![Chapter 1
CRISPR-Cas RNA Targeting Using Transient Cas13a
Expression in Nicotiana benthamiana
Veerendra Sharma, Wenguang Zheng, Jun Huang, and David E. Cook
Abstract
Application of the CRISPR-Cas prokaryotic immune system for single-stranded RNA targeting will have
significant impacts on RNA analysis and engineering. The class 2 Type VI CRISPR-Cas13 system is an
RNA-guided RNA-nuclease system capable of binding and cleaving target single-stranded RNA substrates
in a sequence-specific manner. In addition to RNA interference, the Cas13a system has application from
manipulating RNA modifications, to editing RNA sequence, to use as a nucleic acid detection tool. This
protocol uses the Cas13a ortholog from Leptotrichia buccalis for transient expression in plant cells
providing antiviral defense. We cover all the necessary information for cloning the Cas13 protein, crRNA
guide cassette, performing transient Agrobacterium-mediated expression of the necessary Cas13a compo-
nents and target RNA-virus, visualization of virus infection, and molecular quantification of viral accumu-
lation using quantitative PCR.
Key words CRISPR-Cas13, RNA targeting, mRNA interference, RNA editing, Transcriptome edit-
ing, Antiviral protection, Plant biotechnology, Plant virus
1 Introduction
Understanding gene function, through the manipulation of DNA
and subsequent experimental determination of phenotypic effects
(i.e., functional genomics) remains a grand challenge across
biological disciplines. Application of the clustered regularly inter-
spaced short palindromic repeats (CRISPR) and CRISPR asso-
ciated protein (Cas) prokaryotic immune system for eukaryotic
DNA manipulation has ushered in a new approach for functional
genomics and genome engineering [1–3]. A strength of using
CRISPR-Cas systems for genome engineering is their general
organism-agnostic function, plethora of homologs, ease of use,
and their amenability to be redesigned to carry out novel functions
[4]. The use of class 2 CRISPR-Cas systems, such as Cas9 and
Cas12, for genome editing have been applied and previously
Hailing Jin and Isgouhi Kaloshian (eds.), RNA Abundance Analysis: Methods and Protocols, Methods in Molecular Biology,
vol. 2170, https://doi.org/10.1007/978-1-0716-0743-5_1, © Springer Science+Business Media, LLC, part of Springer Nature 2021
1](https://image.slidesharecdn.com/11208657-250607100737-80e202cd/85/Rna-Abundance-Analysis-Methods-And-Protocols-2nd-Ed-Hailing-Jin-17-320.jpg)
![detailed across a range of organisms and is not the focus of this
methods chapter [5, 6].
The method in this chapter focuses on the use of class 2 type VI
CRISPR-Cas systems referred to as Cas13, which target RNA as
their substrate, delivering programmable single-stranded RNA
interference [7, 8]. This approach opens new opportunities to
manipulate and study gene function by targeting transcribed
RNA. Also, while Cas13 has an inherent function as a RNA nucle-
ase, research has shown it can also be engineered to carry-out novel
functions which can aid in the study of RNA or address societal
challenges [9, 10]. At this time, the RNA-targeting Cas13 systems
have been subdivided into four families, termed Cas13a, Cas13b,
Cas13c, and Cas13d [11–13]. While the Cas13 systems described
to-date all require a crRNA and Cas13 effector protein, their
sequence, structure, and mechanistic details can vary. Conse-
quently, there is variation across the Cas13 systems for attributes
such as target RNA binding affinity, guide processing and target
RNA nuclease activity [10, 11]. There are also reports of additional
helper proteins that are not required, but modulate target RNA
degradation through various mechanisms [14, 15]. Significant
mechanistic questions remain regarding Cas13a/b/c/d function
in general and function within specific groups of organisms.
This method will focus on Cas13a from Leptotrichia buccalis
(Lbu) for transient expression in the plant Nicotiana benthamiana.
We detail the use of Cas13a for targeted reduction of Turnip Mosaic
Virus (TuMV), a single-stranded RNA virus of the largest plant
infecting family, Poytviridae [16, 17]. Plant infecting viruses cause
significant economic losses annually and threaten global food secu-
rity. The method described here provides the plant with a new
antiviral immune response, which has significant implications for
improving crop production through biotechnology. More gener-
ally, the approach can be modified to study any cellular single-
stranded RNA for a variety of experiments in planta.
2 Materials
2.1 Synthetic DNA
and Vectors
1. pGWB413 gateway cloning vector (Addgene plasmid ID:
74807).
2. Leptotrichia buccalis Cas13a DNA fragment including pro-
moter and terminator (Integrated DNA Technologies)
(Table 1 for sequence, see Notes 1–3).
3. NEBuilder HiFi DNA Assembly Master Mix (New England
Biolabs).
4. pENTR/D-TOPO vector and cloning kit (Invitrogen).
2 Veerendra Sharma et al.](https://image.slidesharecdn.com/11208657-250607100737-80e202cd/85/Rna-Abundance-Analysis-Methods-And-Protocols-2nd-Ed-Hailing-Jin-18-320.jpg)
![12. One Shot™ ccdB Survival™ 2 T1R
Competent Cells (Thermo
Fisher).
13. T4 DNA ligase (New England Biolabs).
14. PacI, PspOMI, KpnI, BsaI restriction enzymes (New England
Biolabs).
15. Hotplate and water bath.
16. DNA oligos used for PCR identification during cloning
(Integrated DNA Technologies) (Table 3 for sequence).
17. Luria Bertani (LB) medium: for LB broth, 0.5% yeast extract,
1% tryptone, 1% NaCl in deionized water. For LB agar, add
1.5% agar in LB broth. Autoclave at 121
C for 20 min to
sterilize.
2.2 Agrobacterium-
Mediated Transient
Transformation
1. Seeds of Nicotiana benthamiana plants.
2. Agrobacterium tumefaciens strain GV3101.
3. Turnip Mosaic Virus, TuMV infectious clone pCBTuMV-GFP
(GenBank EF028235.1, [18]).
4. Infiltration buffer: 10 mM MgCl2, 10 mM MES buffer, pH 5.7
and 100 μM acetosyringone (prepared in DMSO).
5. 1.0 mL needleless syringes.
6. Spectrophotometer.
7. 50 mL conical tubes with screw top.
8. Table top centrifuge with rotor for 50 mL conical tubes.
9. Temperature controlled laboratory shaker.
Table 3
Oligos used to screen vectors for positive colonies and to perform qPCR
Name of Oligo Sequence of oligos (50
! 30
) Purpose
Cas13a-F GCGAGGGTCGATTAGTGAAAT Colony screening
Cas13a-R CCAGGATGTCCGTTTCTGAATA Colony screening
U6-F GGAGTGATCAAAAGTCCCACATCG Colony screening
BsaI-R AAACGAGACCAGAACTAAGGGT Colony screening
35S-R TACGTCAGTGGAGATATCACATCA Colony screening
TuMV_P1-F TAGAGCGCAGCAACCAATTA TuMV qPCR
TuMV_P1-R CGAACCTCTTCTGCTTCGATTA TuMV qPCR
EF1a-F AGCTTTACCTCCCAAGTCATC EF1a qPCR
EF1a-R AGAACGCCTGTCAATCTTGG EF1a qPCR
4 Veerendra Sharma et al.](https://image.slidesharecdn.com/11208657-250607100737-80e202cd/85/Rna-Abundance-Analysis-Methods-And-Protocols-2nd-Ed-Hailing-Jin-20-320.jpg)
![enzymes, such as BaeI could be used but needs to be designed
with the entire cloning process in mind to achieve compatibility
between vectors.
7. For guide RNA, the length of spacer sequence and the target-
ing site of choice need to be optimized regarding specific
Cas13a and the target gene. The PFS (protospacer flanking
sequence) of the targeting site might be a consideration during
the guide RNA designing based on the functional property of
Cas13a [7, 14]. In this method, we used 28 bp region of
HCPro with flanking T downstream of the targeting site. To
synthesize the guide RNA, the top strand of the guide RNA
needs to be reverse complementary to the targeting site.
8. We have observed significant target mRNA reduction com-
pared to empty guide control when expressing some guide
crRNA in the absence of Cas13. That is, some guide crRNA
have been observed to produce Cas13-independent target
mRNA interference. Care should be taken to include a negative
control agroinfiltration expressing the guide crRNA without
Cas13.
9. Larger volume of water in a beaker for boiling is acceptable.
After boiling for 5 min, turn off the hotplate and leave the
beaker on the hotplate. Let the water cool gradually to room
temperature for 3 h or overnight. Alternatively, oligo annealing
can also be performed on a thermocycler with 95
C for 5 min
and then ramp down to 25
C with rate of 0.1
C/s.
10. This method uses gateway LR Clonase enzyme mix to perform
the LR recombination reaction. If gateway LR Clonase II is
used, skip the 5 reaction buffer as it is included in the LR
Clonase II enzyme mix.
11. Do not touch or handle liquid nitrogen with your bare hand, it
can burn your skin. Use forceps or protect your hands with
thick gloves.
12. If you already have a glycerol stock of the desired
A. tumefaciens, prepare a fresh streak. It is important to use
A. tumefaciens from plates that are not older than 7 days. Older
plates should be discarded and fresh A. tumefaciens should be
re-streaked. This is necessary to maintain efficient plant infec-
tion and delivery of the transgene.
13. A. tumefaciens cultures should be grown to the log phase,
which can be approximated to occur around OD600 of
0.8–1.2. Overgrown cells lose competency to deliver the gene
of interest. In case of A. tumefaciens strain GV3101, 20 h of
growth is optimal. To analyze the effect of Lbu-Cas13a
mediated silencing of TuMV-GFP, the OD600 ratio of effec-
tor:target is 1.0:0.3. We have observed that infiltrating
Lbu-Cas13a constructs before infiltrating TuMV-GFP
Cas13a RNA-Targeting in Plants 15](https://image.slidesharecdn.com/11208657-250607100737-80e202cd/85/Rna-Abundance-Analysis-Methods-And-Protocols-2nd-Ed-Hailing-Jin-31-320.jpg)
![Chapter 3
Laser Microdissection of Cells and Isolation of High-Quality
RNA After Cryosectioning
Marta Barcala, Carmen Fenoll, and Carolina Escobar
Abstract
Laser capture microdissection (LCM) has become a powerful technique that allows analyzing gene
expression in specific target cells from complex tissues. Widely used in animal research, still few studies
on plants have been carried out. We have applied this technique to the plant–nematode interaction by
isolating feeding cells (giant cells; GCs) immersed inside complex swelled root structures (galls) induced by
root-knot nematodes. For this purpose, a protocol that combines good morphology preservation with
RNA integrity maintenance was developed, and successfully applied to Arabidopsis and tomato galls.
Specifically, early developing GCs at 3 and 7 days post-infection (dpi) were analyzed; RNA from LCM
GCs was amplified and used successfully for microarray assays.
Key words Laser-capture microdissection, RNA isolation, Cryosectioning, Arabidopsis, Tomato,
Galls, Root-knot nematode, Giant cells
1 Introduction
Laser-capture microdissection (LCM) is a technique that allows
harvesting specific cells from complex tissues or populations for
specific RNA, DNA, or protein isolation [1, 2] so that they can
be used in downstream applications such as microarray hybridiza-
tion, cDNA library construction, proteomic analysis, etc. So far
several laser-capture equipments have been developed by different
companies [3]. We performed LCM with the PixCell II system
(Arcturus), which allows isolating cells using a low-power (infrared)
laser and retaining them in a thermoplastic film; as the laser radia-
tion is absorbed by the film instead of by the cell samples, this
procedure should preserve the integrity of the captured material.
The technique is applied to tissue sections that can be prepared
from either frozen or paraffin-embedded biological samples. In
general, better morphology can be observed in paraffin-embedded
tissues fixed with non-coagulating fixatives, whereas the use of
coagulating fixatives (such as ethanol: acetic acid) for frozen tissues
Hailing Jin and Isgouhi Kaloshian (eds.), RNA Abundance Analysis: Methods and Protocols, Methods in Molecular Biology,
vol. 2170, https://doi.org/10.1007/978-1-0716-0743-5_3, © Springer Science+Business Media, LLC, part of Springer Nature 2021
35](https://image.slidesharecdn.com/11208657-250607100737-80e202cd/85/Rna-Abundance-Analysis-Methods-And-Protocols-2nd-Ed-Hailing-Jin-50-320.jpg)
![renders higher RNA yield and quality [4]. Thus, a compromise
between both good morphology and RNA preservation should be
achieved.
A few attempts to study specifically nematode feeding sites
(NFS) have been carried out [5, 6]. The first report was based on
micro-aspiration of the cytosolic content of tomato GCs [7], but
this method could only be applied to large GCs at late differentia-
tion stages. In contrast, LCM represented an advance as it permits
precise NFS collection at any infection time as long as they can be
identified in histological sections. The first reported NFS isolation
by LCM was applied to syncytia induced by cyst nematodes [8]. We
have developed a protocol to both preserve morphology and render
high-quality RNA from GCs formed by root-knot nematodes at
different developmental stages (3 and 7 days post-infection (dpi))
of either Arabidopsis or tomato. Briefly, this protocol consists of a
mild fixation step with a non-crosslinking fixative, gall cryosection-
ing, GCs LCM, and eventually RNA extraction. The RNA obtained
by this protocol has been successfully used for microarray analysis.
Safety handling measures to avoid RNA degradation are
strongly recommended, such as always wearing gloves, preparing
all the solutions with diethyl pyrocarbonate (DEPC)-treated deio-
nized water and using RNase-free plastic and glassware. To prepare
0.1% DEPC-treated deionized water: add 1 ml DEPC to 1 l of
deionized water (see Note 1) and stir overnight at room tempera-
ture (RT) and autoclave it for 20 min at 121
C to destroy DEPC.
2 Materials
2.1 Tissue Fixation 1. Ethanol-acetic acid (EAA) fixative solution: 3 parts of absolute
ethanol (molecular biology grade) and one part of glacial acetic
acid (3:1 v/v). Prepare it in a conical tube or a glass bottle by
mixing the ethanol and acetic acid and keep it tightly closed on
ice. Only freshly made fixative solution should be used.
2. Microcentrifuge tubes.
3. Surgical blade in a scalpel with handle.
4. Pointed tip tweezers.
2.2 Cryoprotective
Solutions
1. 0.01 M phosphate buffered saline solution (PBS), pH 7.4:
0.138 M NaCl, 2.7 mM KCl. Dissolve a pouch in 1 l of
DEPC-water (see Note 2) and store at RT.
2. 10% sucrose in 0.01 M PBS pH 7.4. Add 5 g of sucrose to PBS
for a final volume of 50 ml. Dissolve completely and store at
4
C (see Note 3).
3. 15% sucrose in 0.01 M PBS pH 7.4. Add 7.5 g of sucrose to PBS
for a final volume of 50 ml. Dissolve completely and store at 4
C.
36 Marta Barcala et al.](https://image.slidesharecdn.com/11208657-250607100737-80e202cd/85/Rna-Abundance-Analysis-Methods-And-Protocols-2nd-Ed-Hailing-Jin-51-320.jpg)
![CHAPTER XXIII.
Newcastle-on-Tyne—Indians’ alarms about jails—Kind visits from Friends—Mrs.
A. Richardson—Advice of the Friends—War-Chiefs reply—Liberal presents—
Arrive at Sunderland—Kindness of the Friends—All breakfast with Mr. T.
Richardson—Indians plant trees in his garden—And the Author also—The
Doctor’s superstition—Sacrifice—Feast—Illness of the Roman Nose—Indians
visit a coalpit—North Shields—A sailors’ dinner and a row—Arrive at
Edinburgh—A drive—First exhibition there—Visit to Salisbury Crag—To
Arthur’s Seat—Holyrood House and Castle—The crown of Robert Bruce—
The “big gun,”—“Queen Mab”—Curious modes of building—“Flats”—Origin
of—Illness of Corsair, the little pappoose—The old Doctor speaks—War-
chief’s speech—A feast of ducks—Indians’ remarks upon the government of
Scotland—“The swapping of crowns”—The Doctor proposes the crown of
Robert Bruce for Prince Albert—Start for Dundee—Indians’ liberality—A
noble act—Arrival at Dundee—Death of little Corsair—Distress of the Little
Wolf and his wife—Curious ceremony—Young men piercing their arms—
Indians at Perth—Arrival in Glasgow—Quartered in the Town-hall—The
cemetery—The Hunterian Museum—The Doctor’s admiration of it—Daily
drives—Indians throw money to the poor—Alarm for Roman Nose—Two
reverend gentlemen talk with the Indians—War-chief’s remarks—Greenock
—Doctor’s regret at leaving.
Newcastle-on-Tyne was the next place where we stopped, and when
I arrived there I found Mr. Melody and his friends very comfortably
lodged, and all in excellent spirits. The Indians, he told me, had
been exceedingly buoyant in spirits from the moment they left York,
and the old Doctor sang the whole way, even though he had been
defeated in his design of riding outside on the railway train, as he
had been in the habit of doing on the omnibus in London. I told
them I had remained a little behind them in York to enjoy a few
hours more of the society of an excellent and kind lady of the
Society of Friends,[29] whom they would recollect to have seen in
the exhibition room when they had finished their last night’s
exhibition, who came forward and shook hands in the most](https://image.slidesharecdn.com/11208657-250607100737-80e202cd/85/Rna-Abundance-Analysis-Methods-And-Protocols-2nd-Ed-Hailing-Jin-70-320.jpg)
![affectionate manner, and left gold in their hands as she bade them
good bye, and commended them to the care of the Great Spirit.
I told them that this good lady had only returned from the country
on the last evening of their exhibiting in York, and was exceedingly
disappointed that she could not have the pleasure of their society at
her house. I then sat down and amused them an hour with a
beautiful manuscript book, by her own hand, which she had
presented to me, containing the portraits of seven Seneca chiefs and
braves, who were in England twenty-five years before, and whom
she entertained for three weeks in her own house. This interesting
work contains also some twenty pages of poetry glowing with piety,
and written in a chaste and beautiful style; and an hundred or more
pages in prose, giving a full description of the party, their modes,
and a history of their success, as they travelled through the
kingdom. This was a subject of much pleasure to them, but at the
same time increased their regret that they had not seen more of this
kind lady before they left the town of York.
Their first inquiries after their arrival in Newcastle were whether they
would meet any of the “good people” in that town, and whether that
was a place where they had prisons and a gallows like those in
London and in York. I answered that they would no doubt find many
of the Friends there, for I knew several very kind families who would
call upon them, and also that the good lady who gave me the book
in York had written letters to several of the Friends in Newcastle to
call on them; and that, as to the jails, c., I believed they were
much the same.
In a sort of council which we held there, as we were in the Indian
habit of convening one whenever we were leaving an old lodging or
taking possession of a new one, it was very gravely and diffidently
suggested by the Doctor, as the desire of the whole party, that they
presumed Chippehola[30] had money enough left in London (in case
they should fail in this section of the country to make enough to pay
their debts) to keep them clear from being taken up and treated like
white men who can’t pay what they owe. I approved this judicious](https://image.slidesharecdn.com/11208657-250607100737-80e202cd/85/Rna-Abundance-Analysis-Methods-And-Protocols-2nd-Ed-Hailing-Jin-71-320.jpg)
![and truly charitable lady came with fifteen or twenty of her friends,
and the Indians listened with patience and apparent pleasure to the
Christian advice that was given them by several, and cheerfully
answered to the interrogatories which were put to them.
