SVPEAR bMax R A E P V S L N S N VS yMax 472.27 y4 246.17 y2 187.12 b2 159.12 a2 455.25 301.17 b3 370.20 658.37 y6 571.34 y5 484.24 771.45 y7 667.33 885.51 y8 783.44 972.54 y9 955.50 1086.57 y10 1315.93 1141.84 1367.83
- 103. N-Terminal amino acid sequencing of Ve2-20-91 Protease
- 104. Amide A Amide B Amide I Amide II Amide III Amide IV, V & VI FTIR spectroscopic analysis of Ve2-20-91 Protease
- 105. -2 -1.6 -1.2 -0.8 -0.4 0 0.4 0.8 1.2 1.6 2 240 237 234 231 228 225 222 219 216 213 210 207 204 201 Wavelength (nm) [θ] x 10 -4 deg cm 2 dmol -1 Native Enzyme Denatured 50 Denatured 50 1 M Denature 50 2M -2 -1.6 -1.2 -0.8 -0.4 0 0.4 0.8 1.2 1.6 2 2 4 0 2 3 7 2 3 4 2 3 1 2 2 8 2 2 5 2 2 2 2 1 9 2 1 6 2 1 3 2 1 0 2 0 7 2 0 4 2 0 1 Wavelength (nm) [θ] x 10-4 deg cm2 dmol-1 Native Enzyme Denatured 70 Denature 70 2M Denature 70 1M a b (NaCl,% w/v) Analysis by K2D2 50˚C 70˚C α helix β strand α helix β strand Native 1.58% 24.49% 1.81 36.24 Denature 4.44% 44.17% 1.81 36.25 With 1M NaCl 3.95% 44.11% 1.77 36.09 With 2M NaCl 4.44% 44.17% 1.82 36.07 CD spectroscopy analysis of Ve2-20-91 Protease
- 106. -2.5 -2 -1.5 -1 -0.5 0 0.5 1 1.5 2 2.5 200 210 220 230 240 pH10 pH8 -3 -2 -1 0 1 2 3 200 210 220 230 240 50 70 90 -4 -3 -2 -1 0 1 2 3 4 200 210 220 230 240 50 1M 50 2 M 70 1M 90 1M -2.5 -2 -1.5 -1 -0.5 0 0.5 1 1.5 2 2.5 200 210 220 230 240 0M 4M 8M Circular Dichroism (CD) spectroscopy Wavelength (nm) MRE Urea
- 108. FT-IR analysis of the free and immobilized protease A:alkaline protease, B: immobilized alkaline protease A B Structural topographies of the immobilized HTASP-FT-IR Decrease in Amide A band, suggesting the Interaction of the carriers with –NH groups in protease molecule while C=O regions remain less affected Thakrar, F. J., and Singh, S. P. (2019). Bioresource Technology. 278 150–158
- 109. FTIR spectra of (a) native alkaline protease (b) partially denatured enzyme (c) partially denatured enzyme along with 1M salt and (d) completely denatured enzyme. The spectra were recorded in the range of 400-4000 cm-1. a b c d
- 110. Gene Profiling Cloning, Expression and Characterization of the Recombinant Enzymes
- 111. Protease Gene Profiling Cloning, Expression and Characterization of the Recombinant Enzymes
- 112. Protease gene amplification profile 0 1 2 3 4 5 6 7 8 9 BPAP1 BLIAP2 BAAP PCAP GMAP BPAP2 Number of isolates Primers No. Of isolates 0 1 2 3 4 5 6 BPAP1 BLIAP2 BAAP PCAP GMAP BPAP2 Number of species Primers No. Of Species Hitarth Bhat, Mausami Pandya, Yogesh and S P Singh 2019
- 113. Haloalkaliphilic organism Functional clones Recombinant CLONES Vector construct
