ROLE OF CAVEOLIN-1 AND NRF2 IN NUTRITIONAL MODULATION OF PCB TOXI

University of Kentucky
UKnowledge
Theses and Dissertations--Toxicology and Cancer
Biology
Toxicology and Cancer Biology
2015
ROLE OF CAVEOLIN-1 AND NRF2 IN
NUTRITIONAL MODULATION OF PCB
TOXICITY
Michael C. Petriello
University of Kentucky, michaelcpetriello@gmail.com
This Doctoral Dissertation is brought to you for free and open access by the Toxicology and Cancer Biology at UKnowledge. It has been accepted for
inclusion in Theses and Dissertations--Toxicology and Cancer Biology by an authorized administrator of UKnowledge. For more information, please
contact UKnowledge@lsv.uky.edu.
Recommended Citation
Petriello, Michael C., "ROLE OF CAVEOLIN-1 AND NRF2 IN NUTRITIONAL MODULATION OF PCB TOXICITY" (2015).
Theses and Dissertations--Toxicology and Cancer Biology. Paper 11.
http://uknowledge.uky.edu/toxicology_etds/11

STUDENT AGREEMENT:
I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been
given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright
permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-
party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not
permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File.
I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-
free license to archive and make accessible my work in whole or in part in all forms of media, now or
hereafter known. I agree that the document mentioned above may be made available immediately for
worldwide access unless an embargo applies.
I retain all other ownership rights to the copyright of my work. I also retain the right to use in future
works (such as articles or books) all or part of my work. I understand that I am free to register the
copyright to my work.
REVIEW, APPROVAL AND ACCEPTANCE
The document mentioned above has been reviewed and accepted by the student’s advisor, on behalf of
the advisory committee, and by the Director of Graduate Studies (DGS), on behalf of the program; we
verify that this is the final, approved version of the student’s thesis including all changes required by the
advisory committee. The undersigned agree to abide by the statements above.
Michael C. Petriello, Student
Dr. Bernhard Hennig, Major Professor
Dr. Isabel Mellon, Director of Graduate Studies

NUTRITIONAL MODULATION OF PCB TOXICITY
____________________________________________
DISSERTATION
____________________________________________
A dissertation submitted in partial fulfillment of the
requirements for the degree of Doctor of Philosophy in the
College of Medicine at the University of Kentucky
By
Michael Curtis Petriello
Lexington, Kentucky
Director: Dr. Bernhard Hennig, Professor of Nutrition and Toxicology
Lexington, Kentucky
2015
Copyright © Michael Curtis Petriello 2015

ABSTRACT OF DISSERTATION
Cardiovascular disease is the leading cause of mortality in Western societies and
is linked to multiple modifiable risk factors including lifestyle choices. Emerging evidence
implicates exposure to persistent environmental pollutants, such as polychlorinated
biphenyls (PCBs), as a risk factor for the development or progression of cardiovascular
disease. To reduce disease risks, it is critical to identify sensible means of biomedically
reducing the toxicity of persistent organic pollutants and related environmental stressors.
First, we tested a hypothesis that endothelial cell inflammation and subsequent
cardiovascular toxicity initiated by coplanar PCBs is modulated by the crosstalk between
caveolae and Nuclear factor (erythroid-derived 2)-like 2(Nrf2) related proteins. Caveolae
are lipid-enriched organelles found abundantly in endothelial cells and are important
mediators of endocytosis and signal transduction. Caveolin-1 (Cav-1), the major
structural protein of caveolae, is known to bind and concentrate multiple proteins related
to cardiovascular disease and PCB toxicity. Downregulation of Cav-1 protects against
PCB-induced vascular toxicity, but possible mechanisms of this defense remain elusive.
Studies using endothelial cells isolated from mice deficient in Cav-1 as well as in vitro
silencing assays demonstrated that loss of Cav-1 increases available antioxidant
enzymes by upregulating the antioxidant master controller Nrf2.
Nutritional interventions focused on diets high in bioactive food components,
such as polyphenols or certain fatty acids, may prove to be effective at decreasing
environmental pollutant induced diseases. To test the hypothesis that dietary
intervention can sensitize Nrf2 and/or caveolae signaling pathways, leading to a more
effective anti-inflammatory defense against PCB insults, mice were fed a green tea
polyphenol enriched diet and challenged with coplanar PCB 126. Mice fed an enriched
diet and exposed to PCBs exhibited lower levels of oxidative stress and higher levels of
multiple Nrf2 target antioxidant enzymes. Also, in separate in vitro studies, pretreatment
of endothelial cells with the endogenously formed nutrient metabolite, nitro-linoleic acid,
altered caveolae and Nrf2 related proteins, resulting in a modified response to PCB
exposure. Together, these data support the paradigm that nutritional modulation may be
a sensible means of reducing disease risks associated with exposure to environmental
pollutants.

KEYWORDS: Cardiovascular Disease, PCBs, Nrf2, Caveolae, Nutrition
Student’s Signature
April 13, 2015
Date

By

Dr. Bernhard Hennig
Director of Dissertation
Dr. Liya Gu
Director of Graduate Studies
April 13, 2015

iii

ACKNOWLEDGMENTS
The completion of this dissertation would not have been possible without the
unending support of many individuals. I would like to give my sincere thanks to some of
the key individuals who have helped me on my journey. First, I would like to thank my
doctoral mentor, Dr. Bernhard Hennig who has fostered an enjoyable scientific
environment which emphasizes independence and collaboration building. He has
allowed me the freedom to fail… and eventually succeed, and I hope the relationship we
have begun will only grow stronger.
I would like to thank my doctoral committee for their constant support and advice.
Dr. Shi, thank you for allowing me to rotate in your lab as an early member of the
Graduate Center for Toxicology, and for your scientific insights. Dr. Li, thank you for
your expertise and insights in the field of caveolae and Caveolin-1 biology. Dr. Paumi,
thank you for your continued support and enthusiastic personality. Thank you Dr. Testa,
for volunteering to be my outside examiner.
I would like to thank current and past lab members for their constant support. Dr.
Sung Gu Han, thank you for teaching me many of the scientific techniques that were
necessary for this dissertation. Dr. Bradley Newsome, thank you for your unique
scientific perspectives and companionship. You have helped me see the importance of
big picture ideas and how they can relate to my science. Dr. Maggie Murphy and Dr.
Katryn Eske are two strong scientists and two great friends who have both helped me
throughout my time at the University of Kentucky. Also, I would like to thank Dr. Andrew
Morris for his academic mentorship and his assistance with my American Heart
Association fellowship. He has constantly pushed me to become a better scientist and
to ask questions that are truly worth asking.
The work presented in this dissertation was supported financially by the National
Institute of Environmental Health Sciences at the National Institutes of Health
(Superfund Research Program grant number P42ES007380), the American Heart
Association (Predoctoral fellowship grant number 13PRE15860000), and the University
of Kentucky Agricultural Experiment Station.
Finally, I would like to thank my family and friends for their encouragement and
support. To my parents, thank you for knowing the importance of education and for

iv

doing everything in your power to allow me to reach my potential. To my brother Brett,
thank you for being a breath of fresh air for our family and I hope our relationship can
continue to grow. To my grandparents, aunts, uncles, and cousins thank you for your
love, kindness, and support. To my wife Stephanie, we were married during this
doctoral process so you deserve the most thanks of anyone. You constantly push me to
be a better man and I am so excited to grow as a scientist and husband with you. I am
the luckiest to have you and your family in my life. Thank you everyone for their support,
I truly appreciate it.

v
TABLE OF CONTENTS
Acknowledgements ...................................................................................................iii
Table of Contents.......................................................................................................v
List of Tables..............................................................................................................ix
List of Figures ............................................................................................................x
Chapter 1. Introduction..............................................................................................1
1.1 Background..................................................................................................1
1.1.1 Risk factors for atherosclerosis and cardiovascular disease
progression ..................................................................................................1
1.1.2 Vascular endothelial cells – a link between nutrition, toxicology, and
cardiovascular disease ................................................................................2
1.1.3 Polychlorinated biphenyls – an overview........................................4
1.1.4 Epidemiological links between PCBs and cardiovascular disease .5
1.1.5 Mechanisms of coplanar PCB-induced vascular inflammation – a
focus on the Aryl hydrocarbon receptor .......................................................10
1.1.6 Caveolae, caveolin-1, and PCB-induced endothelial cell dysfunction
……………………………………………………………………………13
1.1.7 The role of Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) in
protecting against PCB-induced oxidative stress and inflammation ............15
1.1.8 Nutrition as a modulator of environmental pollutant-induced toxicity
........................................................................................................17
1.2 Scope of dissertation ...................................................................................26
1.2.1 Aims of dissertation ........................................................................26
Chapter 2. PCB 126 toxicity is modulated by cross-talk between caveolae and Nrf2
signaling .....................................................................................................................30
2.1 Synopsis ......................................................................................................30
2.2 Introduction ..................................................................................................31
2.3 Materials and Methods.................................................................................34
2.3.1 Materials and chemicals .................................................................34
2.3.2 Cell culture and experimental media ..............................................34
2.3.3 Mouse endothelial cell isolation......................................................34
2.3.4 Real-time PCR................................................................................35
2.3.5 Cav-1 siRNA and transfection studies ............................................35
2.3.6 Immunoblotting………………………………………………………….36