The immediate appeal and thanks to the “Great Spirit, who had sent
these kind people to them,” by the War-chief in his reply, seemed to
impress upon the minds of all present the conviction of a high and
noble sentiment of religion in the breasts of these people, which
required but the light of the Christian revelation. His replies as to the
benefits of education were much as he had made them on several
occasions before, that, “as for themselves, they were too far
advanced in life to think of being benefited by it, but that their
children might learn to read and write, and that they should be glad
to have them taught to do so.” Here seemed to dawn a gleam of
hope, which that pious lady, in her conversation and subsequent
correspondence with me, often alluded to, as the most favourable
omen for the desire which the Friends had of rendering them some
lasting benefit. Mr. Melody on this occasion produced a little book
printed in the Ioway language, in the missionary school already in
existence in the tribe, and also letters which he had just received
from the Rev. Mr. Irvin, then conducting the school, giving an
encouraging account of it, and hoping that the Indians and himself
might return safe, and with means to assist in the noble enterprise.
This information was gratifying in the extreme, and all seemed to
think that there was a chance of enlightening these benighted
people. The heart of this Christian woman reached to the American
wilderness in a letter that she directed to this reverend gentleman,
believing that there, where were the wives and children of the chiefs
and warriors who were travelling, was the place for the efforts of the
Society of Friends to be beneficially applied; and thus, I believe,
formed the chain from which I feel confident the most fortunate
results will flow.[31]
Several subsequent interviews were held with the Indians by these
kind people, who took them to their houses and schools, and](https://image.slidesharecdn.com/11208657-250607100737-80e202cd/85/Rna-Abundance-Analysis-Methods-And-Protocols-2nd-Ed-Hailing-Jin-73-320.jpg)
Rna Abundance Analysis Methods And Protocols 2nd Ed Hailing Jin
- 1. Rna Abundance Analysis Methods And Protocols 2nd Ed Hailing Jin download https://ebookbell.com/product/rna-abundance-analysis-methods-and- protocols-2nd-ed-hailing-jin-22417314 Explore and download more ebooks at ebookbell.com
- 2. Here are some recommended products that we believe you will be interested in. You can click the link to download. Rna Abundance Analysis Methods And Protocols 1st Edition Hideo Matsumura https://ebookbell.com/product/rna-abundance-analysis-methods-and- protocols-1st-edition-hideo-matsumura-4501842 Rna Structure And Dynamics 1st Ed 2023 Jienyu Ding Jason R Stagno https://ebookbell.com/product/rna-structure-and-dynamics-1st- ed-2023-jienyu-ding-jason-r-stagno-46591202 Rna Delivery Function For Anticancer Therapeutics Loutfy H Madkour https://ebookbell.com/product/rna-delivery-function-for-anticancer- therapeutics-loutfy-h-madkour-46668394 Rna Structure Prediction Risa Karakida Kawaguchi Junichi Iwakiri https://ebookbell.com/product/rna-structure-prediction-risa-karakida- kawaguchi-junichi-iwakiri-47627364
- 3. Rna Modifications 1st Mary Mcmahon https://ebookbell.com/product/rna-modifications-1st-mary- mcmahon-47699696 Rna Interference And Crispr Technologies 1st Mouldy Sioud https://ebookbell.com/product/rna-interference-and-crispr- technologies-1st-mouldy-sioud-47710484 Rna Methodologies A Laboratory Guide For Isolation And Characterization 6th Edition Robert E Farrell Jr https://ebookbell.com/product/rna-methodologies-a-laboratory-guide- for-isolation-and-characterization-6th-edition-robert-e-farrell- jr-48774206 Rnaprotein Complexes And Interactions Methods And Protocols Methods In Molecular Biology 2666 2nd Ed 2023 Renjang Lin Editor https://ebookbell.com/product/rnaprotein-complexes-and-interactions- methods-and-protocols-methods-in-molecular-biology-2666-2nd- ed-2023-renjang-lin-editor-50124494 Rna And Life Threatening Diseases Esha Rami https://ebookbell.com/product/rna-and-life-threatening-diseases-esha- rami-50295412
- 5. RNA Abundance Analysis Hailing Jin Isgouhi Kaloshian Editors Methods and Protocols SecondEdition Methods in Molecular Biology 2170
- 6. M E T H O D S I N M O L E C U L A R B I O L O G Y Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK For further volumes: http://www.springer.com/series/7651
- 7. For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step- bystep fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.
- 8. RNA Abundance Analysis Methods and Protocols Second Edition Edited by Hailing Jin Department of Plant Pathology and Microbiology, Center for Plant Cell Biology and Institute for Integrative Genome Biology, University of California, Riverside, CA, USA Isgouhi Kaloshian Department of Nematology, University of California, Riverside, CA, USA
- 9. Editors Hailing Jin Department of Plant Pathology and Microbiology, Center for Plant Cell Biology and Institute for Integrative Genome Biology University of California Riverside, CA, USA Isgouhi Kaloshian Department of Nematology University of California Riverside, CA, USA ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-0716-0742-8 ISBN 978-1-0716-0743-5 (eBook) https://doi.org/10.1007/978-1-0716-0743-5 © Springer Science+Business Media, LLC, part of Springer Nature 2021 All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.
- 10. Preface We are pleased to have this opportunity to edit the Second Edition of RNA Abundance Analysis. RNA abundance is one of the most important measurements for gene expression analysis in the field of molecular biology. Continuous progress in modern technology has empowered us to examine RNA expression more accurately and efficiently, with precision at the cellular and subcellular levels. A new collection of the rapid advances of methodology in RNA abundance analysis is important and timely. This book covers a wide range of techni- ques on RNA extraction, detection, quantification, visualization, and genome-wide profiling, from conventional methods to state-of-the-art high-throughput approaches. We include detailed techniques to examine mRNAs, small noncoding RNAs, protein-associated small RNAs, organelle RNAs, endosymbiont RNAs, and alternatively spliced RNA variants from various organisms. RNA editing and the computational data processing for genome- wide datasets are also discussed. Collectively, these methods should provide helpful guidance to biologists in their gene expression and regulation studies. The beginning of many RNA studies is the isolation of RNAs. We have included methods for extracting RNAs from specific cells and tissues of plants, fungi, insect endo- symbiont, and parasites (Chapters 3, 8, 13, and 14). Furthermore, we included detailed protocols on isolating RNAs from specific subcellular structures, such as chloroplasts and extracellular vesicles (Chapters 10 and 16). Isolating RNAs could be challenging if one wishes to address a process that is limited to a few cells within a tissue or organism, or a specific organelle or subcellular fraction of a cell. These chapters have provided excellent tools to achieve these goals. Once high-quality RNAs of specific cells, tissues, or subcellular structures have been extracted, the spatial and temporal expression patterns of an individual gene or the whole genome could be established. Therefore, Chapters 2, 5, 6, 7, 10, 11, 12, 13, and 14 present a set of diverse technologies to examine and analyze the expression of mRNAs and small RNAs. In particular, Chapters 2, 5, 6, 14, and 16 describe the application of high- throughput genome-wide next-generation sequencing approaches to study RNA-related parameters in organisms. While generating vast amounts of sequence data has become routine and increasingly economical, the bottleneck continues to be the computational analysis of the data. This edition therefore includes a chapter on bioinformatics methods to analyze high-throughput RNA and small RNA expression data collected by next- generation sequencing. RNAs function mostly through association with various proteins; the study of RNA-protein interaction is a key focus for understanding RNA regulation and gene expres- sion. Chapters 4, 7, and 15 describe the methods to identify RNAs associated with specific protein or protein complexes and to understand the gene expression regulation mediated by RNA-protein interaction. In this edition, we have also included innovative emerging techniques, such as CRISPR- Cas-mediated RNA editing (Chapter 1) and titanium oxide nanofiber-mediated small RNA extraction (Chapter 8). v
- 11. Finally, we hope this new edition provides a comprehensive set of techniques and methods on isolating and analyzing mRNAs, small RNAs, and other RNA variants, which can assist you in your gene expression studies. Riverside, CA, USA Hailing Jin Isgouhi Kaloshian vi Preface
- 12. Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix 1 CRISPR-Cas RNA Targeting Using Transient Cas13a Expression in Nicotiana benthamiana . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Veerendra Sharma, Wenguang Zheng, Jun Huang, and David E. Cook 2 Strand-Specific RNA-Seq Applied to Malaria Samples . . . . . . . . . . . . . . . . . . . . . . . 19 Xueqing Maggie Lu and Karine Le Roch 3 Laser Microdissection of Cells and Isolation of High-Quality RNA After Cryosectioning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35 Marta Barcala, Carmen Fenoll, and Carolina Escobar 4 Detection of RNA in Ribonucleoprotein Complexes by Blue Native Northern Blotting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45 Lena Krüßel, Steffen Ostendorp, Anna Ostendorp, and Julia Kehr 5 Quantitative Analysis of Plant miRNA Primary Transcripts . . . . . . . . . . . . . . . . . . . 53 Jakub Dolata, Andrzej Zielezinski, Agata Stepien, Katarzyna Kruszka, Dawid Bielewicz, Andrzej Pacak, Artur Jarmolowski, Wojciech Karlowski, and Zofia Szweykowska-Kulinska 6 A Revised Adaptation of the Smart-Seq2 Protocol for Single-Nematode RNA-Seq . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79 Dennis Chang, Lorrayne Serra, Dihong Lu, Ali Mortazavi, and Adler Dillman 7 Analysis of RBP Regulation and Co-regulation of mRNA 30 UTR Regions in a Luciferase Reporter System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 101 Erin L. Sternburg and Fedor V. Karginov 8 Extraction of Small RNAs by Titanium Dioxide Nanofibers . . . . . . . . . . . . . . . . . . 117 Luis A. Jimenez and Wenwan Zhong 9 Identification of MicroRNAs and Natural Antisense Transcript-Originated Endogenous siRNAs from Small-RNA Deep Sequencing Data . . . . . . . . . . . . . . . 125 Weixiong Zhang, Xuefeng Zhou, Xiang Zhou, and Jing Xia 10 Purification and Analysis of Chloroplast RNAs in Arabidopsis . . . . . . . . . . . . . . . . 133 Huan Wang and Hailing Jin 11 In Situ Detection of Mature miRNAs in Plants Using LNA-Modified DNA Probes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 143 Xiaozhen Yao, Hai Huang, and Lin Xu 12 Northern Blotting Technique for Detection and Expression Analysis of mRNAs and Small RNAs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 155 Ankur R. Bhardwaj, Ritu Pandey, Manu Agarwal, and Surekha Katiyar-Agarwal vii
- 13. 13 Isolation of Insect Bacteriocytes as a Platform for Transcriptomic Analyses . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 185 Mélanie Ribeiro Lopes, Pierre Simonet, Gabrielle Duport, Karen Gaget, Séverine Balmand, Akiko Sugio, Jean-Christophe Simon, Nicolas Parisot, and Federica Calevro 14 Small RNA Isolation and Library Construction for Expression Profiling of Small RNAs from Neurospora crassa and Fusarium oxysporum and Analysis of Small RNAs in Fusarium oxysporum-Infected Plant Root Tissue . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 199 Shou-Qiang Ouyang, Gyungsoon Park, Hui-Min Ji, and Katherine A. Borkovich 15 Studying RNA–Protein Interaction Using Riboproteomics. . . . . . . . . . . . . . . . . . . 213 Sonali Chaturvedi and A. L. N. Rao 16 Small RNA Extraction and Quantification of Isolated Fungal Cells from Plant Tissue by the Sequential Protoplastation. . . . . . . . . . . . . . . . . . . . . . . . . 219 Qiang Cai and Hailing Jin Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 231 viii Contents
- 14. Contributors MANU AGARWAL • Department of Botany, University of Delhi North Campus, Delhi, India SÉVERINE BALMAND • Univ Lyon, INSA-Lyon, INRAE, BF2i, UMR203, F-69621, Villeurbanne, France MARTA BARCALA • Facultad de Ciencias Ambientales y Bioquı́mica, Universidad de Castilla- La Mancha, Toledo, Spain; International Research Organization for Advanced Science and Technology (IROAST), Kumamoto University, Kumamoto, Japan ANKUR R. BHARDWAJ • Department of Botany, Ramjas College, University of Delhi North Campus, Delhi, India DAWID BIELEWICZ • Department of Gene Expression, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznań, Poznań, Poland KATHERINE A. BORKOVICH • Department of Microbiology and Plant Pathology, Institute for Integrative Genome Biology, University of California, Riverside, CA, USA QIANG CAI • Department of Plant Pathology and Microbiology, Center for Plant Cell Biology and Institute for Integrative Genome Biology, University of California, Riverside, CA, USA FEDERICA CALEVRO • Univ Lyon, INSA-Lyon, INRAE, BF2i, UMR203, F-69621, Villeurbanne, France DENNIS CHANG • Department of Nematology, University of California, Riverside, CA, USA SONALI CHATURVEDI • Gladstone Institute of Virology and Immunology, Gladstone Institutes, San Francisco, CA, USA DAVID E. COOK • Department of Plant Pathology, Kansas State University, Manhattan, KS, USA ADLER DILLMAN • Department of Nematology, University of California, Riverside, CA, USA JAKUB DOLATA • Department of Gene Expression, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznań, Poznań, Poland GABRIELLE DUPORT • Univ Lyon, INSA-Lyon, INRAE, BF2i, UMR203, F-69621, Villeurbanne, France CAROLINA ESCOBAR • Facultad de Ciencias Ambientales y Bioquı́mica, Universidad de Castilla-La Mancha, Toledo, Spain; International Research Organization for Advanced Science and Technology (IROAST), Kumamoto University, Kumamoto, Japan CARMEN FENOLL • Facultad de Ciencias Ambientales y Bioquı́mica, Universidad de Castilla-La Mancha, Toledo, Spain KAREN GAGET • Univ Lyon, INSA-Lyon, INRAE, BF2i, UMR203, F-69621, Villeurbanne, France HAI HUANG • National Laboratory of Plant Molecular Genetics, Shanghai Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China JUN HUANG • Department of Plant Pathology, Kansas State University, Manhattan, KS, USA ARTUR JARMOLOWSKI • Department of Gene Expression, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznań, Poznań, Poland ix
- 15. HUI-MIN JI • College of Horticulture and Plant Protection, Yangzhou University, Yangzhou, China LUIS A. JIMENEZ • Program in Biomedical Sciences, University of California, Riverside, CA, USA HAILING JIN • Department of Plant Pathology and Microbiology, Center for Plant Cell Biology and Institute for Integrative Genome Biology, University of California, Riverside, CA, USA FEDOR V. KARGINOV • Department of Molecular, Cell and Systems Biology, Institute for Integrative Genome Biology, University of California, Riverside, CA, USA WOJCIECH KARLOWSKI • Department of Computational Biology, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznań, Poznań, Poland SUREKHA KATIYAR-AGARWAL • Department of Plant Molecular Biology, University of Delhi South Campus, New Delhi, India JULIA KEHR • Molecular Plant Genetics, Universit€ at Hamburg, Institute of Plant Science and Microbiology, Hamburg, Germany LENA KRÜßEL • Molecular Plant Genetics, Universit€ at Hamburg, Institute of Plant Science and Microbiology, Hamburg, Germany KATARZYNA KRUSZKA • Department of Gene Expression, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznań, Poznań, Poland KARINE LE ROCH • Department of Cell Biology and Neuroscience, Institute for Integrative Genome Biology, Center for Disease Vector Research, University of California, Riverside, CA, USA DIHONG LU • Department of Nematology, University of California, Riverside, CA, USA XUEQING MAGGIE LU • Department of Cell Biology and Neuroscience, Institute for Integrative Genome Biology, Center for Disease Vector Research, University of California, Riverside, CA, USA ALI MORTAZAVI • Department of Developmental and Cell Biology, Center for Complex Biological Systems, University of California, Irvine, CA, USA ANNA OSTENDORP • Molecular Plant Genetics, Universit€ at Hamburg, Institute of Plant Science and Microbiology, Hamburg, Germany STEFFEN OSTENDORP • Molecular Plant Genetics, Universit€ at Hamburg, Institute of Plant Science and Microbiology, Hamburg, Germany SHOU-QIANG OUYANG • College of Horticulture and Plant Protection, Yangzhou University, Yangzhou, China; Joint International Research Laboratory of Agriculture and Agri- Product Safety of Ministry of Education of China and Key Laboratory of Plant Functional Genomics of the Ministry of Education, Yangzhou University, Yangzhou, China ANDRZEJ PACAK • Department of Gene Expression, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznań, Poznań, Poland RITU PANDEY • Department of Botany, SGTB Khalsa College, University of Delhi North Campus, Delhi, India NICOLAS PARISOT • Univ Lyon, INSA-Lyon, INRAE, BF2i, UMR203, F-69621, Villeurbanne, France GYUNGSOON PARK • Department of Electrical and Biological Physics, Plasma Bioscience Research Institute, Kwangwoon University, Seoul, Republic of Korea A. L. N. RAO • Department of Microbiology and Plant Pathology, University of California, Riverside, CA, USA x Contributors
- 16. MÉLANIE RIBEIRO LOPES • Univ Lyon, INSA-Lyon, INRAE, BF2i, UMR203, F-69621, Villeurbanne, France LORRAYNE SERRA • Department of Developmental and Cell Biology, Center for Complex Biological Systems, University of California, Irvine, CA, USA VEERENDRA SHARMA • Department of Plant Pathology, Kansas State University, Manhattan, KS, USA JEAN-CHRISTOPHE SIMON • Agrocampus Ouest, Université Rennes 1, INRAE, IGEPP, UMR 1349, BP 35327, Le Rheu, France PIERRE SIMONET • Univ Lyon, INSA-Lyon, INRAE, BF2i, UMR203, F-69621, Villeurbanne, France AGATA STEPIEN • Department of Gene Expression, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznań, Poznań, Poland ERIN L. STERNBURG • Department of Molecular, Cell and Systems Biology, Institute for Integrative Genome Biology, University of California, Riverside, CA, USA AKIKO SUGIO • Agrocampus Ouest, Université Rennes 1, INRAE, IGEPP, UMR 1349, BP 35327, Le Rheu, France ZOFIA SZWEYKOWSKA-KULINSKA • Department of Gene Expression, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznań, Poznań, Poland HUAN WANG • Department of Plant Pathology and Microbiology, Center for Plant Cell Biology and Institute for Integrative Genome Biology, University of California, Riverside, CA, USA JING XIA • Department of Computer Science and Engineering, Washington University, St. Louis, MO, USA LIN XU • National Laboratory of Plant Molecular Genetics, Shanghai Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China XIAOZHEN YAO • National Laboratory of Plant Molecular Genetics, Shanghai Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China WEIXIONG ZHANG • Department of Computer Science and Engineering, Fudan University, Shanghai, China; Department of Computer Science and Engineering, Washington University, St. Louis, MO, USA; Department of Genetics, Washington University School of Medicine, St. Louis, MO, USA WENGUANG ZHENG • Department of Plant Pathology, Kansas State University, Manhattan, KS, USA WENWAN ZHONG • Department of Chemistry, University of California, Riverside, CA, USA XIANG ZHOU • Department of Computer Science and Engineering, Washington University, St. Louis, MO, USA XUEFENG ZHOU • Department of Computer Science and Engineering, Washington University, St. Louis, MO, USA ANDRZEJ ZIELEZINSKI • Department of Computational Biology, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznań, Poznań, Poland Contributors xi
- 17. Chapter 1 CRISPR-Cas RNA Targeting Using Transient Cas13a Expression in Nicotiana benthamiana Veerendra Sharma, Wenguang Zheng, Jun Huang, and David E. Cook Abstract Application of the CRISPR-Cas prokaryotic immune system for single-stranded RNA targeting will have significant impacts on RNA analysis and engineering. The class 2 Type VI CRISPR-Cas13 system is an RNA-guided RNA-nuclease system capable of binding and cleaving target single-stranded RNA substrates in a sequence-specific manner. In addition to RNA interference, the Cas13a system has application from manipulating RNA modifications, to editing RNA sequence, to use as a nucleic acid detection tool. This protocol uses the Cas13a ortholog from Leptotrichia buccalis for transient expression in plant cells providing antiviral defense. We cover all the necessary information for cloning the Cas13 protein, crRNA guide cassette, performing transient Agrobacterium-mediated expression of the necessary Cas13a compo- nents and target RNA-virus, visualization of virus infection, and molecular quantification of viral accumu- lation using quantitative PCR. Key words CRISPR-Cas13, RNA targeting, mRNA interference, RNA editing, Transcriptome edit- ing, Antiviral protection, Plant biotechnology, Plant virus 1 Introduction Understanding gene function, through the manipulation of DNA and subsequent experimental determination of phenotypic effects (i.e., functional genomics) remains a grand challenge across biological disciplines. Application of the clustered regularly inter- spaced short palindromic repeats (CRISPR) and CRISPR asso- ciated protein (Cas) prokaryotic immune system for eukaryotic DNA manipulation has ushered in a new approach for functional genomics and genome engineering [1–3]. A strength of using CRISPR-Cas systems for genome engineering is their general organism-agnostic function, plethora of homologs, ease of use, and their amenability to be redesigned to carry out novel functions [4]. The use of class 2 CRISPR-Cas systems, such as Cas9 and Cas12, for genome editing have been applied and previously Hailing Jin and Isgouhi Kaloshian (eds.), RNA Abundance Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2170, https://doi.org/10.1007/978-1-0716-0743-5_1, © Springer Science+Business Media, LLC, part of Springer Nature 2021 1
- 18. detailed across a range of organisms and is not the focus of this methods chapter [5, 6]. The method in this chapter focuses on the use of class 2 type VI CRISPR-Cas systems referred to as Cas13, which target RNA as their substrate, delivering programmable single-stranded RNA interference [7, 8]. This approach opens new opportunities to manipulate and study gene function by targeting transcribed RNA. Also, while Cas13 has an inherent function as a RNA nucle- ase, research has shown it can also be engineered to carry-out novel functions which can aid in the study of RNA or address societal challenges [9, 10]. At this time, the RNA-targeting Cas13 systems have been subdivided into four families, termed Cas13a, Cas13b, Cas13c, and Cas13d [11–13]. While the Cas13 systems described to-date all require a crRNA and Cas13 effector protein, their sequence, structure, and mechanistic details can vary. Conse- quently, there is variation across the Cas13 systems for attributes such as target RNA binding affinity, guide processing and target RNA nuclease activity [10, 11]. There are also reports of additional helper proteins that are not required, but modulate target RNA degradation through various mechanisms [14, 15]. Significant mechanistic questions remain regarding Cas13a/b/c/d function in general and function within specific groups of organisms. This method will focus on Cas13a from Leptotrichia buccalis (Lbu) for transient expression in the plant Nicotiana benthamiana. We detail the use of Cas13a for targeted reduction of Turnip Mosaic Virus (TuMV), a single-stranded RNA virus of the largest plant infecting family, Poytviridae [16, 17]. Plant infecting viruses cause significant economic losses annually and threaten global food secu- rity. The method described here provides the plant with a new antiviral immune response, which has significant implications for improving crop production through biotechnology. More gener- ally, the approach can be modified to study any cellular single- stranded RNA for a variety of experiments in planta. 2 Materials 2.1 Synthetic DNA and Vectors 1. pGWB413 gateway cloning vector (Addgene plasmid ID: 74807). 2. Leptotrichia buccalis Cas13a DNA fragment including pro- moter and terminator (Integrated DNA Technologies) (Table 1 for sequence, see Notes 1–3). 3. NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). 4. pENTR/D-TOPO vector and cloning kit (Invitrogen). 2 Veerendra Sharma et al.