- 114. Organisms NCBI Accession number Gene cloned Host Reference Haloalkaliphilic bacterium OME12 EU680960 Alkaline protease BL21 (DE3) Purohit and Singh 2013 Proc. Biochem Metagenome from salt enriched soil --------------- Alkaline protease BL21 (DE3) Purohit and Singh 2013 IJBIOMAC Oceanobacillus ihyehensis OME18 EU680961 Alkaline protease BL21 (DE3) Purohit and Singh 2013 Proc. Biochem Alkalibacillus haloalkaliphilus C-5 -- Serine alkaline protease E.coli (DH5α) Rawal et al 2012/2014 Haloakaliphilic bacteria Ve2-20-91 JX296114 Serine alkaline protease E.coli (DH5α) Raval et al. 2015 Ann Microbiology Haloalkaliphilic actinomycetes Serine alkaline protease BL21 (DE3) Gohel & Singh, 2012 IJBIOMAC Bacillus lehensis JO-26 ---------- Serine alkaline protease BL21 (DE3) Hitarth Bhatt and S P Singh ( Frontiers in Microbiology, 2020) Cloning, Expression and structure and function relationship of proteases from Haloalkaliphilic bacteria & Actinobacteria
- 115. WP 026680332.1serineproteaseBacillus megaterium WP 121604525.1serineproteaseVirgibacillus sp. Bac332 JO-21 WP 100011609.1serineproteaseLentibacillus sediminis WP 088049911.1serineproteaseVirgibacillus dakarensis WP 102415391.1serineproteaseCitricoccus massiliensis Phylogenetic tree of the alkaline protease J-21 with its closest phylogenetic relatives obtained from BLASTP using Neighbour Joining Method of MEGA 6 software.
- 116. 1 M 1 2 3 4 5 6 7 A 1 kb 3 kb 1 kb 3 kb B PCR Amplification of Alkaline Protease Gene/s 1.2 kb 0.8 kb
- 117. Conformation of insert in pET 21a+ by digesting with Bam HI and Sal I Colony # 1 kb Ladder Size (bp) 1 2 3 4 5 6 10,000 5,000 3,000 2,000 1,500 1,000 Vector Insert (Alkaline protease) (~1.2 kb)
- 118. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Protein expression and effect of IPTG induction
- 119. • Amplicon and pET 21a+ was Digested by BamH1 • Amplicon and pET 21a+ was Digested by Sal1 RE Digestion • Double digested amplicon and vector was ligated in ratio of 1:3 • Ligation carried by Quick Ligase, Fermentas Ligation • Ligated vector transformed to Top 10(E.coli Host strain) • 5 Poisitive clones for O.M.A18 and 7 positive clones for O.M.E12 obtained on plate containing LB+Ampicillin Transformation-I • Colony PCR • To check for release of vector Confirmation of transformation • Positive clone from both the strains vector transformed in BL21 Host strain(Expression strain) Transformation-II THE MAJOR STEPS OF CLONING OF ALKALINE PROTEASE GENES… 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 5 0 1 2 3 4 5 6 7 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 5 0 1 2 3 4 5 6 7 8 9 10 1 2 3 4 Colony number 27oC and 1mM: Lane 1: Molecular weight marker (Middle range, Merk life science) Lane 2: Pre-induction sample Lane 3: 2 hours sample Lane 4: 4 hours sample Lane 5: 4 hours sample Lane 6: 6 hours sample Lane 7: 24 hours sample 1 2 3 4 5 6 7 Colony Diameter (mM) Zone Ratio (m/z) EFFECT OF TEMPERATURE AND IPTG ON ENZYME INDUCTION EXPRESSION ANALYSIS
- 120. 1 2 3 4 5 6 7 1 2 3 4 5 6 7 Soluble fraction: (27 oC;1mM ) Lane 1: PCR control Lane 2: Molecular weight marker (Middle range marker, Merk life science) Lane 3: 24 hours sample Lane 4: 6 hours sample; Lane 5: 4 hours sample Lane 6: 2 hours sample Lane 7: Pre-induction sample Insoluble fraction: (27 oC;1mM ) Lane 1:Protein molecular weight marker (3500- 205000Da) Lane 2: -- Lane 3: 0 hour Lane 4:2 hours Lane 5:4 hours Lane 6: 6 hours Lane 7: 24 hours 120 Over-Expression Analysis