vi
2.3.7 Preparation of nuclear extracts and electrophoretic mobility shift
(EMSA)…………………………………………………………………………….36
2.3.8 Statistical analysis………………………………………………………36
2.4 Results and Discussion................................................................................37
2.4.1 Cav-1 silencing prevents PCB-induced endothelial cell dysfunction by
increasing antioxidant gene expression.......................................................37
2.4.2 Decreased Cav-1 expression promotes Nrf2 activity by decreasing
levels of multiple Nrf2 inhibitory proteins......................................................38
2.4.3 Decreased Cav-1 expression promotes the phosphorylation of Akt but
not phosphorylation of PKC delta ................................................................38
2.4.4 Cells isolated from Cav-1 -/- mice are protected from PCB-induced
inflammation via upregulated Nrf2 activity ...................................................39
2.5 Discussion....................................................................................................39
Chapter 3. Green tea diet decreases PCB 126-induced oxidative stress in mice by
upregulating antioxidant enzymes ...........................................................................52
3.1 Synopsis ......................................................................................................52
3.2 Introduction ..................................................................................................53
3.3.1 Animals, diets, and dosing treatments............................................55
3.3.2 Blood and tissue harvesting............................................................56
3.3.3 Plasma PCB and isoprostane analysis...........................................56
3.3.4 RNA isolation and polymerase chain reaction (PCR) amplification 57
3.3.5 Immunoblotting assays...................................................................57
3.3.6 Data analyses.................................................................................58
3.4 Results .........................................................................................................58
3.4.1 Systemic toxicity associated with PCBs .........................................58
3.4.2 F2-isoprostane levels are significantly reduced in green tea extract-
supplemented, PCB-exposed mice ................................................59
3.4.3 Green tea extract increases antioxidant gene expression..............59
3.4.4 Green tea extract increases NQO1 and GSR antioxidant protein
response against PCB 126.............................................................60
3.4.5 Green tea extract drives Nrf2 nuclear translocation in the presence of
PCB 126 .........................................................................................60

vii
3.4.6 Green tea extract modulates inflammatory and xenobiotic-related
markers in the presence of PCB 126..............................................61
3.4.7 The AhR is implicated as a control mechanism both in PCB 126
toxicity and antioxidant response....................................................61
3.5 Discussion....................................................................................................62
Chapter 4. Nitration of linoleic acid modulates polychlorinated biphenyl-induced
endothelial cell dysfunction......................................................................................80
4.1 Synopsis ......................................................................................................80
4.2 Introduction ..................................................................................................81
4.3.1 Materials and chemicals .................................................................84
4.3.2 Cell culture and experimental media ..............................................84
4.3.3 Real-time PCR................................................................................84
4.3.4 Statistical analysis ..........................................................................85
4.4 Results .........................................................................................................85
4.4.1 Parent linoleic acid is pro-inflammatory whereas nitro-linoleic acid is
anti-inflammatory ............................................................................85
4.4.2 Parent linoleic acid increases AhR and Cyp1A1 expression, but nitro-
linoleic acid has no effect……………………………………………….85
4.4.3 Nitro-linoleic acid upregulates the antioxidant defense greater than
parent linoleic acid ...........................................................................86
4.4.4 PCBs exacerbate linoleic acid-induced increases in Cyp1A1, but
pretreatment with nitro-linoleic acid prevents this exacerbated effect.86
4.4.5 PCBs exacerbate linoleic acid-induced increases in pro-inflammatory
mediators, but pretreatment with nitro-linoleic acid prevents this
exacerbated effect............................................................................87
4.5 Discussion....................................................................................................87
Chapter 5. Overall discussion...................................................................................98
5.1 Discussion....................................................................................................98
5.1.1 Summary ........................................................................................98
5.1.2 Decreasing Cav-1 upregulates the Nrf2 antioxidant response .......98
5.1.3 A diet high in green tea polyphenols modulates the toxicity of PCB126
........................................................................................................100

viii
5.1.4 Parent linoleic acid exacerbates PCB-induced endothelial cell
dysfunction whereas treatment with the endogenously formed
metabolite, nitro-linoleic acid, is anti-inflammatory .........................101
5.2 Future directions and conclusions ...............................................................102
Appendices.................................................................................................................106
Appendix A. Novel analytical methodologies to study anti-inflammatory nitro-fatty
acids.......................................................................................................................106
A.1 Synopsis ......................................................................................................106
A.2 Introduction ..................................................................................................107
A.3 Materials and Methods.................................................................................109
A.3.1 Animal handling and use ................................................................109
A.3.2 Mass spectrometric analysis of nitro-oleate....................................109
A.3.3 Acidic chloroform lipid extraction ....................................................110
A.4 Results .........................................................................................................110
A.4.1 Nitro-oleic acid identification in positive mode is more efficient due to
chemical derivatization.................................................................................110
A.4.2 Confirmation of analytical methods using mice exogenously
administered nitro-oleic acid ........................................................................110
A.4.3 Comparison of two fatty acid extraction procedures.......................111
A.5 Discussion....................................................................................................111
Appendix B. Laboratory protocols ..........................................................................121
References..................................................................................................................128
Vita...............................................................................................................................149

ix
LIST OF TABLES
Table 1.1. Proteins related to inflammation and atherosclerosis that are concentrated in
caveolae lipid micro-domains……………………………………………………………….27
Table 3.1. Primers used for qRT-PCR .........................................................................66
Table 3.2. The effect of green tea extract (GTE) diet supplementation on PCB 126-
induced mRNA inflammatory, xenobiotic-related and antioxidant markers..................67
Table. 3.3. Control and 1% GTE mouse diets..............................................................79

LIST OF FIGURES
Figure 1.1. Nutritional modulation of PCB-induced vascular toxicity............................28
Figure 1.2. The configuration and amount of chlorines evident in a specific PCB
congener relates directly to the molecular mechanism of toxicity of that congener .....29
Figure 2.1. Expression of VCAM-1 mRNA in porcine vascular endothelial cells exposed
to coplanar PCB 126 ....................................................................................................43
Figure 2.2. Expression of antioxidant enzymes and Nrf2 transcriptional binding in cells
silenced for Cav-1 ........................................................................................................44
Figure 2.3. Expression of Nrf2 inhibitory proteins is decreased in cells silenced for
Cav-1............................................................................................................................45
Figure 2.4. Expression of phosphorylated Akt and PKC delta proteins in human
endothelial cells exposed to coplanar PCB 126...........................................................46
Figure 2.5. Confirmation of Cav-1 Nrf2 cross-talk in cells isolated from Cav-1 -/- mice
.....................................................................................................................................47
Figure 2.6. The induction of Nrf2 is controlled by multiple inhibitory proteins and a
complex regulatory mechanism. ..................................................................................48
Figure 2.7. Expression of antioxidant enzymes in cells silenced for Cav-1..................49
Figure 2.8. Expression of Keap1 mRNA in porcine endothelial cells exposed to vehicle
and coplanar PCB 126 .................................................................................................50
Figure 2.9. Expression of Keap1 mRNA in livers from age matched wild-type C57BL6
mice and Cav-1 -/- mice ...............................................................................................51
Figure 3.1. Proposed signaling pathway for PCB detoxification in vivo .......................68
Figure 3.2. The effect of green tea extract (GTE) diet supplementation on systemic PCB
126 concentration and metabolism ..............................................................................69
Figure 3.3. PCB 126-induced oxidative stress is modulated by green tea extract (GTE)
diet supplementation....................................................................................................70
Figure 3.4. Relative mRNA levels of representative antioxidant enzyme markers.......71
Figure 3.5. GTE supplementation leads to increased antioxidant protein expression in
the presence of PCB 126.............................................................................................72
Figure 3.6. Mice fed a 1% GTE-supplemented diet and subsequently exposed to PCB
126 displayed increased Nrf2 activation, as evidenced by increased Nrf2 translocation to
the nucleus, compared to mice fed 10% fat control diet and exposed to PCB.............73
Figure 3.7. Relative mRNA levels of inflammatory and xenobiotic-related markers ....74

Figure 3.8. GTE diet supplementation leads to significant upregulation of AhR mRNA
levels in the presence of PCB 126, thus increasing in vivo toxicant clearance............75
Figure 3.9. Relative mRNA levels of antioxidant enzyme markers ..............................76
Figure 3.10. PCB 126 exposure leads to a significant increase in liver/body weight ratio
(hepatosomatic index, HSI) in both control and GTE-supplemented diets, although GTE
supplementation did not significantly mitigate this PCB-induced increase...................78
Figure 4.1. Relative mRNA levels of monocyte chemoattractant protein-1 in cells treated
for 6 h with parent or nitrated linoleic acid (1 or 3 μM).................................................91
Figure 4.2. Relative mRNA levels of vascular cell adhesion molecule-1 in cells treated
Figure 4.3. Relative mRNA levels of Aryl hydrocarbon receptor and cytochrome
P4501A1 in cells treated for 6 h with parent or nitrated linoleic acid (1 μM) ................93
Figure 4.4. Relative mRNA levels of aryl hydrocarbon receptor and cytochrome
Figure 4.5. Relative mRNA levels of heme oxygenase-1 and NADPH quinone
oxidoreducatase-1 (antioxidant enzymes) in cells treated for 6 h with parent or nitrated
linoleic acid (3 μM) .......................................................................................................95
Figure 4.6. Relative mRNA levels of cytochrome p4501A1 in cells pretreated for 6 h with
parent or nitrated linoleic acid (0.1 μM) and subsequently treated for 6 h with 0.03 nM
PCB 126.......................................................................................................................96
Figure 4.7. Relative mRNA levels of MCP1 or VCAM-1 in cells pretreated for 6 h with
parent or nitrated linoleic acid (0.1 μM) and subsequently treated for 6h with 0.03 nM
PCB 126.......................................................................................................................97

xi

Figure 3.8. GTE diet supplementation leads to significant upregulation of AhR mRNA
levels in the presence of PCB 126, thus increasing in vivo toxicant clearance............75
Supplemental figure 3.1. Relative mRNA levels of antioxidant enzyme markers.........76
Supplemental figure 3.1. PCB 126 exposure leads to a significant increase in liver/body
weight ratio (hepatosomatic index, HSI) in both control and GTE-supplemented diets,
although GTE supplementation did not significantly mitigate this PCB-induced increase
.....................................................................................................................................78
Figure 4.1. Relative mRNA levels of monocyte chemoattractant protein-1 in cells treated
Figure 4.2. Relative mRNA levels of vascular cell adhesion molecule-1 in cells treated
Figure 4.3. Relative mRNA levels of Aryl hydrocarbon receptor and cytochrome
Figure 4.4. Relative mRNA levels of aryl hydrocarbon receptor and cytochrome
Figure 4.5. Relative mRNA levels of heme oxygenase-1 and NADPH quinone
oxidoreducatase-1 (antioxidant enzymes) in cells treated for 6 h with parent or nitrated
linoleic acid (3 μM) .......................................................................................................95
Figure 4.6. Relative mRNA levels of cytochrome p4501A1 in cells pretreated for 6 h with
PCB 126.......................................................................................................................96
Figure 4.7. Relative mRNA levels of MCP1 or VCAM-1 in cells pretreated for 6 h with
parent or nitrated linoleic acid (0.1 μM) and subsequently treated for 6h with 0.03 nM
PCB 126.......................................................................................................................97