- 19. 5. crRNA cloning adaptor (Integrated DNA Technologies) (Table 2 for sequence). 6. TuMV HCPro guide RNA oligos (Integrated DNA Technol- ogies) (Table 3 for sequence). 7. 2 Annealing buffer: 20 mM Tris, 2 mM EDTA, 100 mM NaCl, pH 8.0. 8. TE buffer: 10 mM Tris, 1 mM EDTA, pH 8.0. 9. Gateway LR Clonase (Invitrogen). 10. Agarose (VWR). 11. Gel fragment extraction kit (Promega). Table 1 Synthetic Cas13a cassette Sequence (50 ! 30 ) Sequence overlapping pGWB413, 50 of CaMV 35S promoter Gtacaaagtggttgataacagcgggttaat Lbu (Leptotrichia buccalis) Cas13a coding sequence NCBI protein accession number WP_015770004, codon optimized on IDT website HSP terminator TATGAAGATGAAGATGAAATATTTGGTGTGTCAAA TA AAAAGCTAGCTTGTGTGCTTAAGTTTGTG TTTTTTTCT TGGCTTGTTGTGTTATGAATTTGTGGCTTTTTC TAATA TTAAATGAATGTAAGATCTCATTATAATGAA TAAACA AATGTTTCTATAATCCATTGTGAATGTTTTGTTGGA TC TCTTCGCATATAACTACTGTATGTGCTATGGTA TGGAC TATGGAATATGATTAAAGATAAG Sequence overlapping pGWB413, 30 of HSP terminator Ggcccgatcatattgtcgctcaggatcgtg Table 2 Empty crRNA cassette and target mRNA guide oligos Name of oligos Sequence of oligos (5’ 3’) Note crRNA adaptor CACCtctagatGGAGTGATCAAAAGTCCCACATCGATCAGGTG ATATATAGCAGCTTAGTTTATATAATGATAGAGTCGACATAG CGATTgGATTTAGACCACCCCAAAAATGAAGGGGACTAAAA CAaGAGACCcagctGGTCTCgTTTTTTagcccggg U6 promoter italic, Direct repeat shaded grey, BsaI sites bold HCPro guide-F AACACTGGGAAATCTTGTTGCGAAAGGACTTC HCPro guide-R AAAAGAAGTCCTTTCGCAACAAGATTTCCCAG Cas13a RNA-Targeting in Plants 3
- 20. 12. One Shot™ ccdB Survival™ 2 T1R Competent Cells (Thermo Fisher). 13. T4 DNA ligase (New England Biolabs). 14. PacI, PspOMI, KpnI, BsaI restriction enzymes (New England Biolabs). 15. Hotplate and water bath. 16. DNA oligos used for PCR identification during cloning (Integrated DNA Technologies) (Table 3 for sequence). 17. Luria Bertani (LB) medium: for LB broth, 0.5% yeast extract, 1% tryptone, 1% NaCl in deionized water. For LB agar, add 1.5% agar in LB broth. Autoclave at 121 C for 20 min to sterilize. 2.2 Agrobacterium- Mediated Transient Transformation 1. Seeds of Nicotiana benthamiana plants. 2. Agrobacterium tumefaciens strain GV3101. 3. Turnip Mosaic Virus, TuMV infectious clone pCBTuMV-GFP (GenBank EF028235.1, [18]). 4. Infiltration buffer: 10 mM MgCl2, 10 mM MES buffer, pH 5.7 and 100 μM acetosyringone (prepared in DMSO). 5. 1.0 mL needleless syringes. 6. Spectrophotometer. 7. 50 mL conical tubes with screw top. 8. Table top centrifuge with rotor for 50 mL conical tubes. 9. Temperature controlled laboratory shaker. Table 3 Oligos used to screen vectors for positive colonies and to perform qPCR Name of Oligo Sequence of oligos (50 ! 30 ) Purpose Cas13a-F GCGAGGGTCGATTAGTGAAAT Colony screening Cas13a-R CCAGGATGTCCGTTTCTGAATA Colony screening U6-F GGAGTGATCAAAAGTCCCACATCG Colony screening BsaI-R AAACGAGACCAGAACTAAGGGT Colony screening 35S-R TACGTCAGTGGAGATATCACATCA Colony screening TuMV_P1-F TAGAGCGCAGCAACCAATTA TuMV qPCR TuMV_P1-R CGAACCTCTTCTGCTTCGATTA TuMV qPCR EF1a-F AGCTTTACCTCCCAAGTCATC EF1a qPCR EF1a-R AGAACGCCTGTCAATCTTGG EF1a qPCR 4 Veerendra Sharma et al.
- 21. 2.3 Visualizing Virus Infection 1. Hand held high-intensity UltraViolet lamp (Analytik Jena). 2. Nikon DSLR camera with stand. 3. Black cloth. 2.4 qPCR for Virus Quantification 1. TRIzol (Invitrogen). 2. Liquid Nitrogen. 3. Chloroform (Sigma-Aldrich). 4. Isopropanol (Fisher). 5. Ethanol. 6. Reinforced 2 mL tubes with screw tops. 7. 2.3 mm Zirconia/Silica beads (BioSpec). 8. Bead Ruptor Elite (Omni International). 9. NanoDrop ND1000 (Thermo Fisher). 10. Turbo DNA-free kit (Ambion). 11. 10 mM dNTP mix (New England Biolabs). 12. SuperScript II reverse transcriptase (Thermo Fisher). 13. RNaseOUT inhibitor (Thermo Fisher). 14. Random hexamer (Thermo Fisher). 15. 0.2 and 0.5 mL PCR tubes. 16. Thermocycler (MJ Research). 17. SYBR Select Master Mix for CFX (Applied Biosystems). 18. 96-well microplate. 19. Microplate sealing tape. 20. Centrifuge with rotor for 96-well plate. 21. CFX96 Touch Real-Time PCR Detection System (Bio-Rad). 3 Methods 3.1 Cas13a Expression Vector 1. Synthesize the coding sequence for Cas13a from Leptotrichia buccalis (Lbu) following NCBI protein accession number WP_015770004.1 (see Notes 1–3). 2. Linearize pGWB413 vector by double digestion with PacI and PspOMI restriction enzymes (NEB) in a 20 μL reaction. To set up the reaction, add 2 μL of 10 CutSmart buffer (NEB), 5 U of PacI, 5 U of PspOMI, 800 ng of pGWB413 DNA, and use deionized water to make final volume of 20 μL. Incubate the reaction at 37 C for 2 h. 3. Run the digested products on 1% agarose gel, cut the agarose gel containing the vector fragment of about 10 kb and use a gel fragment extraction kit to purify the vector DNA. Cas13a RNA-Targeting in Plants 5
- 22. 4. Combine the synthesized DNA fragments and linearized vec- tor using NEBuilder HiFi DNA Assembly Master Mix. To prepare the assembly reaction system, add 0.1 pmol of linear- ized vector, 0.2 pmol of gene fragments, 10 μL of NEB HiFi DNA Assembly Master Mix, and deionized water to bring the final volume to 20 μL. Incubate the reaction at 50 C in a thermocycler for 60 min (Fig. 1a). 5. Take 10 μL of the assembly reaction, add to 50 μL of chemically competent E. coli ccdB survival cells. Incubate the reaction on ice for 30 min, heat shock at 42 C in a water bath for 90 s, and then cool promptly on ice. After 2 min on ice, add 250 μL of LB broth, incubate the cells at 37 C for 60 min with shaking at 200 rpm, and then coat the cells on LB agar plate with 75 μg/ mL spectinomycin and 50 μg/mL chloramphenicol. Incubate the plate overnight in 37 C incubator for the transformed cells to form single colonies. 6. Inoculate single colony to 5 mL of LB broth in a culture tube, shake the culture tube at 37 C for about 16 h. Select the positive colonies by PCR using primer set Cas13a-F and Cas13a-R and 1 μL of cell culture as template. The expected size of the amplicon is 255 bp (see Note 4). 7. Miniprep the plasmid DNA from the putative positive colonies, then perform enzyme digestion of the construct with KpnI and PspOMI at 37 C for 2 h. Run the digestion products on 1% agarose gel. The expected release from the construct is about 2150 bp (see Note 4). After verification, the pGWB413 vector harboring Lbu-Cas13a expression cassette will be used as des- tination vector for gateway cloning of crRNA. 3.2 Guide crRNA Cloning 1. Synthesize the empty crRNA cassette for Lbu-Cas13a (see Notes 5 and 6). 2. Clone the synthesized empty crRNA cassette into pENTR/D- TOPO. Add 4 μL of crRNA adaptor DNA (about 100 ng), 1 μL of pENTR/D-TOPO vector, 1 μL of salt solution (avail- able from the kit), incubate at room temperature for 30 min (Fig. 1b). 3. Clone into chemically competent E. coli following procedure described in Subheading 3.1, step 5. The selection antibiotic is 50 μg/mL kanamycin. 4. Screen E. coli colonies for the presence of the insert using PCR with the primer pair U6-F and BsaI-R. Positive colonies will yield a band of 143 bp. 5. Digest the positive pENTR/D-TOPO vector carrying the empty crRNA cassette using BsaI restriction enzyme at 37 C for 2 h. Run the digestion products on 1% agarose gel and clean 6 Veerendra Sharma et al.
- 23. att R2 a t t R 1 att R2 a t t R 1 a t t L 1 C a s 13 a b e c d f CACCtctagatggagTGATCAAAAGTCCCACATC GATCAGGTGATATATAGCAGCTTAGTTTAT ATAATGATAGAGTCGACATAGCGATTgGAT TTAGACCACCCCAAAAATGAAGGGGACTAA AACAaGAGACCcttagttctGGTCTCgT T T TTTagcccggg 1 31 61 91 121 151 30 60 90 120 150 161 LB Directional TOPO cloning Golden Gate Cloning Gateway Cloning HCPro guide F Gibson Assembly pGWB413 pENTR RB c r R N A c assette g u ide c r R N A + guide crRN A C a s13 LB RB C a s13 LB RB att L2 a t t L 1 att L2 a t t L 1 att L2 AACACTGGGAAATCTTGTTGCGAAAGGACTTC HCPro guide R Annealed HCPro-crRNA ready to clone into BsaI digested crRNA cassette Cool to RT Boil sample AAAAGAAGTCCTTTCGCAACAAGATTTCCCAG AACACTGGGAAATCTTGTTGCGAAAGGACTTC GACCCTTTAGAACAACGCT T T CCTGAAGAAAA Topo-D A. thaliana U6 polymerase III promoter U6 Promoter U6 Promoter Lbu crRNA direct repeat DR DR guide crRNA target cloning site DNA removed BsaI BsaI Fig. 1 Schematic overview of Cas13a and associated crRNA cloning. (a) Plant codon optimized Lbu-Cas13a containing additional 30 bp overlapping DNA sequences was assembled with linearized pGWB413 by Gibson Assembly. (b) Synthesized crRNA cassette was inserted pENTR/D-TOPO vector by directional TOPO cloning. The Golden Gate cloning method was used for cloning the guide sequences into the pENTR/D-TOPO vector containing Empty-crRNA. (c) Sequence details for the empty Lbu-crRNA cassette are shown with annotation. The 50 end contains the sequence CACC (highlighted with a black to white gradient bar) to ensure directional TOPO cloning. The RNA polymerase III U6 promoter (indicated by a solid black bar beneath the sequence) is used to direct transcription of the crRNA. A guanine (g) nucleotide is added between the end of the U6 promoter and start of the Lbu-Cas13a crRNA direct repeat (DR) based on observations of a (g) requirement for PolIII promoters. Two BsaI sites (sequence shaded in green) after the Lbu-Cas13a direct repeat are used for cloning the guide target sequence into the empty-crRNA. The DNA region highlighted in grey is removed during Cas13a RNA-Targeting in Plants 7
- 24. up the linearized vector DNA from gel using gel fragment extraction kit. 6. Synthesize the oligos HCPro guide-F and HCPro guide-R needed for target mRNA binding (see Notes 7 and 8). 7. Anneal oligos obtained from step 6 in 1 annealing buffer with final concentration of 1 μM by boiling for 5 min and gradually cooling down to room temperature in 400 mL of water on a hotplate (Fig. 1d; see Note 9). 8. Ligate the annealed HCPro guide into the BsaI-digested empty crRNA cassette with T4 DNA ligase (NEB) at room tempera- ture for 30 min, and transform the ligated products into chem- ically competent E. coli cells as described in Subheading 3.1, step 5. 9. Select positive colonies using PCR with the primers of U6-F and HCPro guide-R. Positive colonies are expected to generate a DNA band of size 149 bp. Isolate plasmid from PCR positive colonies containing crRNA + guide in pENTR/D-TOPO vector. 10. Clone the crRNA cassette contained in the pENTR/D-TOPO vector to the destination vector pGWB413 harboring Lbu-Cas13a by gateway LR reaction (Fig. 1). In a reaction tube, add 1 μL of pENTR plasmid DNA (about 150 ng), 1 μL of pGWB413 vector DNA (about 150 ng), 5 μL of TE buffer, 2 μL of 5 LR reaction buffer, and 1 μL of LR Clonase enzyme mix. Incubate the reaction at 25 C for 1 h in water bath, and then add 1 μL of proteinase K and incubate at 37 C for 10 min in water bath (see Note 10). 11. Transform 2 μL of the gateway reaction product into 50 μL of chemically competent E. coli cells and incubate the coated LB agar plate at 37 C overnight allowing the formation of single colonies. Use 75 μg/mL spectinomycin for selection. 12. Identify positive single colonies by PCR using primers U6-F and 35S-R. Positive colonies containing both Lbu-Cas13 and the crRNA + guide will produce a PCR DNA band of about 500 bp. Miniprep the plasmid DNA from positive colony. The resulting construct carries both Lbu-Cas13a and HCPro- crRNA (Fig. 1f). ä Fig. 1 (continued) this cloning step and replaced by the target-specific guide sequence. A series of thymine nucleotides serve as a transcriptional termination sequence for PolIII (highlighted in red) (d) Representation of target guide oligo annealing. The two single-stranded DNA oligos are combined and heated in a water bath and then cooled to room temperature. Following annealing, the 50 end contains an AACA overhang, while the 30 contains an AAAA overhang to produce compatible sticky ends with BsaI digested Empty-guide. (e) Gateway LR reaction takes place between attL1and attL2 sites in HCPro-crRNA cassette and attR1 and attR2 sites in pGWB413 destination vector containing Lbu-Cas13a. (f) Final vector following gateway LR reaction, containing the HCPro-crRNA cassette and Lbu-Cas13a 8 Veerendra Sharma et al.