- 121. 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 0 20 40 60 80 100 120 140 160 180 200 0 0.5 1 2 4 Relative enzyme activity (%) NaCl concentration (% w/v) Enzyme activity Growth Growth Bhatt, H.B. and Singh S.P. 2020, Frontiers in Microbiology, 11:1- 16, https://doi.org/10.3389/fmicb.2020.00941
- 122. Phylogenetic tree based on a comparison of the APrBL amino acid sequence and some of their closest phylogenetic relatives retrieved from NCBI database. The tree was reconstructed by the neighbor joining method using MEGA 6 software. The numbers on the tree indicates the percentages of bootstrap support derived from 1,000 replications. The scale bar corresponds to 0.1 substitutions per nucleotide position Bhatt, H.B. and Singh S.P. 2020, Frontiers in Microbiology, 11:1-16, https://doi.org/10.3389/fmicb.2020.00941
- 123. AprBL (Alkaline protease gene) (1.151 kbp) from Bacillus lehensis JO-26 , ARID Zone ORF 1014 bp-337 amino acids: Cloned and expressed in E.coli BL21 (DE3) Optimum expression: 0.2 mM IPTG induction, 2% NaCl and 28°C at 20 hrs growth Subtilase S8 family of proteases: Asp 97, His 127 and Ser 280- catalytic triad 31.75% α-helices, 22.55 % β-strands and 45.70% coils Broad pH (8–11) and temperature (30-70°C), Optima at pH 10 and 50°C Highly thermostable: 73% of the residual activity at 80°C up to 3 h Significantly stimulated by SDS, Ca2+, chloroform, toluene, n-butanol and benzene Completely inhibited by PMSF and Hg2+ High glycine and low proline residues, a characteristic feature of the cold adapted enzymes Hydrolysis of whey protein and detergent additive established Bhatt, H.B. and Singh S.P. 2020, Frontiers in Microbiology, 11:1-16, https://doi.org/10.3389/fmicb.2020.00941
- 125. 125 Features Oceanobacillus iheyensis O.M.A18 enzyme Haloalkaliphilic bacterium O.M. E12 enzyme Basis Information N-terminal Sequence 5’MNPGSAWRSPVVPFSSLGMSPAYG 5’KLRVIIEFKEDAVEAGIQSTKQLMKK… Homology(%) 100 100 Homologus protein (BLAST analysis) Bacillus sp.KP43, complete CDS gene- protease gene Bacillus pumulius SAFA-032 -protease gene NCBI Genbank ID: HM219179. HM219182 Physicochemical Properties pI 5 5 instability index (II) 39.57 27.30 Stability Yes Yes Aliphatic Index 65.60 42.94 Grand average of hydropathicity (GRAVY) 0.016 -0.747 Total numbers of negatively charged residues (Asp + Glu) 30 40 Total numbers of positively charged residues 30 40 SEQUENCE ANALYSIS OF RECOMBINANT ALKALINE PROTEASES
- 126. HYDROPATHY DETERMINATION Oceanobacillus iheyensis O.M.A18 Haloalkaliphilic bacterium O.M.E12
- 127. 127 3D Structure Prediction Oceanobacillus iheyensis O.M.A18 Haloalkaliphilic bacterium O.M.E12
- 128. 128 O.M.A18 (Upper panel) and O.M.E12 (Lower Panel) RAMACHANDRAN ANALYSIS
- 129. Metagenomics & Non Cultivable
- 130. Non-Cultivable and their Hidden Potential
- 131. Metagenomics and Functional aspects
- 132. Functional novel Protease enzyme in E.coli Host Characteristics of Haloalkaliphilic Protease (Saline Habitat) Expression and Purification of enzyme Creation of Metagenomic library Designing of Universal Degenerate Primers Isolation of Total Metagenome from Saline Coastal region of Okha,Gujarat Mechanical Method Chemical method