1
Chapter one: Introduction
1.1 Background
1.1.1 Risk factors for atherosclerosis and cardiovascular disease progression
Cardiovascular disease (CVD) is the leading cause of death in the United States
for both men and women and is associated with multiple modifiable and non-modifiable
risk factors. CVD however is not a singular pathology but a group of disorders
encompassing the heart, blood vessels, and associated tissues. Risk factors such as
dyslipidemia, hypertension, obesity, sedentary lifestyle, and cigarette smoking have long
been known to correlate with CVD, but recently nontraditional risk factors such as
inflammatory status, insulin resistance, and genetic predisposition have emerged as
additional important variables to identify and modulate in patients1. Although CVD is a
broad and diverse pathology, there is evidence that an underlying condition called
atherosclerosis may play a key role.
Atherosclerosis is a chronic inflammatory disease that can begin early on in life
and eventually lead to blood vessel blockage and cardiac events such as stroke and
myocardial infarction. Atherosclerosis is initiated when the lining of the blood vessel
becomes damaged or activated by exogenous compounds such as lipophilic toxicants or
by endogenous signaling mediators such as pro-inflammatory cytokines. This activation
leads to increased blood flow, which aides in the recruitment of inflammatory blood cells
such as leukocytes, as well as transcriptional upregeulation of adhesion molecules that
bind and concentrate the leukocytes2. Upregulation of endothelial adhesion molecules,
chemokines, and cytokines such as vascular cell adhesion molecule-1 (VCAM-1) and
monocyte chemoattractant protein 1 (MCP-1) in an NFκB mediated mechanism is critical
for monocyte recruitment and infiltration (diapedesis) within the intima of the vessel2.
Mature monocytes within an early atherosclerotic lesion, known as macrophages, can
then upregulate receptors critical for the uptake of oxidized lipoproteins such as
oxidized-LDL3. These lipid rich macrophages known as foam cells cluster together and
can lead to fatty streaks and an atheromatous necrotic core4. As an atheroma
progresses, nearby smooth muscle cells and macrophages undergo apoptosis which
creates a “protective” fibrous cap3. In advanced stages of atherosclerosis, these caps
may rupture and lead to a possibly deadly thrombotic event3. Although the hardening
and thickening of vessel walls (atherosclerosis) requires multiple cell types, endothelial

2

cells appear to be a critical pathological mediator of both early and advanced stages of
the disease.
1.1.2 Vascular endothelial cells- a link between nutrition, toxicology, and
cardiovascular disease
Vascular endothelial cells are dynamic modulators of CVD and come in contact
with heterogenous blood components and stimuli such as a wide assortment of dietary
nutrients, lipid soluble toxic pollutants, and endogenous pro-inflammatory signals and
compounds. Once believed to be a relatively unimportant regulatory cell type,
endothelial cells are now known to be critical mediators of platelet adherence,
modulators of vascular tone, regulators of thrombosis, and controllers of immune and
inflammatory responses 5. Endothelial cells display semi-permeable characteristics and
can exert important paracrine and endocrine functions with surrounding smooth muscle
cells and leukocytes5. Although endothelial cells create a relatively tight barrier between
the blood and intima, controlled passage of proteins is possible via vesicular transport
mechanisms such as lipid raft caveolae-assisted endocytosis2. Since endothelial cells
are constantly exposed to blood and associated proteins, it is not surprising that nutrient
and chemical compounds from the diet may play a critical role in the regulation of
endothelial cell dysfunction and subsequent cardiovascular disease.
Dietary components may directly advantageously or detrimentally modulate
endothelial cell function. A large body of evidence implicates certain nutritional choices
as a means to protect against cardiovascular disease. For example, a highly studied
class of nutrients known as omega 3 polyunsaturated fatty acids (PUFAs) may protect
against atherosclerosis and cardiovascular disease by interactions with vascular
endothelial cells6. PUFAs such as DHA and EPA found in fish oil may be protective for
many reasons; they have been shown to decrease expression of endothelial cell
adhesion molecules, increase protective nitric oxide formation from endothelial cells via
endothelial cell nitric oxide synthase (eNOS), and reduce the levels of pro-inflammatory
omega 6 unsaturated fatty acids in phospholipids6. Linoleic acid, the pro- inflammatory
parent omega-6 fatty acid has been shown, through an NFκB mediated mechanism, to
activate endothelial cells, upregulate Interleukin-6 cytokine production, release
arachidonic acid, and allow for the leaking of albumin between endothelial cells7. The
toxicity of linoleic acid deserves further investigation because it is a fatty acid found
readily in Western diets and has grown in popularity since saturated and trans fat
sources have been decreased due to highly publicized fears. Linoleic acid’s pro-

3
inflammatory nature and endothelial cell toxicity may be attributed to the ability of the
fatty acid to become oxidized and create detrimental metabolites such as 9- and 13
hydroxy-octadecadienoic acid (9- and 13-HODE)8. In addition to diet-derived fatty acids,
endothelial cells can come into contact with multiple other bioactive food components,
many of which can be described as polyphenols or flavonoids. For example the major
bioactive component of green tea, epigallocatechin-3-gallate (EGCG) has been found at
concentrations of 0.1- 1.0 µM in human plasma and has been shown to not only act as
an antioxidant, but can directly bind to at least one specific receptor, (e.g., the laminin
receptor) which is found on endothelial cells9. This paradigm that endothelial cells can
directly sense and react to their ever changing plasma environment deserves much
further investigation, but interestingly, the scope of this environmental sensing may not
be limited to bioactive nutrients.
Accompanying nutrients from the diet, many lipophilic persistent organic
pollutants (POPs) are also distributed throughout the body via blood flow and plasma
proteins. Developing a body burden of POPs is not rare; for example, in studies
attempting to identify the concentrations of multiple pollutant compounds in human
plasma, it is not uncommon for the researchers to find known toxicants in 99-100% of
their test subjects in the parts per billion range (ppb)10. Also, due to their lipophilic
nature, many POPs such as polychlorinated biphenyls (PCBs) and other
organochlorines can sequester within adipose tissue creating a large storage bank of
highly concentrated toxicants which can be released in a steady state or acute time
frame (e.g., weight loss)11. Not surprisingly, many of these manmade compounds have
been shown to interact and activate endothelial cells; some causing toxicity via many of
the same mechanisms as detrimental nutrient components. For example, certain
toxicants such as PCBs have been shown to increase oxidative stress, upregulate
NFκB, and lead to endothelial cell dysfunction and inflammation12. Due to
commonalities between certain dietary nutrients and toxicants in regards to activation of
endothelial cells, more research describing the interplay between nutrition and toxicology
is critical to better understand the risks of environmental pollutants in a world of multiple
concomitant stressors.

4
1.1.3 Polychlorinated biphenyls – an overview13
Polychlorinated biphenyls are a diverse class of manmade chemicals that have
been outlawed in the United States since the 1970’s, but still pose toxicological risks due
to their persistence to environmental degradation14. Marketed for their effective thermal
and electrical properties, PCBs became commonplace in capacitors, caulking, and
hydraulic fluids but have become notorious for their correlations to multiple human
toxicities ranging from endocrine disruption to vascular inflammation15. A major source
of human exposure to PCBs is through dietary intake of contaminated foods and through
inhalation of airborne pollutants16. Because most halogenated POPs, including PCBs,
are lipid soluble, they easily accumulate in human tissues, leading to a perpetually
increasing disease risk throughout a life span, especially in overweight populations17.
PCBs are detrimental to multiple target organ systems and tissue types16, but the
breadth of this dissertation will focus on vascular related toxicity. Of the 209 individual
congeners that were manufactured, coplanar PCBs, which lack chlorine substitutions on
ortho positions of both phenyl rings, are most toxic to the endothelium and associated
vasculature18. These non-ortho substituted PCBs such as PCB 77 and PCB 126 are
able to, much like dioxin, bind to the aryl-hydrocarbon receptor (AhR) found within
vascular endothelial cells and increase reactive oxygen species (ROS) through
cytochrome P450 1A1 (CYP1A1)-mediated uncoupling12b, 12c. Mechanistically, an
increase in cellular oxidative stress often precedes an inflammatory response19.
CYP1A1 induction allows for the detoxification of multiple xenobiotics, but when in the
presence of PCB, can become inefficient and leaky (i.e., uncoupled) and produce
detrimental reactive oxygen species20. A hallmark of the pathology of vascular diseases,
including atherosclerosis, includes a change in the cellular redox status and a resultant
increase in oxidative stress, which favors chronic and low level inflammation21. There is
sufficient evidence that POPs contribute to inflammation by activating oxidative stress-
sensitive transcription factors such as nuclear factor kappa-light-chain-enhancer of
activated B cells (NFκB)22. For example, our previous studies suggest that PCBs, and in
particular coplanar PCBs, can increase cellular oxidative stress and induce inflammatory
parameters such as inflammatory cytokines, chemokines, and adhesion molecules in the
vascular endothelium, which are metabolic events that foster an inflammatory response
and atherosclerosis12c, 22-23. Through these pro-inflammatory mechanisms, PCBs and
related environmental toxicants have been correlated with increased risk of multiple
human chronic disease phenotypes including myocardial infarction, diabetes, stroke, and