- 25. 3.3 Agrobacterium- Mediated Transient Expression of Cas13a and TuMV-GFP in N. benthamiana 1. Transform the confirmed vector from Subheading 3.2, step 12, containing Lbu-Cas13a and HCPro-crRNA, into compe- tent cells of A. tumefaciens strain GV3101. Transform by add- ing 2.0 μL of plasmid DNA to thawed A. tumefaciens cells and mix gently by tapping. 2. Incubate cells on ice for another 20 min, then transfer the tubes to liquid nitrogen for 1 min (see Note 11). 3. Transfer the tube(s) to 37 C and allow to thaw. Move thawed cells to ice and incubate for 5 min. 4. Add 0.5 mL of LB broth to each tube and incubate at 28 C, 220 rpm for 2–3 h. 5. Spin tubes at 6000 rpm (3,500 g) for 5 min to pellet cells and discard LB broth, leaving 100 μL in the tube. Suspend the cells in the remaining LB broth and spread the cells with the help of spreader on LB-agar medium plate containing selection. For Lbu-Cas13a vectors: 75 μg/mL spectinomycin, 30 μg/mL rifampicin, 30 μg/mL gentamycin; TuMV-GFP vector: 50 μg/mL kanamycin, 30 μg/mL rifampicin, 30 μg/mL gentamycin. 6. Incubate the plates at 28 C in incubator for 48 h, at which time single colonies should be present and visible (see Note 12). 7. In 50 mL tubes, inoculate a single colony of A. tumefaciens containing Lbu-Cas13a + HCPro-crRNA in one tube and another with Lbu-Cas13a + Empty-crRNA in 10 mL of LB broth with selective antibiotics as indicated in Subheading 3.3, step 5. Incubate overnight in a shaker at 28 C and 220 rpm (Fig. 2, step 1). 8. Measure the optical density of the A. tumefaciens cultures using the 600 nm setting of a spectrophotometer. Let grow until the OD600 is 0.8–1.2. 9. Spin down A. tumefaciens cultures at 4 C and 4000 rpm (~1,800 g) for 15 min, discard the supernatant and put tubes upside down on paper towels to drain the remaining LB broth. 10. Re-suspend the A. tumefaciens cells in infiltration buffer, adjusting the optical density (OD600) of bacterial cells to 1.0 (see Note 13). Incubate at room temperature for 2–3 h. 11. Cover the surface of a large laboratory tray with 2–4 sheets of newspaper and perform Agro-infiltration inside the large tray to contain the A. tumefaciens. 12. Using a 1.0 mL needleless syringe, infiltrate the A. tumefaciens suspension into the abaxial side of N. benthamiana leaves. Inject the A. tumefaciens suspension into the leaf surface Cas13a RNA-Targeting in Plants 9
- 26. while applying the counter pressure from the other side (see Notes 14 and 15). After agroinfiltration, mark the boundary of the infiltrated area with a permanent marker (see Note 16) (Fig. 2, step 2). 2) Infiltrate abaxial side of leaf with separate A. tumefaciens strains carrying different vectors 1) Grow A. tumefaciens for 20 h Wait 72 h 28oC 220 rpm Image GFP Collect Samples 3) Visualize viral infection and collect samples for molecular analysis of viral accumulation Fig. 2 General workflow for Agrobacterium-mediated expression of Cas13a and TuMV-GFP in N. benthamiana. (Step 1) requires A. tumefaciens be grown to the appropriate cell density to optimize virulence and transfer of vector DNA. (Step 2) involves the delivery of the A. tumefaciens into the plant leaf using a syringe and physical force. The syringe is held firmly against the abaxial side of the leaf, and using gently pressure, the A. tumefaciens is infiltrated into the intercellular compartments of the leaf. A dark, water soaked ring will be visible present corresponding to the region in which A. tumefaciens was successfully infiltrated. This region should be marked with a marker as it will not be visible during subsequent steps. For this protocol, A. tumefaciens strains carrying the Lbu-Cas13a vectors are infiltrated 48 h prior to infiltration of A. tumefaciens strains carrying TuMV-GFP. The two components are then allowed to accumulate for an additional 72 h before proceeding. In (Step 3), virus accumulation is approximated using a high-intensity UV lamp, which allows visualization of GFP, which is a surrogate for virus accumulation. Following visualization, the infiltrated tissue is collected for further analysis 10 Veerendra Sharma et al.
- 27. 13. 48 h after infiltration of a Lbu-Cas13a vector, follow Subhead- ing 3.3, steps 7–13 to infiltrate A. tumefaciens containing TuMV-GFP. A. tumefaciens carrying TuMV-GFP should be delivered at an OD600 of 0.3 (see Note 13). 3.4 Visualizing Virus Infection To assess the effect of Lbu-Cas13a and crRNA expression on TuMV-GFP infection, the agroinfiltrated leaves are visualized using a hand-held UV lamp (see Note 17). Keep the plant in dark and illuminate the infiltrated leaf with UV light and capture the GFP fluorescence with a digital camera. 1. Hang a dark cloth along a wall or bench. 2. Position the plant so that the abaxial side of the infiltrated leaf can be photographed. 3. Uniformly illuminate the infiltrated leaf with the UV light. As TuMV is expressing GFP, bright green fluorescence can be seen with the naked eye in the areas expressing TuMV-GFP. The rest of the leaf will be red to purple due to chloroplast auto- fluorescence (Fig. 3a). The infiltrated area expressing Lbu-- Cas13a + HCPro-crRNA should have significantly less GFP fluorescence than the area infiltrated the Lbu-- Cas13a + Empty-crRNA vector (Fig. 3a, b). Leaf One Lbu-Cas13a + Empty-crRNA Lbu-Cas13a + HCPro-crRNA Leaf Two 1 2 1 2 0.00 0.25 0.50 0.75 1.00 a b 1: Lbu-Cas13a + Empty-crRNA TuMV quantification normalized to host EF1a expression 2: Lbu-Cas13a + HCPro-crRNA Fig. 3 TuMV accumulation is significantly reduced in the presence of Cas13a with a crRNA targeting the virus. (a) Photographs of N. benthamiana leaves visualized under UV light. Leaf One and Leaf Two are replicates showing the effect of targeting the TuMV-GFP virus with Lbu-Cas13a. The regions of agroinfiltration are outlined by a white dashed line. The two regions labeled with a 1 were infiltrated with the Lbu-Cas13a vector carrying an Empty-crRNA, while the regions marked with a 2 were infiltrated with the Lbu-Cas13a vector carrying the HCPro-crRNA targeting the TuMV genome. Both samples expressing the TuMV-targeting crRNA show less GFP fluorescence, indicating less virus accumulates in the samples. (b) Quantitative assessment of TuMV accumulation from leaf samples expressing Lbu-Cas13a and either the Empty-crRNA or the HCPro- crRNA targeting TuMV. The expression values were normalized to N. benthamiana EF1a and TuMV levels in the Empty-crRNA sample was set to 1 Cas13a RNA-Targeting in Plants 11
- 28. 3.5 qPCR for Virus Quantification 1. Collect leaf tissue corresponding to the area where A. tumefaciens was infiltrated. The area marked at the time of infiltration serves as a guide. Add the tissue to a 2.0 mL screw top tube containing 4–6 2.3 mm beads. Immediately flash- freeze the samples in liquid nitrogen (see Note 18). Samples can be stored at 80 C until ready to extract RNA. 2. Remove the samples from liquid nitrogen and place in a chilled holder. Quickly unscrew the tops and add 1 mL of TRIzol to the frozen sample. Secure the cap back on the tube (see Note 19). 3. Place samples in the Bead Ruptor Elite, secure the lid and run the machine at speed 5, for 2 cycles of 30 s. Immerse the samples in liquid nitrogen between grinding cycles to ensure they remain frozen. 4. Spin tubes at 12,000 g for 10 min at 4 C to remove beads and tissue debris. Transfer supernatant to new 2.0 mL tubes. 5. Add 0.2 mL chloroform for each 1.0 mL of TRIzol added and mix vigorously for 15 s. Incubate samples for 5 min at RT (see Note 20). 6. Spin tubes at 12,000 g for 15 min at 4 C and carefully transfer the upper layer to a new tube (see Note 21). 7. Add 0.5 mL isopropanol to tubes, mix well and incubate at RT for 10 min. Spin tubes at 12,000 g for 30 min at 4 C. 8. Discard supernatant and wash the pellet with 75% ethanol. Spin at 12,000 g for 10 min and discard the supernatant. Remove remaining ethanol with the help of pipetting and dry the pellet at room temperature for 5–10 min. 9. Add 70 μL of RNase free water to the samples and incubate at 55–60 C for 10 min to dissolve the pellet. 10. Quantify RNA samples using NanoDrop ND1000. Addition- ally, check the integrity of the RNA samples by separating 1.0 μg of RNA on a 1.2% agarose gel (see Note 22). Store samples at 80 C until further analysis. 11. Use 1.0 μg of total RNA and treat with 1.0 μL Turbo DNase in 1 Turbo DNase buffer in 10 μL final volume and incubate at 37 C for 30 min. 12. Add 2.0 μL of DNase inactivation reagent and incubate at room temperature for 5 min with occasional mixing. 13. Spin tubes at 10,000 g for 5 min. Carefully transfer the supernatant ~10 μL to new tubes without disturbing inactiva- tion beads. 14. Add 1.0 μL of random hexamers (200 ng/μL) to DNase treated RNA, mix well by pipetting and incubate at 65 C for 5 min, immediately place samples on ice. 12 Veerendra Sharma et al.
- 29. 15. Add 1.0 μL of 10 mM dNTPs, 4.0 μL of 5 First-Strand Buffer, 1.0 μL of RNaseOUT (40 U/μL), 2.0 μL of 0.1 M DTT mix well and incubate at room temperature for 2 min. Add 1.0 μL of SuperScript II Reverse transcriptase, mix well by pipetting and spin briefly. 16. Incubate samples at room temperature for 10 min and then incubate at 42 C for 50 min, followed by incubation at 70 C for 15 min to inactivate SuperScript II reverse transcriptase. Chill samples on ice and proceed to qPCR analysis. Alterna- tively, cDNA can be store at 20 C for weeks or 80 C for months. 17. Dilute an aliquot of cDNA three times with nuclease free water for qPCR analysis. 18. For qPCR analysis using three biological replicates and two qPCR technical replicates for each sample primer pair, calculate the number of reactions using following equation: Total number of reactions ¼ Total number of treatments 3biological replicates 2technical replicates number of reactions for a primer pair number of primer pairs 19. Prepare the master mix for the total number of calculated reactions. A separate master mix is prepared for each primer pair (i.e., target gene and reference gene). Add and mix all the components except for cDNA as detailed in Table 4 (see Note 23). 20. Aliquot 38 μL of master mix in separate tubes for each cDNA sample and add 2.0 μL of cDNA template to the corresponding tubes, mix several times by pipetting, briefly spin and pipette 20 μL of each reaction mixture into two wells of microplate, which corresponds to two technical replicates. Complete the plate setup for all the samples (see Note 24). 21. Cover the microplate with microplate sealing tape and spin the plate briefly to ensure samples are at the bottom of the wells. Table 4 Components for qPCR Master Mix Components Volume (μL) qPCR master mix (2) 10.0 cDNA 1.0 Forward primer (10 μM) 1.0 Reverse primer (10 μM) 1.0 Nuclease-free water 7.0 Final volume 20.0 Cas13a RNA-Targeting in Plants 13
- 30. 22. Insert the covered plate containing the reaction mixtures into the thermocycler and perform qPCR using the cycling condi- tions specified in Table 5 (see Note 24). 4 Notes 1. The coding sequence for Lbu-Cas13a was optimized on IDT website using Codon Optimization Tool (www.idtdna.com/ CodonOpt) to be expressed in plant system. 2. CaMV 35S promoter was used to drive the Lbu-Cas13a gene expression with HSP18 terminator downstream of the coding sequence. The choice of promoter for Cas13a should be con- sidered depending on the users system and desired expression pattern. 3. The synthesized DNA fragment including CaMV 35S pro- moter, optimized coding sequence for Lbu-Cas13a and HSP18 terminator should additionally contain 30 base pairs of DNA sequence overlapping with the linearized pGWB413 vector. 4. The use of primers Cas13a-F and Cas13a-R and digestion by KpnI and PspOMI is based on the Lbu-Cas13a sequence used here. Different coding sequences require appropriate primer design and restriction enzymes. 5. crRNA adaptor includes U6 promoter, direct repeat specific to Lbu-Cas13a protein, BsaI cloning sites for insertion of guide/ spacer complementary to the gene targeting site, and TTTTT downstream of the cloning sites as transcription termination signal (Fig. 1c). For different Cas13a proteins, the direct repeat needs to be changed accordingly. 6. BsaI is one of many type IIS restriction enzymes, commonly used in Golden Gate cloning. Other type IIS restriction Table 5 Three step amplification program for thermocycler during qPCR Number Steps Temperature Duration 1 Initial incubation 50 C 2 min 2 Enzyme activation 95 C 2 min 3 Denaturation 95 C 15 s 4 Annealing 52 C 15 s (39 cyclesa ) 5 Extension 72 C 45 s a At the end of each cycle, set the thermocycler camera to capture the fluorescent signal for each well 14 Veerendra Sharma et al.
- 31. enzymes, such as BaeI could be used but needs to be designed with the entire cloning process in mind to achieve compatibility between vectors. 7. For guide RNA, the length of spacer sequence and the target- ing site of choice need to be optimized regarding specific Cas13a and the target gene. The PFS (protospacer flanking sequence) of the targeting site might be a consideration during the guide RNA designing based on the functional property of Cas13a [7, 14]. In this method, we used 28 bp region of HCPro with flanking T downstream of the targeting site. To synthesize the guide RNA, the top strand of the guide RNA needs to be reverse complementary to the targeting site. 8. We have observed significant target mRNA reduction com- pared to empty guide control when expressing some guide crRNA in the absence of Cas13. That is, some guide crRNA have been observed to produce Cas13-independent target mRNA interference. Care should be taken to include a negative control agroinfiltration expressing the guide crRNA without Cas13. 9. Larger volume of water in a beaker for boiling is acceptable. After boiling for 5 min, turn off the hotplate and leave the beaker on the hotplate. Let the water cool gradually to room temperature for 3 h or overnight. Alternatively, oligo annealing can also be performed on a thermocycler with 95 C for 5 min and then ramp down to 25 C with rate of 0.1 C/s. 10. This method uses gateway LR Clonase enzyme mix to perform the LR recombination reaction. If gateway LR Clonase II is used, skip the 5 reaction buffer as it is included in the LR Clonase II enzyme mix. 11. Do not touch or handle liquid nitrogen with your bare hand, it can burn your skin. Use forceps or protect your hands with thick gloves. 12. If you already have a glycerol stock of the desired A. tumefaciens, prepare a fresh streak. It is important to use A. tumefaciens from plates that are not older than 7 days. Older plates should be discarded and fresh A. tumefaciens should be re-streaked. This is necessary to maintain efficient plant infec- tion and delivery of the transgene. 13. A. tumefaciens cultures should be grown to the log phase, which can be approximated to occur around OD600 of 0.8–1.2. Overgrown cells lose competency to deliver the gene of interest. In case of A. tumefaciens strain GV3101, 20 h of growth is optimal. To analyze the effect of Lbu-Cas13a mediated silencing of TuMV-GFP, the OD600 ratio of effec- tor:target is 1.0:0.3. We have observed that infiltrating Lbu-Cas13a constructs before infiltrating TuMV-GFP Cas13a RNA-Targeting in Plants 15
- 32. significantly increases Cas13a-mediated reduction of TuMV- GFP. Additionally, the ratio of effector (Lbu-Cas13a and crRNA) and target (TuMV-GFP) impacts the amount of target mRNA reduction observed. These details should be considered depending on the experiment. 14. During agroinfiltration, care should be taken to avoid damag- ing the leaves. It is common to have dead plant cells at the site where the syringe contacts the leaves, but too much damage can compromise the infiltration. 15. To avoid cross contamination between A. tumefaciens strains carrying different vectors during infiltration, it is important to disinfect one’s gloves with 70% ethanol or change gloves before handling different constructs. 16. It is important to mark the boundary of agro-infiltrated area during the infiltration of Lbu-Cas13a constructs. For the sec- ond infiltration with TuMV-GFP, try to overlap the infiltrated area as much as possible. Virus infiltration that extends beyond the region of Lbu-Cas13a infiltration will not have virus reduc- tion. Care should be taken to mark these areas to aid in later tissue collection. 17. High-intensity UV light is hazardous to unprotected eyes. Always wear protective glasses while working with a UV light source. Capturing images of GFP fluorescence in a low light setting requires longer exposure times with the camera set- tings. Take care to equally shine the UV lamp across the leaf surface. 18. To obtain high quality intact RNA from leaf tissues, it is important to avoid excessive handling and damage to the tissue during sample collection. Collected leaf tissue should be imme- diately frozen in liquid nitrogen. During the grinding process, the tissue should be kept frozen to avoid RNA degradation. 19. This is considered “wet” grinding, in which the samples are ground in the presence of TRIzol. It is also possible to perform “dry” pulverization depending on the researchers needs and equipment. The critical point is to not let the samples thaw during grinding. Additionally, the bead beater can be placed in a cold room to minimize sample-heating and samples can be placed back into liquid nitrogen between rounds of bead beating. 20. TRIzol and chloroform are hazardous chemicals. Always work in a fume hood while handling TRIzol and chloroform and follow proper hazardous chemical disposal. 21. While transferring the upper phase containing RNA to new tubes it is important to avoid the interphase which contains unwanted molecules and chloroform. 16 Veerendra Sharma et al.