- 133. 0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% AL1 AL3 KH1 KH3 AL KH Relative abundance (%) Phylum Others Unclassified [Thermi] Crenarchaeota Nitrospirae Cyanobacteria Euryarchaeota OD1 Chloroflexi Acidobacteria 1. Nirali Raiyani & S P Singh Raiyani, Nirali and Singh S.P. 2020, Extraction of environmental DNA, construction of metagenomic libraries and functional screening of enzymes from salt pan soil, Indian Journal of Geo-Marine Sciences, Accepted (NISCARE, CSIR, IF 0.50),
- 134. 0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% AL1 AL3 KH1 KH3 AL KH Relative abundance (%) Genus Unclassified Others Fulvivirga Idiomarina Anaerospora Rhodococcus 4-29 Bradyrhizobium Deinococcus Janibacter Brevundimonas Kaistobacter Psychrobacter Pseudomonas Sediminibacterium Methanosaeta Acidiphilium Sphingomonas Hyphomicrobium Gramella Methylobacterium Mycobacterium Planctomyces Halomonas Pseudidiomarina 1. Raiyani, Nirali and Singh S.P. 2020, Taxonomic and functional profiling of the microbial communities of Arabian Sea: A Metagenomics approach Journal: Genomics (Elsevier, IF 6.20), 112:4361- 4369 https://doi.org/10.1016/j.ygeno.2020.07.024
- 135. 135 2.3 kb 564bp 1 2 3 4 5 6 7 1 2 3 4 5 6 7 8 9 10 11 12 13 3kb 1kb Isolation of metagenomic DNA by various methods for saline soil sample O.M.6.2 and O.M.6.5. Lane 1: Lamda DNA /HindIII Marker (Banglo Genei), Lane 2: Soft Lysis, Lane 3: Bead Beating, Lane 4 : Bead beating+Lysis, Lane 5 : Sonication+Lysis Lane 6: Sonication Lane 7: Sonication+Bead Beating Lane 1: DNA ruler (Middle range marker, Merk life sciences, India), Lane 2: lysis buffer treatment (sample-6.2), Lane-3: Lysis Buffer Treatment (sample-6.5), Lane 4: Bead Beating only (sample-6.2); Lane 5: Bead Beating only (sample-6.5); Lane 6: Bead Beating + Lysis Buffer Treatment (sample-6.2), Lane 7: Bead Beating + Lysis Buffer Treatment (sample-6.5); Lane 8: Bead Beating + sonication treatment (sample-6.2); Lane 9: Bead Beating + sonication treatment (sample-6.5); Lane 10: lysis buffer + sonication treatment (sample-6.2); Lane 11: lysis buffer + sonication treatment (sample-6.5); Lane 12: sonication treatment (sample-6.2); Lane 13: sonication treatment ( (sample-6.5) (Fig.6.1.3.2). Isolation of Metagenomic (Environmental) DNA
- 136. 136 1 2 3 4 5 6 7 8 9 10 11 12 13 1 2 3 4 5 6 7 1 2 3 4 5 6 7 Bead beating + Sonication Method Lane 1: 0.2-10Kb ladder, Lane 2: Site 6.2 (Ta=52.4), Lane 3: Site 6.2 (Ta=55.7), Lane 4 : Site 6.2(Ta=56.9), Lane 5 : Site 6.5(Ta=52.4) Lane 6 : Site 6.5 (Ta=55.7) Lane 7 : Site 6.5 (Ta=56.9) (Bead Beating Method) Lane 1: 0.2-10Kb ladder, Lane 2: Site 6.2 (Ta=52.4), Lane 3: Site 6.2 (Ta=55.7), Lane 4 : Site 6.2(Ta=56.9), Lane 5 : Site 6.5(Ta=52.4), Lane 6 : Site 6.5 (Ta=55.7), Lane 7 : Site 6.5 (Ta=56.9) 16S rRNA Amplification from Total DNA of sample O.M.6.2 (Ta- 64oC) Lane 1, smart ladder 0.2-10 kbp ladder (invitrogen); Lane 2, Lysis treatment; Lane 3, Soft Lysis + Bead Beating; Lane 4, Soft Lysis +Sonication; Lane 5, Bead beating; Lane 6, Sonication; Lane 7, Sonication+ Bead Beating. 16S rRNA Amplification from Total DNA of sample O.M.6.5 (Ta- 64oC) Lane8, Lysis treatment; Lane 9, Soft Lysis +Bead Beating; Lane 10, Soft Lysis +Sonication; Lane 11, Bead beating; 16S rRNA amplification of Total DNA isolated by various method by using eubacterium universal primer 1500bp 1500bp 16S rRNA