5
hypertension24. Historically, epidemiological studies have been focused on occupational
exposures such as those that occurred with Swedish capacitor workers in the mid-20th
century, but it is becoming clearer that chronic low dose exposure may pose the most
risk for the general public25. For example, populations most at risk for chronic exposure
are those that ingest high levels of fatty fish due to the fact that PCBs preferentially
bioaccumulate in adipose tissue and thus can be transported vertically through the food
chain24c, 26. Although Inuit populations have been observed to have 3.4-fold higher
plasma PCB levels than Caucasians, low ppb concentrations are common for the
general United States population27. Importantly, according to National Health and
Nutrition Examination Survey (NHANES) there appears to be an association with plasma
levels of PCBs and cardiovascular disease in women in the United States28. Although
these association studies are far from causative and can only correlate levels of PCBs
with disease outcome, there are human studies that show PCB exposure can alter blood
lipid profiles and increase total blood cholesterol and triglycerides, lending merit to the
paradigm that environmental toxicants can promote or exacerbate vascular pathologies
in humans24c.
1.1.4 Epidemiological links between PCBs and cardiovascular disease
Cardiovascular disease (CVD) is a non-communicable disease that
encompasses a group of disorders of the heart and blood vessels including coronary
heart disease, cerebrovascular disease, peripheral arterial disease, rheumatic heart
disease, congenital heart disease, deep vein thrombosis, and pulmonary embolism29.
The World Health Organization estimates that 17.3 million people died from
cardiovascular diseases (CVD) in 2008 alone, accounting for 30% of global deaths and
serving as the number one cause of death globally30. Several risk factors and
associated diseases including type 2 diabetes, hypertension, obesity, sedentary lifestyle,
and over nutrition can contribute to the pathology of CVD. Furthermore, environmental
pollutants, such as PCBs, can thus contribute to CVD directly or indirectly via promotion
of these and other risk factors and associated diseases. Considering the significant
burden that CVDs have on global mortality, it is imperative to explore and assess factors
that may promote or exacerbate the pathogenesis of these diseases30. The goal of this
section, then, is to summarize current epidemiological findings linking environmental
exposures to PCBs with the development of CVD.

6
Type 2 diabetes
In 2000, an estimated 171 million people were diagnosed with diabetes; this
estimate is expected to increase to 366 million by the year 203031. Diabetes mellitus is
characterized by poorly regulated high blood glucose levels and is primarily categorized
into two groups, type 1 and type 2. Although most epidemiological studies do not
distinguish between type 1 and type 2 diabetes, it is estimated that type 2 diabetes
accounts for 90-95% of all diabetes cases32. Among patients with type 2 diabetes, CVD
is the major cause of death, with more than 60% of patient deaths associated with
myocardial infarction and stroke33. In addition, adults with diabetes have a 2 to 4-fold
increased risk of CVD-related events compared to those without diabetes34 and are at
substantially higher risk for developing CVD35.
Increasingly, data and an expanding body of literature are associating PCB
exposure with heightened risk and incidence of type 2 diabetes development 36. These
studies involve a variety of cohorts and subject ages, suggesting that PCB exposure
increase type 2 diabetes risk regardless of age or cohort. In addition to type 2 diabetes,
PCBs also have been implicated in the development of gestational diabetes. Serum
concentrations of PCB 138 and PCB 180 were associated with increased 2-hour glucose
levels and PCB 180 with increased immunoreactive insulin levels, suggesting that PCBs
contribute to insulin resistance in these mothers37. Gestational diabetes, characterized
by the development of any degree of glucose intolerance in mothers during pregnancy,
occurs during approximately 7% of pregnancies, or 200,000 cases annually. Women
who develop gestational diabetes are at an increased risk for the development of type 2
diabetes after pregnancy38.
While the molecular mechanisms that regulate the development of type 2
diabetes from PCB exposure remain elusive, several recent studies have shed light on
this subject. Some, like the gestational diabetes paper, have proposed the development
of insulin resistance as the mechanism by which PCBs cause type 2 diabetes36d, 37, 39.
One recent study suggests that PCBs exhibit toxic effects by adversely affecting insulin
producing β-cells in the pancreas as opposed to simply decreasing insulin sensitivity40.
Additional studies have reported no association with exposure and insulin resistance41,
suggesting that the observed inverse relationship between PCB exposure and serum
insulin40 is indicative of β-cell toxicity. Impaired fasting glucose tests have also been
reported to be associated with PCB exposure42. It has also been suggested that PCBs
may modulate adiponectin levels, leading to increased rates of type 2 diabetes

7
development43. Adiponectin is a hormone produced by adipocytes that is significantly
reduced in patients with insulin resistance, and is suggested as a strong predictor of type
2 diabetes43a. Studies have shown a negative correlation between plasma levels of
adiponectin and plasma PCB 153 concentrations, which may explain the role of PCB
exposure in the development of type 2 diabetes43-44. Additionally, PCB exposure has
been associated with a decreased production of insulin growth factor I, providing another
potential link between exposure to environmental pollutants such as PCBs and
increased risk for the development of type 2 diabetes45.
Hypertension
Of the 17.3 million deaths attributed to CVD in 2008, complications associated with
hypertension, or high blood pressure, accounted for roughly half (9.4 million) of those
deaths. Even more significant, these 2008 data indicated that 40% of all adults
worldwide (aged 25 and above) had been diagnosed with hypertension, an increase
from 600 million reported cases in 1980 to 1 billion cases in 2008. This drastic rise in
rates of hypertension has been attributed to a number of factors including poor nutrition,
lack of physical activity, and exposure to persistent chemical stressors46.
Growing epidemiological evidence is substantiating a link between exposure to PCBs
and increased risk of hypertension. The National Health and Nutrition Examination
Survey (NHANES) data set has been a significant source of information on the
association between hypertension and PCB exposure. Two recent studies showed that
serum PCB levels were significantly associated with hypertension47 and that serum PCB
levels were, on average, higher among individuals with hypertension47b. Additional
studies of NHANES data have indicated that dioxin-like PCB put a person at a higher
risk for hypertension than non-dioxin-like PCBs, but that the arrangement of chlorines
may also be an important factor36c, 48.
While the NHANES data set has provided a wealth of information, a variety of
epidemiological studies involving different cohorts have also found similar associations
between PCB exposure and an increased risk of hypertension. Two studies of the
Anniston, Alabama cohort, a group of 758 participants residing near the original
Monsanto Corporation PCB manufacturing site, showed a correlation between rates of
hypertension and serum PCB concentration49, and that other than age, total serum
PCBs were the strongest determinant of blood pressure level in 394 participants50

8
Additionally, a study of 1,374 Japanese residents substantiated these findings with their
own data indicating that serum levels of dioxin-like PCBs are directly correlated with high
blood pressure51. Finally, hospital discharge rates for hypertension for residents living in
upstate New York in zip codes with POP contaminated sites were increased by 19.2%,
although it is worth noting that these POP sites contained PCBs in addition to other
pollutants52.
Studies analyzing the correlation between PCB exposure and rates of
hypertension have been performed with sample sizes from 59 participants to 12,20047a,
50, 53. With the exception of one, all studies found a significant relationship. Studies with
sample sizes of 394 participants and above have shown a positive relationship between
PCB serum level and rate of hypertension. An older study, with a significantly smaller
sample of 59 participants failed to find a correlation53a, suggesting sample size, as well
as technological limitations, may have influenced the these findings.
Obesity
While atherosclerosis and hypertension are the most common risk factors for the
development of cardiovascular disease, obesity serves as a primary modulator of these
diseases and has been implicated heavily in CVD development54. Limited information
has implicated PCB exposure in the etiology of obesity development, with primary
correlations drawn from laboratory studies14, 55 as well as from multiple epidemiological
studies that have shown an association that warrants further examination56.
Epidemiological studies into the association of PCB exposure and the
development of obesity primarily have relied upon the comparison of serum PCB levels
and body mass index (BMI) or birth weight, although studies have yielded mixed results.
An interesting prospective study of 12,313 non-obese participants in the Seguimiento
Universidad de Navarra (SUN) cohort showed that after a median 8.1 years there were
621 new incidences of obesity among these participants, with a direct correlation seen
between increased dietary PCB intake (estimated from an earlier study of dioxin-like
PCB concentrations in food) and incidences of obesity56a. Additional studies of
adolescent and adult patients have reported total PCB56b, 57 and congener-specific58
obesity modulation, while others have found no correlation59 or even an inverse
association60, indicating the complexity of this question. These discrepancies, and
especially data indicating an inverse relationship between obesity rates and level of PCB