- 33. 22. A 260/280 ratio of 2.0 is an indicator of good quality RNA. The integrity of RNA samples should be checked on agarose gel before proceeding for cDNA synthesis. On a 1.5% agarose gel, the two bands corresponding to the largest size should be sharp and bright. These correspond to intact 28S and 18S ribosomal RNA. Additional bands can also be seen, but they should not be smeared. Smeared bands or weak 28S and 18S bands indicates the samples have undergone RNA degradation. 23. To account for pipetting error during qPCR, it is advisable to prepare master mix with two additional reactions added. Care should be taken to minimize pipetting variation and mixing variation. It is advisable to always mix the components the same number of times (i.e., 10) and to pipette using the same stopping point (i.e., the first stopping point, do not push pipette plunger all the way down). qPCR is sensitive to changes in handling and pipetting and minimizing variation between samples will help ensure robust results. 24. Always make a replica qPCR microplate layout on paper to keep track of your samples while setting up qPCR plate. 25. The qPCR profile for your target gene and housekeeping gene may vary depending upon the primer specifications and should be standardized before performing qPCR. Acknowledgments Funding related to the development of this protocol is provided to DEC by the Defense Advanced Research Projects Agency (DARPA) through a Young Faculty Award (DP17AP00034). The content does not necessarily reflect the position or the policy of the Government and does not imply an official endorsement. References 1. Čermák T, Baltes NJ, Čegan R et al (2015) High-frequency, precise modification of the tomato genome. Genome Biol 16:232. https:/ /doi.org/10.1186/s13059-015-0796- 9 2. Xie K, Minkenberg B, Yang Y (2015) Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proc Natl Acad Sci U S A 112:3570–3575. https:/ /doi.org/10.1073/pnas.1420294112 3. Tang X, Lowder LG, Zhang T et al (2017) A CRISPR-Cpf1 system for efficient genome editing and transcriptional repression in plants. Nat Plants 3:17103. https:/ /doi.org/10. 1038/nplants.2017.103 4. Qi LS, Larson MH, Gilbert LA et al (2013) Repurposing CRISPR as an RNA-guided plat- form for sequence-specific control of gene expression. Cell 152:1173–1183. https:/ /doi. org/10.1016/j.cell.2013.02.022 5. Baltes NJ, Voytas DF (2015) Enabling plant synthetic biology through genome engineer- ing. Trends Biotechnol 33:120–131. https:/ / doi.org/10.1016/j.tibtech.2014.11.008 6. Sadhu MJ, Bloom JS, Day L et al (2018) Highly parallel genome variant engineering with CRISPR-Cas9. Nat Genet 50:510–514. https:/ /doi.org/10.1038/s41588-018-0087- y Cas13a RNA-Targeting in Plants 17
- 34. 7. Abudayyeh OO, Gootenberg JS, Konermann S et al (2016) C2c2 is a single-component pro- grammable RNA-guided RNA-targeting CRISPR effector. Science 353:aaf5573. https:/ /doi.org/10.1126/science.aaf5573 8. East-Seletsky A, O’Connell MR, Knight SC et al (2016) Two distinct RNase activities of CRISPR-C2c2 enable guide-RNA processing and RNA detection. Nature 538:270–273. https:/ /doi.org/10.1038/nature19802 9. Rauch S, He C, Dickinson BC (2018) Targeted m6 A reader proteins to study Epitranscrip- tomic regulation of single RNAs. J Am Chem Soc 140:11974–11981. https:/ /doi.org/10. 1021/jacs.8b05012 10. Cox DBT, Gootenberg JS, Abudayyeh OO et al (2017) RNA editing with CRISPR- Cas13. Science 358:1019–1027. https:/ /doi. org/10.1126/science.aaq0180 11. East-Seletsky A, O’Connell MR, Burstein D et al (2017) RNA targeting by functionally orthogonal type VI-A CRISPR-Cas enzymes. Mol Cell 66:373–383.e3. https:/ /doi.org/10. 1016/j.molcel.2017.04.008 12. Konermann S, Lotfy P, Brideau NJ et al (2018) Transcriptome engineering with RNA-targeting type VI-D CRISPR effectors. Cell 173:665–676.e14. https:/ /doi.org/10. 1016/j.cell.2018.02.033 13. O’Connell MR (2018) Molecular mechanisms of RNA targeting by Cas13-containing type VI CRISPR-Cas systems. J Mol Biol 431 (1):66–68. https:/ /doi.org/10.1016/j.jmb. 2018.06.029 14. Smargon AA, Cox DBT, Pyzocha NK et al (2017) Cas13b is a type VI-B CRISPR-asso- ciated RNA-guided RNase differentially regu- lated by accessory proteins Csx27 and Csx28. Mol Cell 65:618–630.e7 15. Yan WX, Chong S, Zhang H et al (2018) Cas13d is a compact RNA-targeting type VI CRISPR effector positively modulated by a WYL-domain-containing accessory protein. Mol Cell 70:327–339.e5. https:/ /doi.org/ 10.1016/j.molcel.2018.02.028 16. Garcia-Ruiz H, Carbonell A, Hoyer JS et al (2015) Roles and programming of Arabidopsis ARGONAUTE proteins during turnip mosaic virus infection. PLoS Pathog 11:1–27. https:/ / doi.org/10.1371/journal.ppat.1004755 17. Aman R, Ali Z, Butt H et al (2018) RNA virus interference via CRISPR/Cas13a system in plants. Genome Biol 19:1. https:/ /doi.org/ 10.1186/s13059-017-1381-1 18. Lellis AD, Kasschau KD, Whitham SA, Car- rington JC (2002) Loss-of-susceptibility mutants of Arabidopsis thaliana reveal an essential role for elF(iso)4E during potyvirus infection. Curr Biol 12:1046–1051. https:/ / doi.org/10.1016/S0960-9822(02)00898-9 18 Veerendra Sharma et al.
- 35. Chapter 2 Strand-Specific RNA-Seq Applied to Malaria Samples Xueqing Maggie Lu and Karine Le Roch Abstract Over the past few years only, next-generation sequencing technologies became accessible and many applications were rapidly derived, such as the development of RNA-seq, a technique that uses deep sequencing to profile whole transcriptomes. RNA-seq has the power to discover new transcripts and splicing variants, single nucleotide variations, fusion genes, and mRNA levels-based expression profiles. Preparing RNA-seq libraries can be delicate and usually obligates buying expensive kits that require large amounts of stating materials. The method presented here is flexible and cost-effective. Using this method, we prepared high-quality strand-specific RNA-seq libraries from RNA extracted from the human malaria parasite Plasmodium falciparum. The libraries are compatible with Illumina® ’s sequencers Genome Ana- lyzer and Hi-Seq. The method can however be easily adapted to other platforms. Key words Strand-specific RNA-seq, High-throughput sequencing, Malaria, Plasmodium falci- parum, Splicing variant discovery, Transcript discovery 1 Introduction The advent of high throughput sequencing technologies marked the beginning of a new era for whole genome analysis. The cost for sequencing a genome dropped considerably over the past 5 years, a revolution for labs focusing on genome mining. Applications were rapidly derived, applying deep sequencing to various “omics” such as the development of RNA-seq to analyze whole transcriptomes. Where microarray-based techniques proved to be powerful tools in exploring gene expression profiles, RNA-seq has the power to establishing expression profiles in a more quantitative manner and to discover new transcripts and splicing variants, single nucleotide variations, and fusion genes at the single-base resolution. The dark side of the application is the considerable amount of complex computations that accompany RNA-seq. In addition, where pre- paring gDNA libraries is robust and affordable, with a wide range of reagent options on the market, preparing RNA-seq libraries is more expensive and can be more challenging. Hailing Jin and Isgouhi Kaloshian (eds.), RNA Abundance Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2170, https://doi.org/10.1007/978-1-0716-0743-5_2, © Springer Science+Business Media, LLC, part of Springer Nature 2021 19
- 36. Here we present a method that has the double advantage to use reagents originally designed for genomic DNA library preparation and to ultimately provide strand-specific information that simplifies downstream analysis. The described method is used to prepare, in a flexible and cost-effective manner, high quality libraries from small amounts of RNA extracted from the human malaria parasite Plas- modium falciparum to be sequenced on Illumina® ’s sequencers Genome Analyzer and Hi-Seq. It can however be adapted to a wide array of other organisms and platforms. 2 Materials All materials and reagents must be molecular biology grade and nuclease-free. All solutions must be freshly prepared before each experiment. Lab benches and pipettes must be clean. The regular use of cleaning solutions such as RNaseZap® (Ambion) is recom- mended. Nuclease-free barrier tips should be used at all times. Always wear gloves and change them often. After tissue homogeni- zation, samples should always be kept on ice. Using non-stick (low retention) RNase-free tubes and tips can be beneficiary when work- ing with low amounts of RNA. 1. Parasite cultures grown in complete RPMI medium at 5% hematocrit (see Note 1). 2. TRIzol® LS Reagent (Invitrogen™) pre-warmed at 37 C. 3. Chloroform. 4. Isopropanol pre-chilled on ice. 5. Nuclease-free non-DEPC water. 6. DNAse I RNAse-free (Ambion® ). 7. Deionized formamide. 8. Formaldehyde 37%. 9. 10 MOPS EDTA buffer pH 7.0. 10. Glycerol 50%. 11. Bromophenol blue powder. 12. Ethidium bromide 20 mg/mL. 13. GenElute™ mRNA Miniprep Kit (Sigma-Aldrich). 14. 5 RNA storage solution (Ambion). 15. HPLC-purified random hexamers and Anchored OligodT(20). 16. SuperScript® VILO™ cDNA synthesis kit (Invitrogen™). 17. DNA Clean Concentrator™ (Zymo Research). 18. 5 First Strand Buffer (Invitrogen™): 250 mM Tris–HCl (pH 8.3), 375 mM KCl, 15 mM MgCl2. 20 Xueqing Maggie Lu and Karine Le Roch
- 37. 19. 5 Second Strand Buffer (Invitrogen™): 100 mM Tris–HCl (pH 6.9), 450 mM KCl, 23 mM MgCl2, 0.75 mM β-NAD+ , 50 mM (NH4)2SO4. 20. Set of dATP, dGTP, dCTP, and dUTP. 21. E. coli DNA Polymerase I 10 U/μL (Invitrogen™). 22. E. coli DNA Ligase 10 U/μL (Invitrogen™). 23. E. coli DNA RNase H 2 U/μL (Invitrogen™). 24. 0.1 M DTT. 25. dsDNA Shearase™ (Zymo Research). 26. Encore™ NGS Library System I (NuGEN® ). 27. Same-day 70% ethanol in nuclease-free water. 28. USER™ Enzyme (New England Biolabs® ). 29. 1 TE buffer pH 8.0. 3 Methods 3.1 Total RNA Extraction from Parasite Cultures 1. Spin down the cultures at 700 g for 5 min with brake level set at the minimum. Aspirate off the supernatant. 2. Add 5 volumes of pre-warmed TRIzol® LS (37 C) and mix thoroughly to dissolve all clumps (see Note 2). 3. Incubate at 37 C for 5 min to ensure the complete de-proteinization of nucleic acids. 4. Stopping point: the samples can be stored at 80 C until further processing. They must be thawed on ice before resum- ing the protocol. 5. Keep the samples on ice. For each 5 mL of TRIzol® LS that was used in step 2, add 1 mL of chloroform and vortex for 1 min. 6. Centrifuge at 12,000 g for 30 min at 4 C. 7. Carefully transfer the upper aqueous layer to a fresh tube (see Note 3) and add 0.8 volume of prechilled isopropanol to precipitate the RNA. Mix carefully by inverting. 8. Stopping point: the tubes can be stored at 20 C overnight until further processing. Their temperature must be equili- brated on ice for a few minutes before resuming the protocol (see Note 4). 9. Mix by inverting and centrifuge at 12,000 g for 30 min and 4 C. Carefully aspirate off the supernatant. 10. Allow the pellet to air-dry on ice for 5 min and add 30–100 μL of RNase-free non-DEPC treated water. 11. Heat tubes at 60 C for 10 min and then place on ice. Malaria Strand-Specific RNA-Seq 21
- 38. 3.2 DNase Treatment 1. To 100 μL of RNA solution add 11.3 μL of 10 DNase I Buffer and 2 μL (4 U) of DNase I (2 U/μL). 2. Incubate the tube at 37 C for 30 min. 3. Inactivate the DNAse at room temperature for 5 min in the presence of 1 mM EDTA. Transfer the tube on ice. 4. Stopping point: RNA solutions can be aliquoted and stored at 80 C. When needed, thaw tubes on ice. Avoid repeated freeze/thaw cycles. 3.3 Verification of the Quality and the Quantity of Total RNA 1. Quantify the concentration of the total RNA solution by UV spectrophotometry, such as a NanoDrop (Thermo Scientific). Typically, a clean solution of nucleic acid in nuclease-free water has an OD ~ 1.85. A ratio ranging from 1.8 to 2.2 is therefore recommended. 2. Check RNA integrity by agarose gel electrophoresis (see Notes 5 and 6). 3. If genomic DNA is visible on the gel repeat the DNase treat- ment (see Note 7). 4. Verify the absence of trace amounts of genomic DNA by 40 cycles of PCR on a chosen control gene using 50–500 ng of total RNA solution. Repeat the DNase treatment if necessary. 5. Stopping point: Store the total RNA solution at 80 C. 3.4 Purification of polyA+ mRNA from Total RNA This protocol uses the reagents from the GenElute™ mRNA Mini- prep Kit (Sigma-Aldrich). Before starting, equilibrate a heating block for microcentrifuge tubes at 70 C. Keep the elution solution at 70 C. If the beads were kept at 4 C let them sit on the bench top for at least 15 min. Cold beads reduce yields. 1. Thaw the total RNA sample on ice. The amount of starting material should be 150–500 μg of purified total RNA. The remaining steps are performed at room temperature unless specified otherwise. 2. Adjust volume of total RNA to 250 μL with RNase-free water. Add 250 μL of 2 binding solution and vortex briefly. 3. Add 15 μL of oligo(dT) polystyrene beads and vortex thoroughly. 4. Heat the mixture at 70 C for 3 min to denature the RNA and let it cool down for 10 min at room temperature. 5. Centrifuge 2 min at maximum speed (14,000–16,000 g) in a tabletop microcentrifuge. Carefully pipette off the supernatant without disturbing the bead pellet (see Note 8). 22 Xueqing Maggie Lu and Karine Le Roch
- 39. 6. Add 500 μL of wash solution mix by vortexing. Transfer the mixture to a GenElute spin filter/collection tube assembly. Failure to transfer all traces of mixtures will result in lower mRNA yields. 7. Centrifuge 1 min at maximum speed (14,000–16,000 g) in a tabletop microcentrifuge. Discard the flow-through and place the collection tube back on the GenElute spin filter. 8. Add 500 μL of Wash Solution onto the GenElute spin filter and centrifuge 2 min at maximum speed. Transfer the GenElute spin filter to a fresh nuclease-free microcentrifuge tube. 9. Add 50 μL of elution solution heated at 70 C onto the center of the GenElute spin filter and incubate 5 min at 70 C. Cen- trifuge 1 min at maximum speed. 10. Repeat step 10 for a second elution. 11. Check the mRNA quantity by UV spectrometry. Expect 1.5 to 2.5% of the starting amount total RNA, depending on the considered morphological stage of the parasite. 12. Stopping point: The mRNA solutions can be stored at 80 C. When needed, thaw tubes on ice. Avoid repeated freeze/thaw cycles. 3.5 Fragmentation of the polyA+ mRNAs 1. Reduce sample volume to 15–20 μL in a vacuum concentrator type SpeedVac® without heating. Do not let the sample dry. 2. Add 4 volumes of 5X RNA storage solution and incubate for 40 min at 98 C (see Note 9). 3. Reduce sample volume to 10 μL in a vacuum concentrator without heating. Do not let the sample dry. 4. Stopping point: The mRNA solutions can be stored at 80 C. When needed, thaw tubes on ice. Avoid repeated freeze/thaw cycles. 3.6 First Strand cDNA Synthesis First strand cDNA is synthesized using the SuperScript® VILO™ cDNA synthesis kit (Invitrogen™). All reagents and buffers men- tioned in this section refer to elements of the kit. Frozen items should be kept on ice after thawing. 1. In a thin-wall nuclease-free 0.2 mL PCR-grade tube, mix 3 μg of random hexamers and 1 μg of Anchored oligodT(20) to the fragmented mRNA in 14 μL final volume (see Note 10). 2. Incubate the tube in a pre-heated thermal cycler at 70 C for 10 min and quickly chill on ice for 5 min. Do not reduce this time. 3. On ice, add the following reagents to the tube from step 2: 4 μL of 5 VILO™ Reaction Mix, 2 μL of 10 SuperScript® Enzyme Mix (see Note 11). If you prepare multiple samples at Malaria Strand-Specific RNA-Seq 23
- 40. the same time, make a master mix containing the 5 VILO™ Reaction Mix and the 10 SuperScript® Enzyme Mix and add 6 μL of it to each sample (see Note 12). 4. Gently mix the sample by flicking the bottom of the tube with fingertips. Spin, place on ice. 5. Incubate the sample in a thermal cycler using the following program: 25 C for 10 min, 42 C for 90 min, 85 C for 5 min, and hold at 4 C. 6. Remove promptly from the thermal cycler and place the tube on ice. 7. Purify first strand cDNA using the DNA Clean Concentra- tor™ (Zymo Research): (a) Add 100 μL of DNA Binding Buffer to the reaction mixture and mix well by pipetting up and down. (b) Transfer to a Zymo-Spin™ Column/collection tube assembly and centrifuge 30 s at maximum speed (14,000–16,000 g) in a tabletop microcentrifuge. Dis- card the flow-through. (c) Add 200 μL of wash buffer (freshly prepared with absolute ethanol, see Note 13). Centrifuge 30 s at maximum speed. (d) Discard the flow-through and repeat c. for a second wash. (e) Transfer the Zymo-Spin™ Column to a fresh nuclease- free microcentrifuge tube. (f) Pipet 20 μL of nuclease-free water to the column matrix and let stand 1 min. Centrifuge 30 s at maximum speed to elute the nucleic acid. (g) Repeat step f. 8. Adjust sample volume to 47 μL with non-DEPC nuclease-free water (see Note 14). 3.7 Second Strand cDNA Synthesis All reagents and buffers mentioned in this section should be made freshly. Frozen items should be kept on ice after thawing. 1. Prepare a dNTP mix containing dATP, dCTP, dGTP, and dUTP (instead of dTTP) each at 10 mM final concentration (see Note 15). 2. Chill all reagents on ice. 3. Set up the following reaction on ice and in the provided order: 24 Xueqing Maggie Lu and Karine Le Roch
- 41. First strand cDNA 47 μL 5 First strand buffer 2 μL 100 mM DTT 1 μL 5 Second strand buffer 15 μL 10 mM dNTP (w/dUTP) mix 4 μL E. coli DNA polymerase I 10 U/μL 4 μL E. coli DNA ligase 10 U/μL 1 μL E. coli RNase H 2 U/μL 1 μL 4. Mix gently by pipetting and incubate at 16 C for 2 h. 5. Chill the reaction on ice for at least 5 min. 6. Purify ds cDNA using the DNA Clean Concentrator™ (Zymo Research): (a) Add 375 μL of DNA binding buffer to the reaction mix- ture and mix well by pipetting up and down. (b) Transfer to a Zymo-Spin™ Column/collection tube assembly and centrifuge 30 s at maximum speed (14,000–16,000 g) in a tabletop microcentrifuge. Dis- card the flow-through. (c) Add 200 μL of wash buffer (freshly prepared with absolute ethanol, see Note 13). Centrifuge 30 s at maximum speed. (d) Discard the flow-through and repeat c. for a second wash. (e) Transfer the Zymo-Spin™ column to a fresh nuclease-free microcentrifuge tube. (f) Pipet 6 μL of nuclease-free water to the column matrix and let stand for 1 min. Centrifuge 30 s at maximum speed to elute the nucleic acid. (g) Repeat step f. 7. Check the ds cDNA quantity by UV spectrometry and quality by visualization on a 1.2% agarose gel electrophoresis. A smear should be easily detected (see Note 16). 8. Stopping point: The sample is now ds cDNA and is relatively stable. It can be stored at 20 C. When needed, thaw tubes on ice. Avoid repeated freeze/thaw cycles. 3.8 ds cDNA Fragmentation 1. Mix 700 ng of ds cDNA with 11.5 μL of 3 dsDNA Shear- ase™ reaction buffer and 3.5 μL of dsDNA Shearase™ (Zymo Research). Reach a final volume of 35 μL final with nuclease- free water. 2. Incubate at 37 C for 40 min (see Note 17). Malaria Strand-Specific RNA-Seq 25
- 42. 3. Purify ds cDNA and inactivate the dsDNA Shearase™ by add- ing 175 μL of the DNA Clean Concentrator™ DNA bind- ing buffer (Zymo Research). 4. Mix well by pipetting up and down and transfer to a Zymo- Spin™ column/collection tube assembly and centrifuge 30 s at maximum speed (14,000–16,000 g) in a tabletop microcen- trifuge. Discard the flow-through. 5. Add 200 μL of wash buffer (freshly prepared with absolute ethanol, see Note 13). Centrifuge 30 s at maximum speed. 6. Discard the flow-through and repeat step 5 for a second wash. 7. Transfer the Zymo-Spin™ column to a fresh nuclease-free microcentrifuge tube. 8. Pipet 10 μL of nuclease-free water to the column matrix and let stand 1 min. Centrifuge 30 s at maximum speed to elute the nucleic acid. 9. Repeat step 8. 10. Check the size range and the concentration of the sample using microfluidic-based separation devices suitable for small amounts of starting materials, such as an Agilent 2100 Bioa- nalyzer (Agilent Technologies) or a LabChip® GX (Caliper Life Sciences) (see Note 18). Repeat the fragmentation procedure if necessary. 11. Stopping point: The sample can be stored at 20 C. When needed, thaw tubes on ice. Avoid repeated freeze/thaw cycles. 3.9 Library Preparation The protocol described here uses the NuGEN® Encore™ NGS Library System I, compatible with the Illumina® Genome Analyzer and Hi-Seq sequencing platforms, and all mentioned reagents refer to components of this kit (see Note 19). However, since the start- ing material is double stranded DNA, it can be easily adapted to any gDNA library preparation kit (including multiplexing) or set of reagents. The Agencourt® magnetic beads used for sample cleanup must be incubated at room temperature for at least 15 min before use. Cold beads reduce yields. Before each use, beads must be fully resuspended by inverting and tapping the tube. Thaw all necessary reagents, mix by vortexing, spin, and keep them on ice until use. Keep the nuclease-free water at room temperature. 3.9.1 End Repair 1. Dilute 200 ng of fragmented ds cDNA to a volume of 7 μL with nuclease-free water in a 0.2 mL thin-wall nuclease-free PCR tube. Place on ice. 2. On ice, add 2.5 μL of End Repair Buffer Mix and 0.5 μL of End Repair Enzyme Mix to the sample and mix by pipetting up and down. If more than one sample is treated, prepare a master mix 26 Xueqing Maggie Lu and Karine Le Roch