- 137. DGGE ANALYSIS 1 2 3 4 5 6 M M 1 2 3 4 5 6 Megha Purohit and S. P. Singh ( 2009) Letters in Applied Microbiology , 49:338-344
- 138. 138 SPS- 5F&R SPS- 5F&6R SPS- 5F&7R SPS- 6F&R SPS- 6F&5R SPS- 6F&7R SPS- 7F&R SPS- 7F&6R SPS- 7F&5R Ok.M.6.2 0.5 0 0 0.5 0 1 0.5 0.7 2.8 1.1 1.2 Ok.M.6.5 0.7 1 1 0.5 0.5 0 1.2 1 1 0.5 0 0 0.5 0 1 0.5 0.7 2.8 1.1 1.2 0 0.5 1 1.5 2 2.5 3 Size (kb) AMPLIFICATION PROFILE OF O.M.6.2 AND O.M.6.5 SOIL SAMPLE Ok.M.6.2 Ok.M.6.5 1 2 3 4 1 2 3 4
- 139. 139 1 2 3 4 5 1 2 3 4 5 A B D Protease gene amplicons PCR amplification of alkaline proteases genes Protease gene amplicons C 1 2 3 4 5 1 2 3 4 5 D C 1 2 3 4 5 1 2 3 4 5 6 D B C A PCR AMPLIFICATION OF ALKALINE PROTEASE GENE/S Purohit, M. and Singh S.P. 2013. A metagenomic alkaline protease from saline habitat: cloning, over- expression and functional attributes. International Journal of Biological Macromolecules (IJBIOMAC) 53: 138– 143 (IF 2.45). Singh S.P, M.K. Purohit, C. Aoyagi, M. Kitaoka and K. Hayashi. 2010. Biotechnology Bioprocess Engineering, 15 (2):273-276 (IF 1.28)
- 140. Conclusion •Enzyme: Wide occurrence and variation in levels & Characteristics • Analysis based on 16 S rRNA genes: Phylogeny & Identification •Analysis based on Phenotypic & Biochemical Traits: Phenograms •pH, temperature and salt profiling: Growth and enzyme catalysis-stability •Wide variation in optimum salt concentrations for catalysis and for stability •Chemical Denaturation of Enzymes: Sensitivity/Resistance- highly unique Traits •In-vitro protein folding: Denaturation/Renaturation- Highly specific & Variable, affected by pH, Temperature, Salt, enzyme concentration, Redox conditions •Salt -Dependence thermo stability and temperature profile •Metagenomic & Non-Cultivability •Exploration of novel genes •Understanding the function of genes and proteins • Above features/patterns : Could be developed and used as a marker to assess diversity
- 146. Research Team Dr. Sangeeta Gohel, Assistant Professor Dr. Vikram Raval, DST Young Scientist (Now at Gujarat University) Dr. Aparna Singh, DST Women Scientist ( Now Asstt. Prof, Surat) Dr. Kalpana Rakholiya, SERB- National Post-Doctoral Fellow Ms. Kruti Dangar, DST Women Scientist (Now Asstt. prof, Saurashtra University) & Ph.D./M.Phil/M.Sc. Students