9

exposure, are likely due to bioaccumulation of highly lipophilic PCBs in human and
animal fat tissue44, 61 leaving low and/or inconsistent levels of PCB remaining in serum
samples for analysis. This suggests that serum PCB concentration measurement may
not provide an accurate estimate of a subject’s PCB exposure or body burden that
contributes to obesity risk factors. Recent weight loss or gain may also significantly alter
the measured concentration of PCBs, which would also impact findings. While there are
still many questions about the role of PCBs in modulating obesity risk factors, growing
epidemiological evidence along with in vitro and in vivo findings have implicated PCBs
as a part of a much larger group of environmental pollutants that act as obesogens, or
chemicals capable of inappropriately activating molecular pathways that induce
adipocyte differentiation and lead to a predisposition to obesity through dysfunctional
weight-control62.
Dyslipidemia
Dyslipidemia refers to a wide array of lipid abnormalities that can be causative in
the development of CVD. Efforts to prevent CVD have focused significant effort on
addressing dyslipidemia because it is readily modifiable by lifestyle changes and drug
therapies, most notably statins63. There is compelling evidence that decreasing total
cholesterol (TC), triglycerides (TG), and low-density lipoproteins (LDL) can help
markedly reduce a patient’s risk of CVD35, 64. Similar to findings on the association
between obesity and PCB exposure, the most compelling and complete evidence comes
from laboratory studies65. For instance, ApoE (-/-) mice injected with PCB 77 exhibited
increased serum cholesterol and atherosclerosis14. Although the small volume of
epidemiological literature directly examining a potential causal relationship between
dyslipidemia and PCB exposure is certainly a limiting factor, serum lipid measurements
are widely published within much larger analyses that implicate environmental stressors
more broadly in metabolic dysfunction. Despite these limitations, though, there is
epidemiological evidence suggesting PCB exposure may contribute to dyslipidemia24c, 39,
51. Among the contributors to dyslipidemia, elevated TG levels has been most
consistently associated with PCB exposure42, 66. Increases in both LDL67 and total
cholesterol53b, 67a, 68 have also been reported, although there are findings of no
correlation66b. An inverse relationship between PCB exposure and high-density

10

lipoproteins (HDL) has also been shown66c, 67b which is significant considering that
increasing levels of HDL are associated with a decrease in cardiovascular disease risk69
1.1.5 Mechanisms of coplanar PCB-induced vascular inflammation – a focus on
the Aryl hydrocarbon receptor
Coplanar PCBs activate the AhR and cause increased oxidative stress and inflammation
The toxicity of coplanar PCBs, such as PCBs 77 and 126, is primarily induced
through constant basal activation of the aryl hydrocarbon receptor (AhR), a transcription
factor involved in xenobiotic metabolism. As a so-called orphan receptor, AhR has no
associated high-affinity endogenous ligands, but rather binds to a wide array of ligands
that include PCBs70. Without a ligand present, AhR exists in the cytoplasm of cells as
an inactive complex with a heat-shock protein (Hsp90) as well as other co-chaperone
proteins such as the p23 protein71. Once bound to a ligand, AhR translocates into the
nucleus, dissociates from both Hsp90s and its co-chaperone proteins, and forms a
heterodimer with the aryl hydrocarbon receptor nuclear translocator (ARNT). The AhR-
ARNT complex then binds to a xenobiotic responsive element (XRE) in the promoter
region of the target genes72. A large number of drug-metabolizing enzymes are
induced as a result of AhR activation, including the phase I (oxidation), phase II
(conjugation), and transporters of the phase III (excretion) metabolic pathways. The
activation of these enzymes results in AhR ligands inducing their own metabolism and
clearance from the body70. This, combined with the fact that AhR is a relatively
ubiquitous protein that is expressed in most bodily tissues, has resulted in AhR being
recognized as the body’s primary molecular defense when presented with an
environmental toxin73. Previous work has demonstrated that coplanar PCBs are
capable of acting as AhR agonists12b, 22, 73. The toxicity that is then caused by these
coplanar PCBs while stimulating AhR is often attributed to the release of reactive
oxygen species (ROS) and the subsequent increase in oxidative stress20. It has been
suggested that ROS-induced oxidative stress in conjunction with coplanar PCB
exposure is the result of increased expression of, and eventual uncoupling of
cytochrome P450 1A subfamily (CYP1A1)20a, 22. The metabolism of PCBs by
cytochrome P450 enzymes involves a catalytic cycle of reactions that produce

11

metabolites of the parent compound74. The metabolism of PCBs is a slow process and,
unlike many other drugs, the metabolites produced are not currently thought to be a
major source of toxicity20a. The sluggish rate of PCB oxidation, though, causes the
uncoupling of the CYP1A1 catalytic cycle and allows ROS to leak out of the active site,
causing oxidative stress. Increased amounts of oxidative stress have been shown to be
heavily involved in many of the risk factors for cardiovascular disease75, including the
development of atherosclerosis76. In addition to increasing oxidative stress, ROS also
accelerate the degradation of nitric oxide, which impairs vasorelaxation by the
endothelium and is often referred to as endothelial dysfunction77. Patients with coronary
heart disease and increased endothelial dysfunction were shown to have an increased
risk of cardiovascular events, demonstrating the importance of oxidative stress in
cardiovascular disease78.
In addition to increasing oxidative stress, coplanar PCBs acting as AhR agonists
also induce cellular inflammation that is largely mediated by nuclear factor κB (NF-κB)22,
79. Previous research has shown that activation of NF-κB drives expression of target
genes that activate immune response mechanisms, ultimately resulting in the release of
proinflammatory cytokines and adhesion molecules that attract immune cells to
modulate pollutant-induced toxicity80. These effects, combined with oxidative stress
associated with ROS, have been shown to be atherogenic81. The compensatory
mechanism intended to help combat these effects, known as the nuclear factor
(erythroid-derived 2)-like 2 (Nrf2) antioxidant response pathway, regulates the response
to oxidative stress and, once activated by ROS, Nrf2 protein binds to antioxidant
response elements on target genes, leading to their upregulated expression. These
target genes include xenobiotic metabolizing enzymes, such as glutathione S-
transferases (GSTs), and many cytochrome P450s (CYPs), as well as antioxidant
enzymes, NAD(P)H: quinone oxidoreductase-1 (NQO1)82.
Role of AhR in cardiovascular disease
As seen in multiple epidemiological and laboratory studies, AhR ligands such as
dioxins and coplanar PCBs can negatively affect the cardiovascular system and lead to
phenotypes including hypertension and atherosclerosis83. Although the AhR’s main
evolutionary role may be to control detoxification and excretion of xenobiotic
compounds, emerging evidence now shows a role for the AhR in endogenous

12

physiological functions. AhR is found in many cell types and tissues including placenta,
lung, heart, and liver and can be activated by many non-toxicant ligands including
arachidonic acid metabolites, heme metabolites, and LDL84. AhR knockout animals
display developmental abnormalities, especially related to the vasculature. For example,
deficient mice display aberrant hepatovascular and ocular blood flow due to improper
developmental blood vessel formation84b. Xenobiotic and endogenous ligands may also
promote aberrant blood pressure regulation through an AhR mediated mechanism. AhR
null mice have been shown to have elevated angiotensin II and endothelin 1 levels which
are known to be linked with hypertension, but these differences may also be related to
specific environmental conditions such as geographic elevation84a. Interestingly,
circulating AhR expression levels have been used as a surrogate biomarker for coronary
arterial disease in certain populations, and specific AhR polymorphisms have been
linked to a greater likelihood of developing the disease85. With an obvious role in proper
mammalian development, early life exposures that alter AhR signaling may play a critical
role in the toxicities of many environmental pollutants.
Cross-talk between AhR and other toxicant-related signaling proteins
AhR is known to cross-talk with multiple signaling partners, many of which are
involved with inflammation and detoxification of xenobiotics. AhR has been shown to
directly or indirectly alter the signaling of multiple proteins including hypoxia inducible
factor (HIF), constitutive androstane receptor (CAR), estrogen receptor (ER), NFκB,
caveolin-1, and Nrf212b, 86. Although this may make deciphering the mechanisms of
toxicity of environmental pollutants difficult, cross-talk between many of these pathways
makes physiological sense. For example, many POPs including coplanar PCBs activate
AhR and subsequent Phase 1 detoxification enzymes; while simultaneously activating
Nrf2 and subsequent Phase 2 and 3 detoxification enzymes. Thus, AhR and Nrf2
pathways work concurrently to more effectively excrete and decrease the toxicity of
pollutants. Mechanistically, the Nrf2 promotor contains AhR binding elements, whereas
the AhR promotor contain Nrf2 binding elements86b. Also, certain compounds known as
“bifunctional inducers”, such as β-napthoflavone, can activate AhR first, and only
activate Nrf2 once CYP1A transforms the compound to a reactive intermediate86b.
Cross-talk between AhR and NFκB is a complicated area of study, but one that
deserves further investigation. Overall, it appears that NFκB suppresses AhR and AhR-

13

regulated CYP1A1 induction, but this is not universally agreed upon in the literature87.
Directly, NFκB can act as a transcription factor and bind cis-acting sequences in the AhR
promoter, leading to upregulation of CYP1A1 and related genes87b. Interestingly, NFκB
has been shown to upregulate multiple cytochrome p450s directly. This upregulation
has been shown to be due to multiple non-AhR mediated mechanisms including
transcriptional and post-transcriptional means87b. However, it has also been shown that
NFκB can directly suppress AhR-mediated pathways leading to exacerbated toxic
responses in a preexisting inflammatory environment87a. This inhibitory cross-talk, is still
controversial, as opposite effects are seen in certain cell types. Cell signaling pathways
related to inflammation and xenobiotics are incredibly intertwined which makes it difficult
if not futile to determine a direct mechanism of toxicant-induced disease. For example,
CYP1A1 activation has long be studied and used as a surrogate/biomarker for AhR
ligand binding. However, as more information related to the complicated cross-talk
between these signaling pathways emerges, a larger view of mechanistic toxicology,
including the roles of other AhR-related signaling pathways must be utilized to better
understand all of the interactions.
1.1.6 Caveolae, Caveolin-1, and PCB-induced endothelial cell dysfunction
Caveolae are flask shaped organelles found primarily at the plasma membrane in
endothelial cells, adipocytes, and other cell types88. Caveolae are composed of primarily
cholesterol and sphingolipids, whereas the majority of plasma membrane is made up of
phospholipids89. Caveolae have historically been believed to be primarily an
endocytosis mediator, but emerging evidence implicates caveolae as a critical regulator
of signaling transduction90. In fact, numerous proteins have been shown to be
associated with/concentrated in caveolae membranes (see table 1.1). Important
structural proteins of caveolae called caveolins (1, 2, or 3) are known to bind cholesterol,
fatty acids, and many signal transduction related proteins88-89, 91. Caveolin-1 (Cav-1) has
two important domains. The central domain contains 33 hydrophobic amino acids which
act as a membrane anchor allowing for a hairpin structure that points both the N- and C-
termini toward the cytoplasm92. The second important domain, known as the “Cav-1
binding domain”, allows for Cav-1 to bind itself as well as many other proteins92. Cav-1,
a major component of endothelial cell caveolae, has been known to directly bind, and
modulate many proteins related to inflammation, redox sensing, and cardiovascular