- 43. of sufficient amounts of End Repair Buffer Mix and End Repair Enzyme Mix before adding 3 μL to each sample (see Note 12). 3. Place the tube in a pre-warmed thermal cycler (lid heated at 100 C) with the following program: 30 min at 25 C; 10 min at 70 C; hold at 4 C. 4. Remove the sample promptly from the thermal cycler, give a quick spin, and place on ice. 5. Resuspend Agencourt® RNAClean XP magnetic beads by inverting and tapping the tube on the bench top. Do not spin the tube. 6. Add 12 μL of the bead slurry to the sample and mix thoroughly by pipetting up and down. Incubate at room temperature for 10 min. 7. Transfer tubes to the magnetic separation device and let them stand for 5 min (see Note 20). 8. While still on the magnet, carefully pipet off 15 μL of liquid without disturbing the beads (see Note 21). Dispersion and loss of significant amounts of beads will reduce yields. 9. While still on the magnet, gently add 200 μL of freshly made 70% ethanol and let stand for 30 s (see Note 22). 10. While still on the magnet, remove 200 μL of the ethanol wash (see Note 23). 11. Repeat step 9. 12. While still on the magnet, remove all of the ethanol wash. Carefully inspect the tube for the absence of ethanol drops. 13. While still on the magnet, air-dry the beads for 5–10 min. Carefully inspect the tube to ensure the ethanol has entirely evaporated. 14. Remove from the magnet and add 12 μL of nuclease-free water to the dried beads. Resuspend carefully by pipetting up and down. 15. Transfer the tubes to the magnet and let them stand for 1 min. 16. While on the magnet, carefully remove 11 μL of the eluate without disturbing the beads and transfer to a fresh tube. 17. Repeat step 15 to minimize the carryover of beads into the next stage of the library preparation. 18. While on the magnet, carefully remove 10 μL of the eluate without disturbing the beads and transfer to a fresh nuclease- free thin-wall 0.2 mL PCR tube. Place on ice. 19. Proceed immediately to Subheading 3.9.2 (see Note 24). Malaria Strand-Specific RNA-Seq 27
- 44. 3.9.2 Ligation 1. On ice, add 1 μL of Adaptor Mix to the sample (see Note 25). Mix by pipetting thoroughly with the pipette set to 5 μL. 2. On ice, add 12.5 μL of Ligation Buffer Mix and 1.5 μL of Ligation Enzyme Mix to the sample (the Ligation Buffer Mix is very viscous and should be pipetted slowly). If more than one sample is treated, prepare a master mix of sufficient amounts of Ligation Buffer Mix and Ligation Enzyme Mix before adding 14 μL to each sample (see Note 12). 3. Carefully mix by pipetting slowly up and down without form- ing bubbles with the pipette set at 20 μL. Spin down the tube for 2 s. 4. Place the tube in a pre-warmed thermal cycler (lid not heated) with the following program: 10 min at 25 C; hold at 4 C. IMPORTANT : Use this incubation time to prepare the Amplification Master Mix to be used in the library amplifica- tion reaction (see Subheading 3.9.3, step 1). The adapter- ligated sample must not remain on ice more than 10 min from the end of the ligation reaction to the beginning of the amplification reaction. 5. Remove the sample promptly from the thermal cycler, give a quick spin, and place on ice. 6. Proceed immediately to Subheading 3.9.3. 3.9.3 Library Amplification 1. Prepare an Amplification Master Mix by sequentially mixing the following reagents: 64 μL of Amplification Buffer Mix, 3 μL of Amplification Primer Mix, 4 μL of DMSO (this mix should have been prepared during the incubation indicated at Subheading 3.9.2, step 4). Place tube on ice. If more than one sample is treated, adapt volumes to prepare a sufficient quantity of master mix. 2. On ice, add 3 μL of Amplification enzyme mix and 1 μL of USER™ enzyme to the Amplification Master Mix immediately before adding to the adapter-ligated sample (the USER™ enzyme will degrade the second strand of the ds cDNA prior amplification to achieve strand specificity, see Note 26). If more than one sample is treated, adapt volumes to prepare a sufficient quantity of master mix. 3. Mix well by pipetting slowly, avoiding bubbles, spin, and place on ice. 4. Add 73 μL of Amplification Master Mix to a clean 0.2 mL thin- wall nuclease-free PCR tube. 5. Add 7 μL of adapter-ligated sample to the tube prepared at step 4. Mix well by pipetting slowly up and down at the 73 μL pipette setting, avoiding bubbles, spin, and place on ice. The remaining adapter-ligated sample can be discarded. 28 Xueqing Maggie Lu and Karine Le Roch
- 45. 6. Place the tube in a pre-warmed thermal cycler (lid heated at 100 C) with the following program: 5 min at 95 C; 2 min at 72 C; 5 cycles of (30 s at 94 C—30 s at 55 C—1 min at 72 C); 10 cycles of (30 s at 94 C—30 s at 63 C—1 min at 72 C); 5 min at 72 C; hold at 10 C. 7. Remove the sample promptly from the thermal cycler, give a quick spin, and place on ice. 8. Resuspend Agencourt® RNAClean XP magnetic beads by inverting and tapping the tube on the bench top. Do not spin the tube. 9. Add 80 μL of the bead slurry to the amplified library and mix thoroughly by pipetting up and down (see Note 27). Incubate at room temperature for 10 min. 10. Transfer tubes to the magnetic separation device and let them stand for 5 min (see Note 20). 11. While still on the magnet, carefully pipet off 140 μL of liquid without disturbing the beads (see Note 21). Dispersion and loss of significant amounts of beads will reduce yields. 12. While still on the magnet, gently add 200 μL of freshly made 70% ethanol and let stand for 30 s (see Note 22). 13. While still on the magnet, remove 200 μL of the ethanol wash (see Note 23). 14. Repeat steps 12 and 13 two more times for a total of three washes. 15. While still on the magnet, remove all of the ethanol wash. Carefully inspect the tube for the absence of ethanol drops. 16. While still on the magnet, air-dry the beads for at 10–15 min. Carefully inspect the tube to ensure the ethanol has entirely evaporated. 17. Remove from the magnet and add 33 μL of 1 TE to the dried beads. Resuspend carefully by pipetting up and down. 18. Transfer the tubes to the magnet and let stand for 2 min. 19. While on the magnet, carefully remove 30 μL of the eluate without disturbing the beads and transfer to a fresh tube. Place on ice. 20. Stopping point: The amplified libraries can be stored at 20 C. When needed, thaw tubes on ice. Avoid repeated freeze/thaw cycles. 3.9.4 Qualitative and Quantitative Evaluation of the Library 1. Analyze 3 μL of the library on a 1.6% agarose gel electrophore- sis (see Note 28) and check the size and the purity of the library. Quantify by UV spectrophotometry. Malaria Strand-Specific RNA-Seq 29
- 46. 4 Notes 1. Typically, parasites are cultured in 25 mL total volume at 5% hematocrit until a parasitemia of 6–10% is reached. If a syn- chronization is performed (e.g., using sorbitol) make sure to let the parasites recover from the stress of the treatment, ideally wait for one cycle of invasion, before harvesting the RNAs. Waiting will minimize the background caused by stress-related variations. This RNA-seq protocol is typically prepared using four different cultures pooled together. 2. It is crucial to dissolve everything at this step for an optimal yield. 3. Do not transfer any of the lower phase to the next step. Phenol inhibits downstream enzymatic reactions including reverse transcription. 4. Tubes containing nucleic acids that were precipitated at 20 C or 80 C should always be allowed to equilibrate on ice before centrifugation. At these low temperatures the samples tend to become very viscous and the efficiency of centrifugation is lower. 5. Typically, 0.5–1 μg of total RNA should be loaded on a 1.2% agarose gel. Mix sample with 10 volumes of denaturing RNA loading buffer (for 1.5 mL stock loading buffer mix: 750 μL of deionized formamide, 240 μL of formaldehyde 37%, 150 μL of 10X MOPS EDTA buffer pH 7.0, 200 μL of 50% glycerol, 0.5 mg of bromophenol blue, and 10 μL of ethidium bromide 10 mg/mL) and heat for 5 min at 65 C. Ensure that all solutions and hardware, including electrophoresis tank and gel combs, are RNAse-free. The 28S and 18S rRNAs should appear as two clean bands around 5.3 and 2 kb, respectively. The upper band should be more intense. The presence of significant smearing or a lower intensity of the upper band indicates degradation of the extracted material. 6. If the purity of the RNA solution is questioned, e.g., presence of phenol, the samples can be further purified on RNeasy® (QIAGEN) cleanup columns according to the “RNA Cleanup” manufacturer’s protocol. All solutions must be fresh. 7. It is crucial to eliminate all contamination with genomic DNA in order to avoid competition in downstream reaction and inaccurate quantitative analysis of RNA levels or false discovery of alternative transcripts. 8. Any loss in beads will result in a loss of material. For maximum yield, about 50 μL of sample should remain in the tube after removing the supernatant. 30 Xueqing Maggie Lu and Karine Le Roch
- 47. 9. The efficiency of this step is directly linked to the amount of starting material. If desired, the incubation time can be adjusted accordingly but should not exceed 60 min. 10. A combination of random primers and oligos dT should always be used in experiments dealing with Plasmodium falciparum’s AT-rich genome to maximize the reverse transcription of all possible transcripts regardless of their GC content. 11. The 5 VILO™ Reaction mix already contains random pri- mers, MgCl2, and dNTPs. The 10 SuperScript® Enzyme Mix includes the SuperScript® III Reverse Transcriptase (reduced RNase H activity and high thermal stability for extended syn- thesis), the RNAseOUT™ Recombinant Ribonuclease Inhibi- tor, and a helper protein proprietary to Invitrogen™. 12. When dealing with multiple samples at the same time, the delay between the preparation of the first sample and the preparation of the last sample should be kept to a minimum to ensure uniformity. Do not prepare more than eight samples at a time. 13. As a general rule when using nucleic acid cleanup and purifica- tion reagents, buffers containing ethanol should always be as fresh as possible. Aging solutions can cause dramatic losses in material. 14. At that point, the samples can theoretically be frozen at 20 C until further processing. Empirical observations seem to indi- cate, however, that the performances are significantly increased when second strand cDNA is synthesized immediately after first strand. Therefore, we do not recommend the freezing of first strand cDNA. 15. The substitution of the dTTP by dUTP in the dNTP mix is critical in this protocol since it will allow using the USER™ (Uracil-Specific Excision Reagent) enzyme prior library ampli- fication and achieving strand specificity. The USER™ enzyme will leave a nucleotide gap at the location of a uracil in the second strand of the cDNA. 16. Obtaining high-quality ds cDNA is an absolute prerequisite for a successful preparation of a sequencing library. We recom- mend not proceeding if the ds cDNA is not of satisfactory quality (the presence of a regular smear on the gel and an OD 1.8 is an example of satisfactory quality). 17. These reaction conditions have been optimized to obtain frag- ments ranging 150 bp to 300 bp in size. Increase incubation time for shorter fragments, decrease it for longer ones. 18. Small amounts of nucleic acids cannot be detected by classical agarose gel electrophoresis. In order to avoid wasting large amounts of samples we recommend using microfluidic-based devices that can quantify and display the size distribution of a Malaria Strand-Specific RNA-Seq 31
- 48. few microliters of a sample concentrated in the picogram per microliter range. The Bioanalyzer DNA High Sensitivity Chip (Agilent Technologies) can resolve 3 μL of purified DNA at 5 μg/μL in TE for sizes ranging 50–7000 bp. The LabChip® GX can resolve bands as low as 5 bp and features a sensitivity of 0.1 ng/μL. 19. The NuGEN® Encore™ NGS Library System I uses magnetic beads (RNAClean® XP Purification Beads supplied in the kit) for the successive purification of the samples through the library preparation steps rather than silicate-based spin col- umns. Magnetic beads allows for minimized sample loss and reduction of input material for library preparation. A magnetic separation device, such as the Agencourt® SPRIStand, is thus necessary to perform the purification steps. When using the Agencourt® SPRIStand, 96-well plates or tube strips are pre- ferred rather than single tubes for greater stability in the stand and better separation. 20. Reduction in the incubation time of the beads on the magnetic stands will result in reduced recovery of the samples. Similarly, the various incubation times have been optimized to obtain reproducible results in terms of nucleic acid yield and size range. They must be strictly observed. 21. While on the magnet, the beads will stay on the walls of the tube and form a ring. Use a small volume pipette tip to reach the bottom of the tube without touching the sides and gently aspirate the desired volume. 22. If multiple samples are treated simultaneously, monitor the time spent in reaching the last tube and deduct it from the 30 s. 23. Always use the smallest volume pipette tip that allows the removal of the desired volume within 2 to 3 withdrawals. Do not try to get everything in one-step and pipet slowly to prevent any bead loss. 24. NuGEN® developed proprietary adapter and primer sequences directly compatible with the Illumina® Genome Analyzer and Hi-Seq systems. Their use differ from the more common Illu- mina® ones mostly in the fact that the step for 30 -end A-tailing of the fragments that is usually carried on prior adapter ligation is absent in the NuGEN® protocol. This specificity significantly reduces the hands-on time of the protocol. In addition, NuGEN® adapters generate libraries free from adaptor dimers, unlike Illumina® ’s adapters. 25. The adapters are partly complementary and provided partially annealed to each other. This condition is necessary for a suc- cessful ligation to the sample of interest. Make sure to always keep the tube of Adapter Mix on ice so that the adapter duplex does not denature. 32 Xueqing Maggie Lu and Karine Le Roch
- 49. 26. The USER™ (Uracil-Specific Excision Reagent) enzyme is added to the amplification mix. During a short denaturing step (5 min at 95 C) prior to the actual amplification cycles, the USER™ enzyme nicks the second strand of the ds cDNA at uracil locations. Only the first strand is amplified and strand specificity is achieved. 27. If multiple samples are processed at the same time, it may be useful to use a multi-channel pipette to ensure consistent incu- bation times. 28. A high percentage of agarose is necessary to resolve small libraries. Increasing the amount of agarose, however, signifi- cantly increases the detection threshold using intercalant agents such as ethidium bromide. Here, preparing a gel at 1.5–1.8% agarose is a good compromise between resolution and sensitivity. In addition, the use of low range agarose, such as the Certified Low Range Ultra Agarose (Bio-Rad), greatly improves the resolution of small bands without having to increase the agarose content. Acknowledgements The authors thank Courtney Brady (NuGEN® ), and Barbara Wal- ter, John Weger, Rebecca Sun, and Glenn Hicks (Institute for Integrative Genome Biology, University of California Riverside) for their assistance in the library preparation and sequencing processes. References 1. Le Roch KG et al (2003) Discovery of gene function by expression profiling of the malaria parasite life cycle. Science 301:1503–1508 2. Bozdech Z et al (2003) The transcriptome of the intraerythrocytic developmental cycle of Plasmo- dium falciparum. PLoS Biol 1:E5 3. Otto TD et al (2010) New insights into the blood-stage transcriptome of Plasmodium falciparum using RNA-Seq. Mol Microbiol 76:12–24 4. Sorber K, Dimon MT, DeRisi JL (2011) RNA-Seq analysis of splicing in Plasmodium fal- ciparum uncovers new splice junctions, alterna- tive splicing and splicing of antisense transcripts. Nucleic Acids Res 39:3820–3835 Malaria Strand-Specific RNA-Seq 33
- 50. Chapter 3 Laser Microdissection of Cells and Isolation of High-Quality RNA After Cryosectioning Marta Barcala, Carmen Fenoll, and Carolina Escobar Abstract Laser capture microdissection (LCM) has become a powerful technique that allows analyzing gene expression in specific target cells from complex tissues. Widely used in animal research, still few studies on plants have been carried out. We have applied this technique to the plant–nematode interaction by isolating feeding cells (giant cells; GCs) immersed inside complex swelled root structures (galls) induced by root-knot nematodes. For this purpose, a protocol that combines good morphology preservation with RNA integrity maintenance was developed, and successfully applied to Arabidopsis and tomato galls. Specifically, early developing GCs at 3 and 7 days post-infection (dpi) were analyzed; RNA from LCM GCs was amplified and used successfully for microarray assays. Key words Laser-capture microdissection, RNA isolation, Cryosectioning, Arabidopsis, Tomato, Galls, Root-knot nematode, Giant cells 1 Introduction Laser-capture microdissection (LCM) is a technique that allows harvesting specific cells from complex tissues or populations for specific RNA, DNA, or protein isolation [1, 2] so that they can be used in downstream applications such as microarray hybridiza- tion, cDNA library construction, proteomic analysis, etc. So far several laser-capture equipments have been developed by different companies [3]. We performed LCM with the PixCell II system (Arcturus), which allows isolating cells using a low-power (infrared) laser and retaining them in a thermoplastic film; as the laser radia- tion is absorbed by the film instead of by the cell samples, this procedure should preserve the integrity of the captured material. The technique is applied to tissue sections that can be prepared from either frozen or paraffin-embedded biological samples. In general, better morphology can be observed in paraffin-embedded tissues fixed with non-coagulating fixatives, whereas the use of coagulating fixatives (such as ethanol: acetic acid) for frozen tissues Hailing Jin and Isgouhi Kaloshian (eds.), RNA Abundance Analysis: Methods and Protocols, Methods in Molecular Biology, vol. 2170, https://doi.org/10.1007/978-1-0716-0743-5_3, © Springer Science+Business Media, LLC, part of Springer Nature 2021 35
- 51. renders higher RNA yield and quality [4]. Thus, a compromise between both good morphology and RNA preservation should be achieved. A few attempts to study specifically nematode feeding sites (NFS) have been carried out [5, 6]. The first report was based on micro-aspiration of the cytosolic content of tomato GCs [7], but this method could only be applied to large GCs at late differentia- tion stages. In contrast, LCM represented an advance as it permits precise NFS collection at any infection time as long as they can be identified in histological sections. The first reported NFS isolation by LCM was applied to syncytia induced by cyst nematodes [8]. We have developed a protocol to both preserve morphology and render high-quality RNA from GCs formed by root-knot nematodes at different developmental stages (3 and 7 days post-infection (dpi)) of either Arabidopsis or tomato. Briefly, this protocol consists of a mild fixation step with a non-crosslinking fixative, gall cryosection- ing, GCs LCM, and eventually RNA extraction. The RNA obtained by this protocol has been successfully used for microarray analysis. Safety handling measures to avoid RNA degradation are strongly recommended, such as always wearing gloves, preparing all the solutions with diethyl pyrocarbonate (DEPC)-treated deio- nized water and using RNase-free plastic and glassware. To prepare 0.1% DEPC-treated deionized water: add 1 ml DEPC to 1 l of deionized water (see Note 1) and stir overnight at room tempera- ture (RT) and autoclave it for 20 min at 121 C to destroy DEPC. 2 Materials 2.1 Tissue Fixation 1. Ethanol-acetic acid (EAA) fixative solution: 3 parts of absolute ethanol (molecular biology grade) and one part of glacial acetic acid (3:1 v/v). Prepare it in a conical tube or a glass bottle by mixing the ethanol and acetic acid and keep it tightly closed on ice. Only freshly made fixative solution should be used. 2. Microcentrifuge tubes. 3. Surgical blade in a scalpel with handle. 4. Pointed tip tweezers. 2.2 Cryoprotective Solutions 1. 0.01 M phosphate buffered saline solution (PBS), pH 7.4: 0.138 M NaCl, 2.7 mM KCl. Dissolve a pouch in 1 l of DEPC-water (see Note 2) and store at RT. 2. 10% sucrose in 0.01 M PBS pH 7.4. Add 5 g of sucrose to PBS for a final volume of 50 ml. Dissolve completely and store at 4 C (see Note 3). 3. 15% sucrose in 0.01 M PBS pH 7.4. Add 7.5 g of sucrose to PBS for a final volume of 50 ml. Dissolve completely and store at 4 C. 36 Marta Barcala et al.