- 147. Dr. Bharat Joshi (Canada) Dr. Manish Bhatt ( Canada) Dr. Rajesh K. Patel ( Professor, VNUSG, Surat) Dr. Anju Mittal ( Scientist, USA) Dr. Mital Dodia ( Scientist, Canada) Dr.. Jignasha Thumar ( Associate Prof. Gandhinagar) Dr. Rupal Joshi (ZRC, Ahmedabad) Dr. Chetna Rajyaguru (Associate Prof. Rajkot) Ms. Geera Mankad ( Associate Prof. Rajkot) Dr. Chirantan Raval ( Asst Prof., Govt College) Dr. Megha Purohit ( Scientist and Entrepreneur, Canada) Dr. Himanshu Bhimani ( Associate Prof. Navsari Ag Univ,) Dr. Bhavtosh Kikani (Asstt. Prof. CHARUSAT) Dr. Vikram Raval (Asstt Prof. Gujarat University) Dr. Sangeeta Gohel (Asstt Prof. Saurashtra University) Dr. Sandeep Pandey (Scientist, Pharma, Daman) Dr. Viral Akbari ( Self Employed) Dr. Rushit Shukla (Asstt Prof. Christ College, Rajkot) Dr. Amit Sharma (Scientist, ZRC, Ahmedabad) Dr. Kruti Dangar (Asstt Prof. Saurashtra University) Dr. Atman Vaidya ( Biology Teacher & Entrepreneur) Dr.r. Hitarth Bhatt (Asstt Prof. Virani College, Rajkot) Dr. Rupal Pandya (Scientist, USA) Dr. Foram Thakrar ( Ahmedabad) Dr. Dalip Singh Rathore ( GBRC, Gandhinagar) Acknowledgements : Ph.D. Students
- 148. Financial Support DBT, UGC, DST, MoES, GSBTM, Saurashtra University, Rajkot Research Collaborations •IIT Delhi, New Delhi: Prof. S. K.Khare •DUSC, New Delhi: Prof. Sanjay Kapoor •NFRI, Tsukuba, Japan: Dr. Kiyoshi Hayashi ( Now at Toyo University, Japan) •Griffith University, Australia •JNTU Hyderabad, Prof. Ch. Sasikala •Central University of Hyderabad, Prof. Ch. Rama Rao
- 150. Recent Publications ( Cumulative Impact factor : 201, H-Index: 31) 2021 Dwivedi, Purna, Sharma, A. K. and Singh, S.P. 2021. Biochemical properties and repression studies of an alkaline serine protease from a haloalkaliphilic actinomycete, Nocarpdiopsis dassonvillei subsp. albirubida OK-14. Biocatalysis and Agricultural Biotechnology, Accepted. 07 June 2021 (Elsevier; IF: 0.90) Kikani, B.A. and Singh, S.P. 2021. Amylases from thermophilic bacteria: Structure and Function Relationship. Critical Reviews in Biotechnology, In Press, 30 April 2021 (Taylor & Francis; IF: 8.102) Rathore, D. R., Sheikh, M., Gohel G.D, and Singh, S.P. 2021. Genetic and phenotypic heterogeneity of the Nocardiopsis alba strains of sea water. Current Microbiology, 78: 1377- 1387 (Springer; IF: 1.75), DOI: 10.1007/s00284-021-02420-0 •
- 151. 2021 • Chauhan, J.V., Mathukiya, R. Singh, S.P. and Gohel, S.D. 2021. Two steps purification, biochemical characterization, thermodynamics and structure elucidation of thermostable alkaline serine protease from Nocardiopsis alba strain OM-5. International Journal of Biological Macromolecules (IJBIOMAC), 169: 39-50 (Elsevier; IF: 5.16), https://doi.org/10.1016/j.ijbiomac.2020.12.061 , Available On-Line 12 Dec 2020. Rathore, D R and Singh, S.P. 2021. Kinetics of growth and co-production of amylase and protease in novel marine actinomycete, Streptomyces lopnurensis KaM5. Folia Microbiologica (Springer; IF: 1.70), https://doi.org/10.1007/s12223-020-00843-z