14

disease88, 90, 93. This has lead multiple research groups to examine the therapeutic
potential of downregulating caveolin-1.
Due to their high abundance in cell and tissue types related to cardiovascular
diseases, caveolae may have an important role in the pathogenesis of vascular disease.
The creation of whole body knock out animals has allowed researchers to identify links
between Cav-1 and caveolae to non-communicable diseases such as atherosclerosis
and cancer90, 93. Currently, it appears that loss of Cav-1 may have protective or
detrimental effects depending on what cell type, organ system, or disease pathology one
is interested in92-94. Specifically relevant to this dissertation however, decreasing Cav-1
most likely is protective against the early stages of atherosclerosis and endothelial cell
dysfunction93-94.
Decreasing Cav-1 protects against atherosclerosis by multiple mechanisms.
Over a decade ago it was determined that Cav-1 knockout animals had protection
against atherosclerosis94. Early work showed that Cav-1-null mice bred with ApoE
knockouts (spontaneously develop atherosclerosis) displayed a pro-atherogenic lipid
profile, but interestingly showed dramatic decreases in lesion formation and decreased
levels of pro-inflammatory adhesion molecules94. This protection may be due to
decreased transcytosis of LDL particles across endothelial cells. In fact, some studies
have shown upwards of 50% reduction in LDL uptake in cells lacking Cav-193. Most of
the anti-atherosclerotic phenotype may be due to loss of Cav-1 in endothelial cells95. A
recent study clearly showed that overexpression of Cav-1 only in endothelial cells
accelerated atherosclerosis as evidenced by increased levels of VCAM-1 in the vessel
wall, increased atheroma formation, and decreased nitric oxide production95. Cav-1 has
also been shown to regulate the expression of pro-inflammatory receptors such as TNF-
α96. Taken together, a growing body of evidence now implicates a decrease in
endothelial cell Cav-1 as anti-inflammatory and protective against the early stages of
atherosclerosis. Previous work in our laboratory has also identified a role for Cav-1 and
caveolae in PCB-induced endothelial cell toxicity.
Since PCBs are highly lipophilic we previously hypothesized a role relating lipid raft
microdomain caveolae and associated proteins to PCB-induced vascular toxicity. Using
cellular fractionation techniques and subsequently GC-MS to quantify PCB levels, we
determined that PCBs selectively accumulate in caveolae12b and induce pro-
inflammatory genes associated with caveolae. For example, we determined that PCB
77, a coplanar PCB, promotes phosphorylation of Cav-1 and subsequent

15

phosphorylation of eNOS, which when dysfunctional, can lead to the creation of reactive
nitrogen species97. It is also known that AhR is critical for PCB-induced inflammation.
Using an immunoprecipitation analysis, we determined that coplanar PCBs increase
AhR binding to Cav-1 and that silencing of Cav-1(siRNA) attenuated PCB-mediated
induction of CYP1A1, oxidative stress, and MCP-112b, 23b. In vivo, we exposed ApoE-/-
mice to coplanar PCB (49 mg/kg), and observed higher overall cholesterol levels, serum
dyslipidemia and greater atherosclerotic lesion size. We demonstrated via real time
PCR that PCB 77 treatment increased both aortic mRNA expression levels of MCP-1 in
LDL-R−/− mice and plasma protein levels of MCP-1, suggesting that coplanar PCBs
induce cellular dysfunction in vivo. However, no MCP-1 induction was detected in mice
deficient in both LDL-R and Cav-1 genes23b. Similarly, Cav-1 KO mice did not induce the
pro-inflammatory cytokines interleukin-6 (IL-6)23b when exposed to coplanar PCB. These
findings imply that the loss of Cav-1 is protective of the earliest stages of PCB-induced
inflammation and atherosclerosis. The mechanisms of this protection have remained
elusive, however, interesting data has now linked loss of Cav-1 to an increase in
protective antioxidant enzymes via an upregulated Nrf2 response98
1.1.7 The role of Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) in protecting
against PCB-induced oxidative stress and vascular inflammation
Physiological systems have evolved multiple mechanisms of protection against
xenobiotics and reactive oxygen species. Nrf2 has been shown to be a redox sensitive
master regulator of antioxidant enzymes and plays an integral role in cellular protection
against persistent environmental pollutants such as PCBs. There are multiple
mechanisms of Nrf2 activation, including direct phosphorylation of Nrf2 by PKC delta
and loss of contact between Nrf2 and inhibitory kelch-like ECH-associated protein 1
(Keap-1)99. Upon activation, Nrf2 is able to evade ubiquitination, enter the nucleus, and
bind cis-acting antioxidant response elements (ARE) in target genes such as heme-
oxygenase 1 (HO-1) and NAD(P)H:quinoneoxidoreductase 1(NQO1)82a. Importantly,
Nrf2 activation leads to decreased inflammation which is a hallmark of PCB toxicity100.
Primarily, activation of Nrf2 is regulated through interactions between Keap1.
Modifications of Keap1 by oxidation or alkylation promotes a conformational change that
eliminates an important Keap1:Nrf2 molecular connection and allows the protein lifespan

16

of Nrf2 to increase from 7-15 to 30-100 minutes101. Key residues in Keap1, such as
Cys151, Cys273, and Cys288, control the interactions between Keap1, Nrf2, and
ubiquitin ligase E3101. Genetic deletion of Nrf2 increases sensitivity to oxidants and
inflammatory agents, whereas activation of the Keap1-Nrf2 pathway allows survival and
adaptation under various conditions of cellular stress82a, 102, suggesting that Nrf2 is a
critical player in down-regulating pro-inflammatory genes103. Also, Nrf2 activation can
play a role in atherosclerosis and vascular disease.
Atherosclerosis is a disease of inflammation and oxidative stress so it is not
surprising that Nrf2 can play modulatory roles. In certain models of induced-disease,
Nrf2-null mice display increased production of pro-inflammatory cytokines, chemokines,
and adhesion molecules such as TNF-α, CXC, and VCAM-1100. Upregulating Nrf2,
either via overexpression mechanisms or therapeutically, can decrease these pro-
inflammatory mediators100. Activation of Nrf2 can lead to an upregulation of HO-1 which
can suppress lesion formation by limiting the migration of monocytes into the intima104.
HO-1 upregulation leads to an increase in endogenous antioxidants such as biliverdin
and bilirubin which have been shown to decrease inflammation in many disease states.
Interestingly, the endothelial cell response to reactive oxygen species (ROS) and
reactive nitrogen species (RNS) may have a critical role in the development of
atherosclerosis. As blood flows through vessels, a dragging force called fluid shear
stress can activate enzymes such as NADPH oxidases resulting in the formation of
superoxide105. Depending on the location of the vessel as well as other factors,
endothelial cells may come into contact with disturbed flow or steady laminar flow.
Disturbed shear stress (oscillatory/turbulent) has been shown to upregulate pro-
inflammatory mediators such as MCP1 whereas laminar shear stress (steady) has been
shown to be anti-atherogenic by upregulating Nrf2105-106. Endothelial cell activation of
Nrf2 appears to be primarily anti-atherosclerotic, and our laboratory and others have
also shown that Nrf2 is a critical mediator of toxicant-induced inflammation.
Genetic deletion of Nrf2 increases sensitivity to oxidants and inflammatory agents,
whereas activation of the Keap1-Nrf2 pathway allows survival and adaptation under
various conditions of cellular stress82a, 102, suggesting that Nrf2 is a critical player in
down-regulating pro-inflammatory genes103. Our data in ECs suggest a regulatory
function of Nrf2 in PCB 126-mediated induction of CYP1A1, as silencing Nrf2 further
increased CYP1A1 induction by PCB73b. Silencing of Nrf2 appears to shut off the

17

cellular defense against PCB toxicity as silencing of Nrf2 also increased inflammatory
markers, such as MCP-1 and VCAM-1 at basal and post PCB-exposure conditions. Nrf2
has also been shown to protect against TCDD-induced oxidative injury and liver
steatohepatitis, as Nrf2 deficient mice were less capable of preventing fat accumulation,
lipid peroxidation, impaired adipogenesis, and depletion of glutathione when exposed to
the toxicant107. Since Nrf2 is more of a redox sensing platform, a wide variety of
activators have been identified and hypothesized including POPs, metals, nutrients, and
chemotherapeutics. Many of these activators may be electrophiles or Michael reaction
acceptors that can disrupt the Nrf2-Keap1 interactions82a. Interestingly, certain bioactive
nutrients may be able to activate Nrf2 prior to a toxicological insult, which may help to
prevent toxicant-induced disease.
1.1.8 Nutrition as a modulator of environmental pollutant-induced toxicity13
Sub-optimal or unhealthy nutrition modulates the toxicity of environmental pollutants
There is a large collection of evidence pointing to the role that a person’s dietary
makeup and eating habits can play in the promotion of chronic inflammation, metabolic
disorders and vascular diseases108. Additionally, emerging data show that exposure to
persistent organic pollutants such as PCBs may work in concert with unhealthy diets to
promote cumulative or synergistic negative effects109. In fact, POPs and subprime
nutritional status share mechanisms of disease development including the induction of
pro-inflammatory pathways. Interestingly, a growing body of evidence implicates an
exacerbated toxic effect of PCBs and other environmental pollutants when combined
with an additive pro-inflammatory dietary environment13b. Our data support the paradigm
that a poor nutritional state can exacerbate toxicity associated with exposure to PCBs
and other persistent organic pollutants (POPs), and taking into account the interactions
between diet and toxicants will help to better elucidate the impacts that PCBs and
related compounds have on human health.
Multiple research groups have shown negative interactions between unhealthy or
refined diets and environmental pollutants ranging from heavy metals to PCBs. For
example, high fat diets appear to intensify arsenic-induced inflammation,
hepatofibrogenesis, and cancer initiation110, while diets high in saturated fats exacerbate