- 52. 4. 34.3% sucrose in 0.01 M PBS pH 7.4. Add 17.25 g of sucrose to PBS for a final volume of 50 ml. Dissolve completely and store at 4 C. 5. 34.3% sucrose, 0.01% safranine-O dye, 0.01 M PBS pH 7.4. Prepare this solution by adding safranine-O from a 1000 stock to the previous solution. 6. 10% safranine-O (1000): weigh 100 mg of safranine-O and add it to 1 ml of 0.01 M PBS, pH 7.4. 7. Vacuum eppendorf concentrator 5301 (Eppendorf, Hamburg, Germany). 8. Orbital shaker. 2.3 Embedding and Cryosectioning 1. Embedding media: Tissue-TEK® , optimal cutting temperature grade (O.C.T) media (Sakura Finetek, AV Alphen aan den Rijn, The Netherlands). 2. Cryomoulds: mould disposable base of 7 7 5 mm (see Note 4). 3. 2-Isopentane (Methyl butane). 4. Liquid nitrogen. 5. Long forceps. 6. Poly-L-Lysine coated slides: Polysine® (BDH, Poole, UK). 7. Vertical glass staining jars. 8. Ethanol solutions: 70% and 95% Ethanol. 9. Xylene. 10. Desiccant (silica gel). 11. Cryostat with disposable blades and anti-roll device. We have developed the protocol using a Leica CM3050S cryostat (Leica Microsystems, Wetzlar, Germany). 2.4 Laser Capture Microdissection and RNA Extraction 1. PixCell II Laser Capture Microdissection system (Arcturus® , Life Technologies, California, USA). 2. CapSure® HS LCM caps (Arcturus). 3. ExtracSureTM Sample Extraction device (Arcturus). 4. Absolutely RNA Nanoprep kit (Stratagene, California, USA). 3 Methods 3.1 Tissue Fixation Unless otherwise specified, all the steps are carried out at 4 C by placing the microcentrifuge tubes on ice. 1. Clean the working surface and all metallic dissection instru- ments, such as the scalpel handle and the tweezers, with acetone. LCM of Cells from Cryosections and RNA Isolation 37
- 53. 2. Prepare aliquots with 1.5 ml of EAA fixative in as many micro- centrifuge tubes as needed (see Note 5), and let them cool down on ice. 3. Localize the galls and root pieces to dissect under a stereo microscope; open the plate containing the in vitro grown infected Arabidopsis plants and cover them with cool freshly made fixative EAA (see Note 6). Collect all the galls and control root pieces one by one, and transfer them into the fixative-filled tubes very quickly. Cut the samples carefully, leaving a small portion of root at both sides of the gall to facilitate sample handling with a pair of tweezers (i.e., when orienting the sample in the moulds). 4. To facilitate fixative infiltration apply vacuum to the samples for 15 min (see Note 7). Then gently swirl the tubes for 1 h (i.e., in a shaker at 70 rpm). 5. Replace the solution with fresh fixative; repeat the infiltration as in step 4 and swirl samples for 2 h (see Note 8). 6. Discard the fixative and add 10% sucrose in 0.01 M PBS pH 7.4 to each tube. Apply vacuum for 10 min and swirl the samples for 3 h as described in step 4. 7. Continue with the cryoprotective treatment by infiltrating samples successively in 15% sucrose in 0.01 M PBS pH 7.4, and 34.3% sucrose, 0.01% safranine-O, 0.01 M PBS pH 7.4 (see Note 9) as described in step 6. Swirl the samples for 3 h and overnight, respectively, as described in step 4. 8. Rinse the samples in 34.3% sucrose in 0.01 M PBS pH 7.4 to remove excess safranine-O dye immediately prior to embed- ding (see Note 10). 3.2 Embedding 1. Cool down isopentane almost to its freezing point by submer- sion in a liquid nitrogen bath (see Note 11) (Fig. 1a). 2. Label carefully the moulds. 3. Fill a mould with Tissue -Tek® O.C.T. compound, taking special care to avoid air bubbles. This prevents moulds from cracking during freezing and sectioning (see Note 12). 4. Carefully introduce a sample in the O.C.T. media and orient it with the tweezers. It is important to drain as much sucrose solution as possible from the sample (see Note 13). 5. Freeze the sample by immersing the entire mould in precooled isopentane for at least 20 s. Large samples will need longer immersion times. Long, wide open forceps are recommended as they facilitate handling the mould during submersion into the isopentane without disturbing sample orientation (Fig. 1a). O.C.T. will turn white upon freezing. 38 Marta Barcala et al.
- 54. 6. Transfer the mould to liquid nitrogen until you have finished freezing all the samples; then store the moulds at 80 C for later cryosectioning. 3.3 Cryosectioning and Laser Capture Microdissection 1. Let the cryostat cool down to 20 C (see Note 14). Then, place the samples inside and let them equilibrate to the cryostat temperature for at least 15 min. Also keep a staining jar filled with 70% ethanol inside the cryostat. Fig. 1 Some steps of the LCM process. (a) Custom-made setup for cooling isopentane in a liquid nitrogen bath. (b) Cryosections of Arabidopsis galls before (upper panels) and after (lower panel) dehydration. Giant cells are labeled by white asterisks. (c) LCM PixCell II instrument. (d) The LCM process, showing a CapSure® placed over a slide and the laser beam, an Arabidopsis root section after exposure to the laser beam, and the microdissected area captured onto a CapSure® LCM of Cells from Cryosections and RNA Isolation 39
- 55. Exploring the Variety of Random Documents with Different Content
- 56. women also, pray every day to the Great Spirit, and He has therefore been very kind to us. “My Friends,—We have been this day taken by the hand in friendship, and this gives us great consolation. Your friendly words have opened our ears, and your words of advice will not be forgotten. “My Friends,—You have advised us to be charitable to the poor, and we have this day handed you 360 dollars to help the poor in your hospitals. We have not time to see those poor people, but we know you will make good use of the money for them; and we shall be happy if, by our coming this way, we shall have made the poor comfortable. “My Friends,—We Indians are poor, and we cannot do much charity. The Great Spirit has been kind to us though since we came to this country, and we have given altogether more than 200 dollars to the poor people in the streets of London before we came here; and I need not tell you that this is not the first day that we have given to the poor in this city. “My Friends,—If we were rich, like many white men in this country, the poor people we see around the streets in this cold weather, with their little children barefooted and begging, would soon get enough to eat, and clothes to keep them warm. “My Friends,—It has made us unhappy to see the poor people begging for something to eat since we came to this country. In our country we are all poor, but the poor all have enough to eat, and clothes to keep them warm. We have seen your poorhouses, and been in them, and we think them very good; but we think there should be more of them, and that the rich men should pay for them. “My Friends,—We admit that before we left home we all were fond of ‘fire-water,’ but in this country we have not drunk it. Your words are good, and we know it is a great sin to drink it. Your words to
- 57. us on that subject, can do but little good, for we are but a few; but if you can tell them to the white people, who make the ‘fire- water,’ and bring it into our country to sell, and can tell them also to the thousands whom we see drunk with it in this country, then we think you may do a great deal of good; and we believe the Great Spirit will reward you for it. “My Friends,—It makes us unhappy, in a country where there is so much wealth, to see so many poor and hungry, and so many as we see drunk. We know you are good people, and kind to the poor, and we give you our hands at parting; praying that the Great Spirit will assist you in taking care of the poor, and making people sober. “My Friends,—I have no more to say.” Temperance medals were then given to each of the Indians, and the deputation took leave. A council was held that evening in the Indians’ apartments, and several pipes smoked, during which time the conversation ran upon numerous topics, the first of which was the interesting meeting they had held that day, and on several former occasions, with the Friends, and which good people they were about to leave, and they seemed fearful they should meet none others in their travels. They were passing their comments upon the vast numbers which Daniel and Bobasheela had told them there actually were of poor people shut up in the poorhouses, besides those in the streets, and underground in the coal-pits; and concluded that the numerous clergymen they had to preach to them, and to keep them honest and sober, were not too many, but they thought they even ought to have more, and should at least keep all they had at home, instead of sending them to preach to the Indians. Jim was busy poring over his note-book, and getting Daniel to put down in round numbers the amount of poor in the poorhouses and in the streets, which they had found in some newspaper. And he was anxious to have down without any mistake the large sum of money they had presented to the hospitals,
- 58. so that when they got home they could tell of the charity they had done in England; and if ever they got so poor as to have to beg, they would have a good paper to beg with. The sum, in American currency (as they know less of pounds, shillings, and pence), amounted to the respectable one of 370 dollars. This last night’s talk in Birmingham was rather a gloomy one, for it was after leave had been taken of all friends. Bobasheela was to start in the morning for Liverpool, and I for London, where I had been summoned to attend as a witness in court, and Mr. Melody and the Indians were to leave for Nottingham and other towns in the north. So at a late hour we parted, and early in the morning set out for our different destinations, bearing with us many warm attachments formed during our short stay in the beautiful town of Birmingham. For what befel these good fellows in Nottingham and Leeds there will probably be no historian, as I was not with them. I commenced with them in York, where I became again the expounder of their habits and mysteries, and was delighted to meet them on classic ground, where there is so much to engage the attention and admiration of civilized or savage. I had visited York on a former occasion, and had the most ardent wish to be present at this time, and to conduct these rude people into the noble cathedral, and on to its grand tower. I had this pleasure; and in it accomplished one of my favourite designs in accompanying them on their northern tour. On my return from London I had joined the Indians at Leeds, where they had been exhibiting for some days, and found them just ready to start for York. I was their companion by the railway, therefore, to that ancient and venerable city; and made a note or two on an occurrence of an amusing nature which happened on the way. When we were within a few miles of the town the Indians were suddenly excited and startled by the appearance of a party of fox-hunters, forty or fifty in number, following their pack in full cry, having just crossed the track ahead of the train.
- 59. This was a subject entirely new to them and unthought of by the Indians; and, knowing that English soldiers all wore red coats, they were alarmed, their first impression being that we had brought them on to hostile ground, and that this was a “war-party” in pursuit of their enemy. They were relieved and excessively amused when I told them it was merely a fox-hunt, and that the gentlemen they saw riding were mostly noblemen and men of great influence and wealth. They watched them intensely until they were out of sight, and made many amusing remarks about them after we had arrived at York. I told them they rode without guns, and the first one in at the death pulled off the tail of the fox and rode into town with it under his hatband. Their laughter was excessive at the idea of “such gentlemen hunting in open fields, and with a whip instead of a gun; and that great chiefs, as I had pronounced them, should be risking their lives, and the limbs of their fine horses, for a poor fox, the flesh of which, even if it were good to eat, was not wanted by such rich people, who had meat enough at home; and the skin of which could not be worth so much trouble, especially when, as everybody knows, it is good for nothing when the tail is pulled off.” On our arrival in York one of the first and most often repeated questions which they put was, whether there were any of the “good people,” as they now called them, the Friends, living there. I told them it was a place where a great many of them lived, and no doubt many would come to see them, which seemed to please and encourage them very much. Mr. Melody having taken rooms for them near to the York Minster, of which they had a partial view from their windows, their impatience became so great that we sallied out the morning after our arrival to pay the first visit to that grand and venerable pile. The reader has doubtless seen or read of this sublime edifice, and I need not attempt to describe it here. Were it in my power to portray the feelings which agitated the breasts of these rude people when they stood before this stupendous fabric of human hands, and as they passed through its aisles, amid its huge columns, and under its grand arches, I should be glad to do it; but those feelings which they enjoyed in the awful silence, were for
- 60. none but themselves to know. We all followed the guide, who showed and explained to us all that was worth seeing below, and then showed us the way by which we were to reach the summit of the grand or middle tower, where the whole party arrived after a laborious ascent of 273 steps. We had luckily selected a clear day; and the giddy height from which we gazed upon the town under our feet, and the lovely landscape in the distance all around us, afforded to the Indians a view far more wonderful than their eyes had previously beheld. Whilst we were all engaged in looking upon the various scenes that lay like the lines upon a map beneath us, the old Doctor, with his propensity which has been spoken of before, had succeeded in getting a little higher than any of the rest of the party, by climbing on to the little house erected over the gangway through which we entered upon the roof; and, upon the pinnacle of this, for a while stood smiling down upon the thousands of people who were gathering in the streets. He was at length, however, seen to assume a more conspicuous attitude by raising his head and his eyes towards the sky, and for some moments he devoutly addressed himself to the Great Spirit, whom the Indians always contemplate as “in the heavens, above the clouds.” When he had finished this invocation, he slowly and carefully “descended on to the roof, and as he joined his friends he observed that when he was up there “he was nearer to the Great Spirit than he had ever been before.” The War-chief excited much merriment by his sarcastic reply, that “it was a pity he did not stay there, for he would never be so near the Great Spirit again.” The Doctor had no way of answering this severe retort, except by a silent smile, as, with his head turned away, he gazed on the beautiful landscape beneath him. When we descended from the tower, the Indians desired to advance again to the centre of this grand edifice, where they stood for a few minutes with their hands covering their mouths, as they gazed upon the huge columns around them and the stupendous arches over their heads, and at last came silently away, and I believe inspired with greater awe and respect for the religion of white men than they had ever felt before.
- 61. Our stay of three days in York was too short for the Indians to make many acquaintances; but at their exhibitions they saw many of the Society of Friends, and these, as in other places, came forward to offer them their hands and invite them to their houses. Amongst the invitations they received was one from the governor of the Castle, who with great kindness conducted us through the various apartments of the prison, explaining the whole of its system and discipline to us. We were shown the various cells for different malefactors, with their inmates in them, which no doubt conveyed to the minds of the Indians new ideas of white men’s iniquities, and the justice of civilized laws. When we were withdrawing we were invited to examine a little museum of weapons which had been used by various convicts to commit the horrid deeds for which they had suffered death or transportation. A small room, surrounded by a wire screen, was devoted to these, and as it was unlocked we were invited in, and found one wall of the room completely covered with these shocking records of crime. The turnkey to this room stepped in, and in a spirit of the greatest kindness, with a rod in his hand to point with, commenced to explain them, and of course add to their interest, in the following manner:— “You see here, gentlemen, the weapons that have been used in the commission of murders by persons who have been tried and hung in this place, or transported for life. That long gun which you see there is the identical gun that Dyon shot his father with. He was hung. “That club and iron coulter you see there, gentlemen, were used by two highwaymen, who killed the gatekeeper, near Sheffield, by knocking out his brains, and afterwards robbed him. They were both hung. “This club and razor here, gentlemen (you see the blood on the razor now), were used by Thompson, who killed his wife. He
- 62. knocked her down with this club, and cut her throat with this identical razor. “This leather strap—gentlemen, do you see it? Well, this strap was taken from a calf’s neck by Benjamin Holrough, and he hung his father with it. He was hung here. “That hedging-bill, razor, and tongs, gentlemen, were the things used by Healy and Terry, who knocked an old woman down, cut her throat, and buried her. They were hung in this prison. “Now, gentlemen, we come to that hammer and razor you see there. With that same hammer Mary Crowther knocked her husband down, and then with that razor cut his throat. She was hung. “Do you see that club, gentlemen? That is the club with which Turner and Swihill, only nineteen years of age, murdered the bookkeeper near Sheffield. Both were hung. “Do you see this short gun, gentlemen? This is the very gun with which Dobson shot his father. He was hung. “This hat, gentlemen, with a hole in it, was the hat of Johnson, who was murdered near Sheffield. The hole you see is where the blow was struck that killed him.” The Indians, who had looked on these things and listened to these recitals with a curious interest at first, were now becoming a little uneasy, and the old Doctor, who smiled upon several of the first descriptions, now showed symptoms of evident disquiet, retreating behind the party, and towards the door. “Do you see this knife and bloody cravat, gentlemen? With that same knife John James stuck the bailiff through the cravat, and killed him. He was executed here. “A fire-poker, gentlemen, with which King murdered his wife near Sheffield. He was hung here.
- 63. “These things, gentlemen—this fork, poker, and bloody shoes— with this poker Hallet knocked his wife down, and stabbed her with the fork; and the shoes have got the blood on them yet. Hallet was hung. “That rope there is the one in which Bardsley was hung, who killed his own father. “A bloody axe and poker, gentlemen. With that axe and poker an old woman killed a little boy. She then drowned herself. She was not executed. “This shoe-knife, gentlemen, is one that Robert Noll killed his wife with in Sheffield. He was executed. “Another knife, with which Rogers killed a man in Sheffield. He ripped his bowels out with it. He was hung. “A club, and stone, and hat, gentlemen. With this club and stone Blackburn was murdered, and that was his hat: you see how it is all broken and bloody. This was done by four men. All hung. “The hat and hammer here, gentlemen—these belonged to two robbers. One met the other in a wood, and killed him with the hammer. He was hung. “That scythe and pitchfork, you see, gentlemen”—— When our guide had thus far explained, and Jeffrey had translated to the Indians, I observed the old Doctor quite outside of the museum-room, and with his robe wrapped close around him, casting his eyes around in all directions, and evidently in great uneasiness. He called for the party to come out, for, said he, “I do not think this is a good place for us to stay in any longer.” We all thought it was as well, for the turnkey had as yet not described one-third of his curiosities; so we thanked him for his kindness, and took leave of him and his interesting museum.