- 152. 2020 Sharma, A.K. Kikani, B.A. and Singh S.P. 2020, Diversity and Phylogeny of Actinomycetes of Arabian Sea along the Gujarat Coast. Geomicrobiology Journal (Taylor & Francis, IF 1.90), DOI: 10.1080/01490451.2020.1860165 Raiyani, Nirali and Singh S.P. 2020, Extraction of environmental DNA, construction of metagenomic libraries and functional screening of enzymes from salt pan soil, Indian Journal of Geo-Marine Sciences, Accepted (NISCARE, CSIR, IF 0.50), Raiyani, Nirali and Singh S.P. 2020, Taxonomic and functional profiling of the microbial communities of Arabian Sea: A Metagenomics approach Journal: Genomics (Elsevier, IF 6.20), 112:4361- 4369 https://doi.org/10.1016/j.ygeno.2020.07.024 Bhatt, H.B. and Singh S.P. 2020, Cloning, Expression and structural elucidation of a biotechnologically potential alkaline serine protease from a newly isolated Haloalkaliphilic Bacillus lehensis JO-26, Frontiers in Microbiology (IF 4.25), 11:1-16, https://doi.org/10.3389/fmicb.2020.00941
- 153. 2020 Sharma, A.K. Kikani, B.A. and Singh S.P. 2020, Biochemical, thermodynamic and structural characteristics of a biotechnologically compatible alkaline protease from a haloalkaliphilic, Nocardiopsis dassonvillei OK-18 International Journal of Biological Macromolecules (IJBIOMAC), 153:680-696, DOI: 10.1016/j.ijbiomac.2020.03.006 (IF 5.16) Pandya, Rupal D. and Singh S.P. 2020, Pigment production by an extreme halophilic archaeon on Halorubrum sp. J4.2.2 from little Rann of Kutch, Gujarat, India. Research Journal of Biotechnology, 15(1):88-100. E-ISSN: 2278-4535 Print ISSN: 0973-6263
- 154. 2019 Thakrar, F.J. and Singh S.P. 2019. Catalytic, thermodynamic and structural properties of an immobilized and highly thermostable alkaline protease from a haloalkaliphilic actinobacteria, Nocardiopsis alba Tata-5. Bioresource Technology, 278:150-158 (IF 5.802) Sheikh, M., Rathore, D.S., Gohel, S.D. and Singh S.P. 2019. Cultivation and characteristics of the Marine Actinobacterial from the Sea water of Alang, Bhavnagar. Indian Journal of Geo- Marine Sciences (CSIR-NISCARE), 48(12), 1896-1901(IF 0.4). Rathore, D.S., Sheikh, M.A., Gohel, S.D. and Singh, S.P. (2019) Isolation strategies, abundance and characteristics of the marine actinomycetes of Kachhighadi, Gujarat, India. Journal of Marine Biological Association of India (JMBAI), CMFRI Cochin, India 61(1): 21-27
- 155. 2018 Gohel, S. D. and Singh S.P. 2018. Thermodynamics of a Ca2+ dependent, highly thermostable and detergent compatible purified alkaline serine protease from Nocardiopsis xinjiangensis strain OM-6. International Journal of Biological Macromolecules (IJBIOMAC), https://doi.org/10.1016/j.ijbiomac.2018.02.157, 113:565-574 (IF 3.00) Gohel, S. D. and Singh S.P. 2018. Molecular phylogeny and diversity of the salt-tolerant alkaliphilic actinobacteria inhabiting Coastal Gujarat, India. Geomicrobiology Journal, DOI: 10.1080/01490451.2018.1471107, 35:9, 775-789 (IF 1.5) Thakrar, F.J., Kikani, B.A., Sharma, A.K. and Singh S.P. 2018. Stability of alkaline proteases from haloalkaliphilic actinobacteria probed by circular dichroism spectroscopy. Applied Biochemistry and Microbiology (Russia), 54(6), 591-602 (IF 0.68) Sheikh, M., Rathore, D. S., Gohel, S. D. and Singh S.P. 2018. Marine actinobacteria associated with the invertebrate hosts: a rich source of bioactive compounds: A Review. (Invited contribution) Journal of Cell &Tissue Research, 18 (01), 6361-6374.