18

polycyclic aromatic hydrocarbon-induced adenomas111. Unfortunately, studies that
investigate the impacts of mixing multiple types of exposures, (e.g. chlorinated pollutants
and heavy metals) in combination with the added variable of an unhealthy diet are
lacking. These types of comprehensive integrated toxicity studies will better mirror real
world exposure conditions especially for people residing in close proximity to Superfund
and other hazardous waste sites.
PCBs are prime pollutant candidates to study the interactions between diet and
toxicants because they can sequester in adipose for long durations, and exposures are
due often to ingestion of contaminated foods. Our research has focused on the
interactions of PCBs and proinflammatory omega-6 fatty acids. We have shown that
omega-6 fatty acids, and in particular linoleic acid, can cross-amplify the detrimental
effects of coplanar PCBs and produce increases in oxidative stress, CYP1A1 induction,
and endothelial permeability109. This work was expanded in vivo as we observed
increased proinflammatory cytokine levels and lipid staining in mice fed oils rich in
omega-6 fatty acids and exposed to PCB compared to mice exposed to PCB alone112.
Animal fats such as those found in beef and chicken are significant sources of pro-
inflammatory medium and long-chain omega-6 fatty acids as well as PCBs and other
related POPs113. Mechanistically, synergism between unhealthy diets (e.g., high-
fat/high caloric diets) and toxicants makes logical sense because both factors act upon
many of the same receptors and cell signaling pathways. For example, omega-6 fatty
acids and PCBs have both been implicated in inflammatory initiation through AhR,
cytochrome P450’s, and toll-like receptors (TLRs)114. With the growing rates of obesity
and chronic oxidative and inflammatory stress, it is important to more thoroughly
elucidate interactions between proinflammatory diets and toxicants. Although it does
appear that unhealthy nutrition can work in concert with PCBs and related toxicants to
create an increasingly proinflammatory phenotype, a new paradigm has emerged that
implicates certain bioactive food components in protection against persistent organic
pollutant-induced vascular toxicity.

19

Healthful nutrition decreases the toxicity of pro-inflammatory pollutants
Polychlorinated biphenyls and related Superfund POPs induce chronic oxidative
stress and disregulated inflammatory responses, but anti-inflammatory nutritional
antioxidants may buffer and protect against toxicant-induced disease through multiple
cell signaling mechanisms13b. Polyphenols and bioactive fatty acids have been shown to
decrease toxicant-induced maladies including liver diseases, tumor formation and
growth, and endothelial cell activation13b, 115. Our work has shown that plant-derived
flavonoids such as epigallocatechin-3-gallate (EGCG), and long-chain omega-3 fatty
acids such as docosahexaenoic acid (DHA) can protect cellular systems by decreasing
pro-inflammatory lipid raft signaling domains called caveolae and by simultaneously
upregulating antioxidant defenses through increased nuclear factor (erythroid-derived 2)-
like 2 (Nrf2) activation116.
Polyphenols, for example, are an abundant and diverse class of bioactive
compounds found in many fruits and vegetables and have been linked to decreased
toxicity from dioxin and dioxin-like PCBs117. These ROS scavenging compounds can
also increase PCB excretion rates118, prevent AhR-induced inflammation73b, limit body
wasting119 and decrease cellular dysfunction120. Resveratrol, a well-studied polyphenol,
has been shown to interact with the primary receptor of coplanar PCBs, AhR, and to limit
its activation and subsequent proinflammatory signaling cascade121 122. Other groups
have shown that bioactive food compounds such as those found in broccoli
(sulphoraphane) and red wine (resveratrol) can activate Nrf2 through multiple
mechanisms and decrease oxidative stress levels in cells and in animals123. A goal of
our research is to determine the efficacy of causative nutrients or plant-derived bioactive
compounds found in everyday healthy diets, such as Vitamin E, that can bolster
protective physiological mechanisms and prevent against PCB-induced vascular
toxicity115a. Obviously, most Western diets are not fruit and vegetable focused, so it is
important to identify and classify lipid-based bioactive compounds as well.
Omega-3 polyunsaturated fatty acids (PUFAs) such as docosahexaenoic acid
(DHA) and eicosapentaenoic acid (EPA) are the main components of fish oil and have
been shown to decrease inflammation, reduce vascular diseases, and protect against
dioxin and PCB-mediated toxicity115b, 124. Unfortunately, most Western diets lack
adequate levels of omega-3 PUFAs, and the ratio of unhealthy omega-6 fats to omega-3
fats is very high115b, 125. Experimentally, it was determined that diets predominantly made
up of oils rich in linoleic acid (omega-6) increased PCB-induced cellular dysfunction, but

20

this negative effect was blunted as the ratio favored protective omega-3’s126.
Interestingly, we have shown that mice fed a DHA-supplemented diet and subsequently
exposed to coplanar PCB 126 exhibited a more profound antioxidant response as
observed by higher expression levels of protective heme-oxygenase 1 (HO-1) and
NAD(P)H:quinoneoxidoreductase 1 (NQO1)127. This preliminary work illustrates that
omega-3 PUFAs may help to protect against PCB-induced vascular toxicity by allowing
for a more efficient and intense endogenous protective response that utilizes multiple
physiological cell signaling pathways. Polyunsaturated fatty acids, and especially
omega-3 fatty acids, as well as their anti-inflammatory breakdown metabolites can
protect against PCB-induced disease by activating Nrf2 but interestingly also by
disrupting functional caveolae116a. Although caveolae and Nrf2 pathways appear to be
prime candidates for modulation by bioactive food components, more research is
necessary to better elucidate other novel pathways that can be targeted both in vitro and
in vivo.
Healthful nutrition can decrease body burden of environmental toxicants
An emerging paradigm implicates healthful nutrition as an effective protective
modulator of environmental toxicant-induced inflammation and human disease. Multiple
laboratories have investigated the decreased toxicities of environmental pollutants due
to bioactive nutrients such as flavonoids and omega-3 polyunsaturated fatty acids, but
many of these studies rely on in vitro assays that lack the complexity of a whole body
organismal approach. Importantly, emerging classes of bioactive food components such
as polyphenols also have been shown to modulate the pro-inflammatory effects of
environmental toxicants. Our laboratory and others have shown that a wide array of
phenolic compounds such as EGCG, curcumin and quercetin can decrease toxicant-
induced oxidative stress and inflammation in multiple cell types, tissues and animal
species118-119, 128. Although human studies are lacking, strong evidence in animal models
implicates a protective role for flavonoids and other polyphenols perhaps through the
induction of antioxidant enzyme pathways and increased fecal excretion rates129.
Interstingly, plant-derived polyphenols are being found to not only protect against POP-
mediated oxidative stress, inflammation, and toxicity but also to bind to POPs and thus

21

contribute to a decrease in body burden. In fact, if has been proposed that green tea,
containing high levels of polyphenols including EGCG, can inhibit the intestinal
absorption of lipids and highly lipophilic organic compounds and accelerate excretion of
PCBs118, 130.
Certain foods and polluted air can be major sources of toxicant exposures16.
Thus, altering nutritional choices may prove to effectively modulate risks associated with
exposure to POPs. Making informed dietary decisions such as substituting lower fat
versions of protein sources (e.g. legumes, nuts, or lean meats and dairies) may have
multiple health benefits including decreased exposure to detrimental pollutants such as
dioxins and PCBs131. For many populations it may be difficult or cost-prohibitive to
change major dietary protein sources; thus, increasing dietary intake of other bioactive
nutrients may buffer already exposed individuals against the negative ramifications of
pollutant exposures. For example, several laboratories have shown that diets high in
fiber can alter the absorption and excretion rates of pollutants such as PCBs132.
Mechanistically, multiple dietary fibers have been shown to effectively bind pollutants
such as dioxins, which may help to explain increased fecal excretion rates, decrease in
body burden, and observed protection132a. Increasing excretion of lipophilic toxicants
through other nutritional compounds such as fat substitutes may also effectively
decrease risk. For example, much emphasis including human clinical trials has been
placed on the interactions between the non-absorbable fat substitute olestra and
environmental toxicants133. Researchers determined that low levels of olestra
supplementation (25 grams/day) increased the excretion of multiple PCBs and related
contaminants upwards of 11 fold compared to normal diet134. Interestingly, in a human
study, an olestra-supplemented diet completely eliminated excessive POP
concentrations in adipose tissue and reversed POP-mediated clinical conditions such as
diabetes and hyperlipidemia135. Diet-derived bioactive compounds such as EGCG are
attractive modulators of toxic exposure because they may both help to prime the
physiological system prior to a toxic insult by upregulating protective detoxifying
enzymes as well as protect therapeutically after exposure by increasing the rate of
excretion and lowering overall body burden129b. Altering diets to increase fiber and
bioactive nutrients from fruits and vegetables is an effective and cost-efficient means of
modulating POP toxicity.