- 64. We were then conducted by the governor’s request to the apartments of his family, where he and his kind lady and daughters received the Indians and ourselves with much kindness, having his table prepared with refreshments, and, much to the satisfaction of the Indians (after their fatigue of body as well as of mind), with plenty of the Queen’s chickabobboo. The sight-seeing of this day and the exhibition at night finished our labours in the interesting town of York, where I have often regretted we did not remain a little longer to avail ourselves of the numerous and kind invitations which were extended to us before we left. After our labours were all done, and the Indians had enjoyed their suppers and their chickabobboo, we had a pipe together, and a sort of recapitulation of what we had seen and heard since we arrived. The two most striking subjects of the gossip of this evening were the cathedral and the prison; the one seemed to have filled their minds with astonishment and admiration at the ingenuity and power of civilized man, and the other with surprise and horror at his degradation and wickedness; and evidently with some alarm for the safety of their persons in such a vicinity of vice as they had reason to believe they were in from the evidences they had seen during the day. The poor old Doctor was so anxious for the next morning to dawn, that we might be on our way, that he had become quite nervous and entirely contemplative and unsociable. They had heard such a catalogue of murders and executions explained, though they knew that we had but begun with the list, and saw so many incarcerated in the prison, some awaiting their trial, others who had been convicted and were under sentence of death or transportation, and others again pining in their cells, and weeping for their wives and children (merely because they could not pay the money that they owed), that they became horrified and alarmed; and as it was the first place where they had seen an exhibition of this kind, there was some reason for the poor fellows’ opinions that they were in the midst of the wickedest place in the world.
- 65. They said that, from the grandeur and great number of their churches, they thought they ought to be one of the most honest and harmless people they had been amongst, but instead of that they were now convinced they must be the very worst, and the quicker Mr. Melody made arrangements to be off the better. The Indians had been objects of great interest, and for the three nights of their amusements their room was well filled and nightly increasing; but all arguments were in vain, and we must needs be on the move. I relieved their minds in a measure relative to the instruments of death they had seen and the executions of which they had heard an account, by informing them of a fact that had not occurred to them —that the number of executions mentioned had been spread over a great number of years, and were for crimes committed amongst some hundreds of thousands of inhabitants, occupying a tract of country a great many miles in every direction from York; and also that the poor men imprisoned for debt were from various parts of the country for a great distance around. This seemed to abate their surprise to a considerable degree; still, the first impression was here made, and made by means of their eyes (which they say they never disbelieve, and I am quite sure they will never get rid of it), that York was the “wicked town,” as they continued to call it during the remainder of their European travels. I explained to them that other towns had their jails and their gallows—that in London they daily rode in their buss past prison walls, and where the numbers imprisoned were greater than those in York, in proportion to the greater size of the city. Their comments were many and curious on the cruelty of imprisoning people for debt, because they could not pay money. “Why not kill them?” they said; “it would be better, because when a man is dead he is no expense to any one, and his wife can get a husband again, and his little children a father to feed and take care of them; when he is in jail they must starve: when he is once in jail he cannot wish his face to be seen again, and they had better kill them all at once.” They thought it easier to die than to live in jail, and seemed to be surprised that white men, so many hundreds and
- 66. thousands, would submit to it, when they had so many means by which they could kill themselves. They saw convicts in the cells who were to be transported from the country: they inquired the meaning of that, and, when I explained it, they seemed to think that was a good plan, for, said they, “if these people can’t get money enough to pay their debts, if they go to another country they need not be ashamed there, and perhaps they will soon make money enough to come back and have their friends take them by the hand again.” I told them, however, that they had not understood me exactly—that transportation was only for heinous crimes, and then a man was sent away in irons, and in the country where he went he had to labour several years, or for life, with chains upon him, as a slave. Their ideas were changed at once on this point, and they agreed that it would be better to kill them all at once, or give them weapons and let them do it themselves. While this conversation was going on, the Recorder Jim found here very interesting statistics for his note-book, and he at once conceived the plan of getting Daniel to find out how many people there were that they had seen in the prison locked up in one town; and then, his ideas expanding, how many (if it could be done at so late an hour) there were in all the prisons in London; and then how many white people in all the kingdom were locked up for crimes, and how many because they couldn’t pay money. His friend and teacher, Daniel, whose head had become a tolerable gazetteer and statistical table, told him it would be quite easy to find it all ready printed in books and newspapers, and that he would put it all down in his book in a little time. The inquisitive Jim then inquired if there were any poorhouses in York, as in other towns; to which his friend Daniel replied that there were, and also in nearly every town in the kingdom; upon which Jim started the design of adding to the statistical entries in his book the number of people in poorhouses throughout the kingdom. Daniel agreed to do this for him also, which he could easily copy out of a memorandum-book of his own, and also to give him an estimate of the number of people annually
- 67. transported from the kingdom for the commission of crimes. This all pleased Jim very much, and was amusement for Daniel; but at the same time I was decidedly regretting with Mr. Melody that his good fellows the Indians, in their visit to York, should have got their eyes open to so much of the dark side of civilization, which it might have been better for them that they never had seen. Jim’s book was now becoming daily a subject of more and more excitement to him, and consequently of jealousy amongst some of the party, and particularly so with the old Doctor; as Jim was getting more rapidly educated than either of the others, and his book so far advanced as to discourage the Doctor from any essay of the kind himself. Jim that night regretted only one thing which he had neglected to do, and which it was now too late to accomplish—that was, to have measured the length of the cathedral and ascertained the number of steps required to walk around it. He had counted the number of steps to the top of the grand tower, and had intended to have measured the cathedral’s length. I had procured some very beautiful engravings of it, however, one of which Daniel arranged in his book, and the length of the building and its height we easily found for him in the pocket Guide. The Doctor, watching with a jealous eye these numerous estimates going into Jim’s book, to be referred to (and of course sworn to) when he got home, and probably on various occasions long before, and having learned enough of arithmetic to understand what a wonderful effect a cipher has when placed on the right of a number of figures, he smiled from day to day with a wicked intent on Jim’s records, which, if they went back to his tribe in anything like a credible form, would be a direct infringement upon his peculiar department, and materially affect his standing, inasmuch as Jim laid no claims to a knowledge of medicine, or to anything more than good eating and drinking, before he left home. However, the Doctor at this time could only meditate and smile, as his stiff hand required some practice with the pen before he could make those little 0’s so as to match with others in the book, which
- 68. was often left carelessly lying about upon their table. This intent was entirely and originally wicked on the part of the old Doctor, because he had not yet, that any one knew of, made any reference to his measure of the giant woman, since he had carefully rolled up his cord and put it away amongst his other estimates, to be taken home to “astonish the natives” on their return.
- 70. CHAPTER XXIII. Newcastle-on-Tyne—Indians’ alarms about jails—Kind visits from Friends—Mrs. A. Richardson—Advice of the Friends—War-Chiefs reply—Liberal presents— Arrive at Sunderland—Kindness of the Friends—All breakfast with Mr. T. Richardson—Indians plant trees in his garden—And the Author also—The Doctor’s superstition—Sacrifice—Feast—Illness of the Roman Nose—Indians visit a coalpit—North Shields—A sailors’ dinner and a row—Arrive at Edinburgh—A drive—First exhibition there—Visit to Salisbury Crag—To Arthur’s Seat—Holyrood House and Castle—The crown of Robert Bruce— The “big gun,”—“Queen Mab”—Curious modes of building—“Flats”—Origin of—Illness of Corsair, the little pappoose—The old Doctor speaks—War- chief’s speech—A feast of ducks—Indians’ remarks upon the government of Scotland—“The swapping of crowns”—The Doctor proposes the crown of Robert Bruce for Prince Albert—Start for Dundee—Indians’ liberality—A noble act—Arrival at Dundee—Death of little Corsair—Distress of the Little Wolf and his wife—Curious ceremony—Young men piercing their arms— Indians at Perth—Arrival in Glasgow—Quartered in the Town-hall—The cemetery—The Hunterian Museum—The Doctor’s admiration of it—Daily drives—Indians throw money to the poor—Alarm for Roman Nose—Two reverend gentlemen talk with the Indians—War-chief’s remarks—Greenock —Doctor’s regret at leaving. Newcastle-on-Tyne was the next place where we stopped, and when I arrived there I found Mr. Melody and his friends very comfortably lodged, and all in excellent spirits. The Indians, he told me, had been exceedingly buoyant in spirits from the moment they left York, and the old Doctor sang the whole way, even though he had been defeated in his design of riding outside on the railway train, as he had been in the habit of doing on the omnibus in London. I told them I had remained a little behind them in York to enjoy a few hours more of the society of an excellent and kind lady of the Society of Friends,[29] whom they would recollect to have seen in the exhibition room when they had finished their last night’s exhibition, who came forward and shook hands in the most
- 71. affectionate manner, and left gold in their hands as she bade them good bye, and commended them to the care of the Great Spirit. I told them that this good lady had only returned from the country on the last evening of their exhibiting in York, and was exceedingly disappointed that she could not have the pleasure of their society at her house. I then sat down and amused them an hour with a beautiful manuscript book, by her own hand, which she had presented to me, containing the portraits of seven Seneca chiefs and braves, who were in England twenty-five years before, and whom she entertained for three weeks in her own house. This interesting work contains also some twenty pages of poetry glowing with piety, and written in a chaste and beautiful style; and an hundred or more pages in prose, giving a full description of the party, their modes, and a history of their success, as they travelled through the kingdom. This was a subject of much pleasure to them, but at the same time increased their regret that they had not seen more of this kind lady before they left the town of York. Their first inquiries after their arrival in Newcastle were whether they would meet any of the “good people” in that town, and whether that was a place where they had prisons and a gallows like those in London and in York. I answered that they would no doubt find many of the Friends there, for I knew several very kind families who would call upon them, and also that the good lady who gave me the book in York had written letters to several of the Friends in Newcastle to call on them; and that, as to the jails, c., I believed they were much the same. In a sort of council which we held there, as we were in the Indian habit of convening one whenever we were leaving an old lodging or taking possession of a new one, it was very gravely and diffidently suggested by the Doctor, as the desire of the whole party, that they presumed Chippehola[30] had money enough left in London (in case they should fail in this section of the country to make enough to pay their debts) to keep them clear from being taken up and treated like white men who can’t pay what they owe. I approved this judicious
- 72. suggestion, and assured them they might feel quite easy as long as they were in the kingdom. I told them I was quite sure they had a good and faithful friend in Mr. Melody, and, if anything happened to him, they would be sure to find me ready to take care of them, and that, if we were both to die, they would find all the English people around them their friends. This seemed to satisfy and to cheer them up, and our few days in Newcastle thus commenced very pleasantly. From their first night’s exhibition they all returned to their lodgings with peculiar satisfaction that they had observed a greater number of Friends in the crowd than they had seen in any place before, and many of these had remained until everybody else had gone away, to shake hands and converse with them. They found roast beef and beef-steaks and chickabobboo also, the same as in other places, and altogether there was enough around them here to produce cheerful faces. I need not describe again to the reader the nature and excitement of the dances, c., in their exhibitions, which were nightly repeated here as they had been in London; but incidents and results growing out of these amusements were now becoming exceedingly interesting, and as will be found in the sequel of much importance, I trust, to those poor people and their descendants. Very many of the Society of Friends were nightly attending their exhibitions, not so much for the purpose of witnessing or encouraging their war-dances and customs, as for an opportunity of forming an acquaintance with them, with a view to render them in some way an essential good. With this object a letter was addressed to me by Mrs. Anna Richardson (with whom I had formerly corresponded on the subject of the Indians), proposing that a number of the Friends should be allowed to hold a conversation with them in their apartments, on some morning, for the purpose of learning the true state of their minds relative to the subjects of religion and education, and to propose some efforts that might result to their advantage, and that of their nation. Mr. Melody and myself embraced this kind proposal at once, and the Indians all seemed delighted with it when it was made known to them. The morning was appointed, and this kind
- 73. and truly charitable lady came with fifteen or twenty of her friends, and the Indians listened with patience and apparent pleasure to the Christian advice that was given them by several, and cheerfully answered to the interrogatories which were put to them. The immediate appeal and thanks to the “Great Spirit, who had sent these kind people to them,” by the War-chief in his reply, seemed to impress upon the minds of all present the conviction of a high and noble sentiment of religion in the breasts of these people, which required but the light of the Christian revelation. His replies as to the benefits of education were much as he had made them on several occasions before, that, “as for themselves, they were too far advanced in life to think of being benefited by it, but that their children might learn to read and write, and that they should be glad to have them taught to do so.” Here seemed to dawn a gleam of hope, which that pious lady, in her conversation and subsequent correspondence with me, often alluded to, as the most favourable omen for the desire which the Friends had of rendering them some lasting benefit. Mr. Melody on this occasion produced a little book printed in the Ioway language, in the missionary school already in existence in the tribe, and also letters which he had just received from the Rev. Mr. Irvin, then conducting the school, giving an encouraging account of it, and hoping that the Indians and himself might return safe, and with means to assist in the noble enterprise. This information was gratifying in the extreme, and all seemed to think that there was a chance of enlightening these benighted people. The heart of this Christian woman reached to the American wilderness in a letter that she directed to this reverend gentleman, believing that there, where were the wives and children of the chiefs and warriors who were travelling, was the place for the efforts of the Society of Friends to be beneficially applied; and thus, I believe, formed the chain from which I feel confident the most fortunate results will flow.[31] Several subsequent interviews were held with the Indians by these kind people, who took them to their houses and schools, and
- 74. bestowed upon them many tangible proofs of their attachment to them, and anxiety for their welfare. The Indians left Newcastle and these suddenly made friends with great reluctance, and we paid a visit of a couple of days to Sunderland. Here they found also many of the “good people” attending their exhibitions, and received several warm and friendly invitations to their houses. Amongst these kind attentions there was one which they never will forget: they were invited to breakfast at the table of Mr. T. Richardson, in his lovely mansion, with his kind family and some friends, and after the breakfast was over all were invited into his beautiful garden, where a spade was ready, and a small tree prepared for each one to plant and attach his name to. This ceremony amused them very much, and, when they had all done, there was one left for Chippehola, who took the spade and completed the interesting ceremony. This had been kindly designed for their amusement, and for the pleasing recollections of his family, by this good man; and with all it went off cheerfully, except with the Doctor, who refused for some time, but was at length induced to take the spade and plant his tree. I observed from the moment that he had done it that he was contemplative, and evidently apprehensive that some bad luck was to come from it—that there was medicine in it, and he was alarmed. He was silent during the rest of the interview, and after they had returned to their rooms he still remained so for some time, when he explained to me that “he feared some one would be sick—some one of those trees would die, and he would much rather they had not been planted.” He said “it would be necessary to make a great feast the next day,” which I told him would be difficult, as we were to leave at an early hour. This puzzled him very much, as it was so late that, “if they were to try to give it that night, there would not be time for the ducks to be well cooked.” They all laughed at him for his superstition, and he got the charm off as well as he could by throwing some tobacco, as a sacrifice, into the fire. We travelled the next day to North Shields, and the gloom that was still evidently hanging over the old man’s brow was darkened by the increased illness of the Roman Nose, who had been for some weeks
- 75. slightly ailing, but on that day was attacked for the first time with some fever. The Doctor’s alarm was such that he stayed constantly by him, and did not accompany his friend Jim and one or two others with Daniel to the coalpit. This, from the repeated representations of Daniel and their old friend Bobasheela, was one of the greatest curiosities in the kingdom, and they were not disappointed in it. In this enterprise I did not accompany them, but from their representations ascertained that they descended more than two thousand feet and then travelled half a mile or so under the sea— that there were fifty horses and mules at that depth under the ground, that never will come up, drawing cars loaded with coal on railways, and six or seven hundred men, women, and children, as black as negroes, and many of these who seldom come up, but sleep there at nights. This scene shocked them even more than the sights they had seen in York, for they seemed to think that the debtors’ cells in a prison would be far preferable to the slavery they there saw, of “hundreds of women and children drawing out, as they said, from some narrow places where the horses could not go, little carriages loaded with coal; where the women had to go on their hands and knees through the mud and water, and almost entirely naked, drawing their loads by a strap that was buckled around their waists; their knees and their legs and their feet, which were all naked, were bleeding with cuts from the stones, and their hands also; they drew these loads in the dark, and they had only a little candle to see the way.” This surprising scene, which took them hours to describe to their companions, became more surprising when Daniel told them of “the vast number of such mines in various parts of the kingdom, and of the fact that many people in some parts have been born in those mines, and gone to school in them, and spent their lives, without ever knowing how the daylight looked.” Daniel reminded them of the hundreds of mines he had pointed out to them while travelling by the railroads, and that they were all under ground, like what they had seen. Here was rich subject for Jim, for another entry in his book, of the statistics of England; and Daniel, always ready, turned to the page in his own note-book, and
- 76. soon got for Jim’s memorandum the sum total of coalpits and mines in the kingdom, and the hundreds of thousands of human civilized beings who were imprisoned in them. It happened, on the second day that we were stopping in North Shields, much to the amusement of the Indians, that there was a sailors’ dinner prepared for an hundred or more in the large hall of the hotel where we were lodging; and, from the rooms which the Indians occupied, there was an opportunity of looking through a small window down into their hall, and upon the merry and noisy group around the table. This was a rich treat for the Indians; and, commencing in an amusing and funny manner, it became every moment more and more so, and, finally (when they began to dance and sing and smash the glasses, and at length the tables, and from that to “set-to’s,” “fisticuffs,” and “knockdowns,” by the dozens, and, at last, to a general mélée, a row, and a fight in the street) one of the most decidedly exciting and spirited scenes they had witnessed in the country. It afforded them amusement also for a long time after the day on which it took place, when they spoke of it as the “great fighting feast.” Two days completed our visit to North Shields, and on the next we were in comfortable quarters in Edinburgh. The Indians were greatly delighted with the appearance of the city as they entered it, and more so daily, as they took their omnibus drives around and through the different parts of it. The Doctor, however, who was tending on his patient, Roman Nose, seemed sad, and looked as if he had forebodings still of some sad results to flow from planting the trees; but he took his seat upon the bus, with his old joking friend Jim, by the side of the driver, smiling occasionally on whatever he saw amusing, as he was passing through the streets. Their novel appearance created a great excitement in Edinburgh; and our announcements filled our hall with the most respectable and fashionable people.
- 77. Welcome to our website – the perfect destination for book lovers and knowledge seekers. We believe that every book holds a new world, offering opportunities for learning, discovery, and personal growth. That’s why we are dedicated to bringing you a diverse collection of books, ranging from classic literature and specialized publications to self-development guides and children's books. More than just a book-buying platform, we strive to be a bridge connecting you with timeless cultural and intellectual values. With an elegant, user-friendly interface and a smart search system, you can quickly find the books that best suit your interests. Additionally, our special promotions and home delivery services help you save time and fully enjoy the joy of reading. Join us on a journey of knowledge exploration, passion nurturing, and personal growth every day! ebookbell.com