- 156. 2018 Dangar, K. G., Kalasava, A. B., Dave, A. V. and Singh S.P. 2018. Molecular diversity of Nocardiopsis alba sp. isolated from the coastal region of Gujarat, India. Journal of Cell &Tissue Research, 18(3) 6559-6570 Vaidya A., Nair, V. S., Georrge, J. and Singh S.P. 2018. Comparative analysis of thermophilic proteases, Research Journal of Life Sciences, Bioinformatics, Pharaceutical and Chemical Sciences (RJLBPCS) 4(6), P. 66. DOI: 10.26479/2018.0406.05 Pandey, S. Sharma, A.K., Solanki, Kiran P. and Singh S.P. January 2018. Catalysis and stability of an extracellular α- amylase from a haloalkaliphilic bacterium as a function of the organic solvents at different pH, salt concentrations and temperatures. Indian Journal of Geo-Marine Sciences (CSIR-NISCARE), 47 (01), 240-248 (IF 0.4).
- 157. 2018 Dangar, K. G., Kalasava, A. B., Dave, A. V. and Singh S.P. 2018. Molecular diversity of Nocardiopsis alba sp. isolated from the coastal region of Gujarat, India. Journal of Cell &Tissue Research, 18(3) 6559-6570 Vaidya A., Nair, V. S., Georrge, J. and Singh S.P. 2018. Comparative analysis of thermophilic proteases, Research Journal of Life Sciences, Bioinformatics, Pharaceutical and Chemical Sciences (RJLBPCS) 4(6), P. 66. DOI: 10.26479/2018.0406.05 Pandey, S. Sharma, A.K., Solanki, Kiran P. and Singh S.P. January 2018. Catalysis and stability of an extracellular α- amylase from a haloalkaliphilic bacterium as a function of the organic solvents at different pH, salt concentrations and temperatures. Indian Journal of Geo-Marine Sciences (CSIR-NISCARE), 47 (01), 240-248 (IF 0.4).
- 158. 2017 Bhatt, H.B., Gohel, S.D. and Singh, S.P. 2017. Phylogeny, Novel bacterial lineage and enzymatic potential of haloalkaliphilic bacteria from the saline coastal desert of Little Rann of Kutch, Gujarat, India. 3 Biotech, 8,53, https://doi.org/10.1007/s13205-017-1075-0 (IF 1.36) Bhatt, H.B., Begum, M.A., Chintalapati, S., Chintalapati, V.R. and Singh, S.P. 2017. Desertibacillus haloalkaliphilus gen. nov.sp. nov., isolated from a salt desert. International Journal of Systematic & Evolutionary Microbiology (IJSEM), 67(11):4435- 4442 (IF 2.1) Kikani, B.A., Sharma, A.K. & Singh, S.P. 2017. Metagenomic and Culture-Dependent Analysis of the Bacterial Diversity of a Hot Spring Reservoir as a Function of the Seasonal Variation. International Journal of Environmental Research, 11: 25-38. DOI:10.1007/s41742-017-0003-9 (IF 1.0). Datta, A., Sharma, A., Kundu, R.S. and Singh S.P. 2017. Diversity and enzymatic profile of bacterial flora in the gut of an estuarine fish, Mugil jerdoni. Indian Journal of Geo-Marine Sciences (CSIR-NISCARE), 46(06): 1116-1127 (IF 0.4)
- 159. Richard Feynman https://en.wikipedia.org/wiki/Richard_Feynman Richard Phillips Feynman, an American theoretical physicist, known for his work in the path integral formulation of quantum mechanics,
- 161. Assignment Question -1: What are different reasons for the variability in publications among the scientists/students. (One para or 5-7 Points) Question-2: In the light of the historical background of the citations, discus its implications (One para or 5-7 Points) Question-3 Discuss the Impact factors of the journals in the context of the assessment of the credentials of the scientists. (One-two para) Question-4 Highlight the merits of H-Index? (up to 5 Points) Question-5 List 10 Journals with Impact factors and publishers of your research areas
- 162. Thank you