22

Protective cellular signaling pathways
Multiple signaling pathways have been attributed to nutritional modulation of
environmental toxicants, but we have shown that caveolae and the antioxidant master
controller nuclear factor (erythroid-derived 2)-like 2 (Nrf2) play integral protective roles.
There is increasing evidence that lipid raft membrane microdomains, i.e. caveolae, may
play an important role in atherosclerosis, the toxicity of coplanar PCBs, and nutritional
protection12a, 90, 94. Caveolae are flask shaped membrane invaginations that are
important in cholesterol transport, nutrient and xenobiotic import into cells and cellular
signaling93. Due to the lipophilicity of PCBs, they may enter the cell through lipid raft
mediated events or come into contact with caveolae-related signaling proteins.
Caveolae are abundant in vascular endothelial cells and the cardiovascular system in
general, which points to a highly probable role for caveolae in inflammation and
atherosclerosis92. Our laboratory has previously reported that coplanar PCBs promote
the upregulation of genes related to the activation of endothelial cells and the initial
stages of atherosclerosis and that the loss of functional caveolae ameliorates these
detrimental effects97. Caveolin-1 (Cav-1), the major structural protein of caveolae,
contains the “Cav-1 binding domain” that is known to bind multiple proteins including
endothelial nitric oxide-synthase (eNOS), v-src sarcoma (SRC), protein kinase C (PKC),
extracellular-signal-regulated kinase(ERk) and protein kinase B (Akt); many of which are
involved in inflammatory pathways90. For example, downregulation of Cav-1 can lead to
eNOS activation and subsequent increases in diffusible nitric oxide, which has been
shown to play a major role in healthy blood pressure and vessel tone12c. Many
publications from our laboratory and others show downregulation and elimination of Cav-
1 to be anti-atherosclerotic12b, 23b. Importantly, eliminating Cav-1 prevents PCB-induced
cellular dysfunction97. Our data point to Cav-1 as a possible anti-atherosclerotic
therapeutic target and we hypothesize that nutritional intervention can downregulate
Cav-1 and, in turn, protect against PCB-induced inflammation.
Nrf2 is a transcription factor that can upregulate cytoprotective genes in response
to oxidative stress, xenobiotics, and bioactive food molecules100, 136. Many nutrients,
including resveratrol, sulforaphane, and epigallocatechin gallate (EGCG), have been
shown to activate Nrf2123c, 137. There are multiple mechanisms of Nrf2 activation,
including direct phosphorylation of Nrf2 by PKC delta and loss of contact between Nrf2
and inhibitory kelch-like ECH-associated protein 1 (Keap-1)99. Upon activation, Nrf2 is
able to evade ubiquitination, enter the nucleus, and bind cis-acting antioxidant response

23

elements (ARE) in target genes such as heme-oxygenase 1 (HO-1) and
NAD(P)H:quinoneoxidoreductase 1(NQO1)82a. Importantly, Nrf2 activation leads to
decreased inflammation which is a hallmark of PCB toxicity100. Activation of Nrf2 may
lead to vascular protection from PCB-induced toxicity and we hypothesize that a diet rich
in bioactive food components can activate Nrf2 and prevent PCB-induced inflammation.
Nrf2 has been shown to cross-talk with multiple signaling partners, especially with the
major player in PCB toxicity, AhR138. Although it has been known for decades that dioxin
and dioxin-like compounds activate both AhR- and Nrf2-related genes, it was shown only
recently that Nrf2 is required for induction of AhR genes such as CYP1A1139. This
observed cross-talk can be explained mechanistically at the genetic level by the fact that
the promoter region for Nrf2 contains AhR binding regions and the gene promoter for
AhR contains multiple Nrf2 binding elements138. Our laboratory previously determined
that AhR is a binding partner of Cav-1, so it is plausible that cross-talk between caveolae
and Nrf2 signaling pathways also exists12b.
Little is known about the cross-talk between Nrf2 and caveolae signaling and
how bioactive compounds such as omega-3 lipids, flavonoids and other polyphenols
interact to protect against environmental insults. We have shown that decreasing
cellular Cav-1 levels results in a more intense antioxidant response. Mechanistically, we
attribute this to decreased AhR activity as well as increased Nrf2 activity73b. Recently,
an intimate example of cross-talk between Cav-1 and Nrf2 was illustrated140, and our
published data supports this phenomenon98, 116b. Using bioactive food components such
as flavonoids and omega-3 PUFAs may be an economically and logistically beneficial
method to counteract PCB-induced vascular inflammation. Although it does appear that
both caveolae and Nrf2 signaling pathways play an important role in nutritional
modulation of vascular inflammation, other signaling cascades may also prove to be
involved. Phytochemicals may work through multiple mechanisms that upregulate
protective genes, downregulate pro-inflammatory genes and/or decrease overall
oxidative stress (Figure1.1).
Emerging and future directions
The paradigm of nutritional modulation of environmental toxicants is still new,
thus many issues remain unresolved. One critically important area in need of further
investigation involves the metabolism of protective nutrients. With the advent of more

24

precise and high-resolution analytical techniques, researchers have finally begun to
elucidate truly causative bioactive food components. In a physiological system, both
nutrients and xenobiotics interact with similar cell signaling molecules and pathways.
Both nutrients and toxicants are impacted by all aspects of absorption, distribution,
metabolism and excretion, and understanding how bioactive compounds are altered or
influenced at each step will allow for more efficient biomodulation. Specifically, the
detection and identification of bioactive metabolites is of utmost importance due to the
fact that many parent compounds are altered and modified in vivo. As mentioned
previously, resveratrol is an extensively studied protective phytochemical, and
exemplifies the necessity of further investigating the roles that bioactive metabolites
play. For example, a major limitation with resveratrol supplementation involves poor gut
absorption of the parent compound and fast metabolism to sulfate and glucuronide
products141. However, even with the short half-life of the parent compound, there is a
large body of evidence associating resveratrol supplementation with protective
phenotypes in vivo123a. This has led some research groups to investigate the bioactivity
of specific metabolites and observed protection via the activation of Sirtuin1(SIRT1) and
inhibition of cyclooxygenase123a. This is an important finding worthy of further exploration
because bioactive metabolites, such as the glucuronide and sulfate forms of resveratrol,
have much longer half-lives than the parent compound, which may qualify the
metabolites as more appropriate and effective nutritional modulators142. Also, our
laboratory has shown that oxidized metabolites of the bioactive omega-3 PUFA DHA are
more protective against such PCB-induced vascular toxicity compared to the parent
PUFA116a. Mechanistically, oxidation of PUFAs can lead to multiple F-type isoprostanes
with active cyclopentenone rings that have been shown to activate Nrf2, inhibit NFκB,
and decrease inflammation143. Also, other metabolically-relevant electrophilic fatty acid
modifications, such as nitro-fatty acids, may play a role in combating inflammation and
environmental toxicant-induced diseases144. Nitro-fatty acids are a newly discovered
class of modified lipids that exhibit anti-inflammatory properties via multiple
mechanisms145. Unsubstituted fatty acids such as oleic acid (18:1) and arachidonic acid
(20:4) can be nitrated endogenously by multiple enzymatic and non-enzymatic reactions,
resulting in the inhibition of pro-inflammatory mediators, induction of protective heme
oxygenase-1 and the relaxation of blood vessels146. This class of bioactive lipid can
protect via multiple mechanisms including upregulation of PPARγ and Nrf2 as well as
downregulation of pro-inflammatory NFκB147. More work needs to be accomplished to

25
elucidate the mechanistic impact of nitro and oxidized PUFAs on vascular inflammation
and toxicant-induced diseases. It appears that both oxidized PUFAs and nitro-fatty acids
are anti-inflammatory, which may implicate the importance of bioactive modified lipids in
a clinical and therapeutic setting. Although research linking bioactive lipids, vascular
inflammation and environmental toxicants is lacking, state of the art high-resolution mass
spectroscopy technologies are beginning to allow researchers to explore the most
efficient and physiologically-relevant bioactive compounds, which will in turn help further
the use of nutrition in a clinical and preventative setting.

26
1.2 Scope of Dissertation
1.2.1 Aims of dissertation
The general hypothesis of the research described herein is that coplanar PCBs
can promote cardiovascular disease by modulating endothelial cell caveolae. We also
hypothesize that nutritional modulation of PCB-toxicity is modulated through the cross-
talk between caveolae and Nrf2 signaling pathways. To test these hypotheses the
following Specific Aims were proposed:
Specific Aim 1: To test the hypothesis that endothelial PCB toxicity and associated
inflammatory events are regulated through the crosstalk between caveolae and Nrf2
related proteins such as Keap1.
Specific Aim 2: To test the hypothesis that dietary intervention with green tea
polyphenols can sensitize Nrf2 and/or caveolae signaling pathways, leading to a more
effective anti-inflammatory cellular defense/response against PCB insults in vivo.
Specific Aim 3: To test the hypothesis that treatment with nutrient metabolites, such as
nitro-fatty acids, instead of parent compounds will better sensitize Nrf2, caveolae, and/or
AhR signaling pathways leading to a more effective anti-inflammatory cellular response
against PCB insults.

27
Table 1.1 Proteins related to inflammation and atherosclerosis that are concentrated in
caveolae lipid micro-domains88
.
Protein
Name
Function Related to
Atherosclerosis
Cav-1 Inhibits eNOS, cholesterol
regulation
SRC Plaque destabilization
eNOS Vascular tone, Superoxide
production
ERK Inflammation
AhR NFκB induced inflammation
CD36 Involved in fatty acid uptake
PKC Inflammation, Vasoconstriction
ER α
and β
Control of eNOS
SR-B1 HDL scavenger receptor
gp60 Control of albumin transcytosis
Fyn Negative regulator of Nrf2
MMP-
1/2
Plaque destabilization

28
Fig. 1.1 Nutritional modulation of PCB-induced vascular toxicity. Bioactive nutrients
such as certain flavonoids found in fruits and vegetables or bioactive fatty acids such as
long chain PUFAs may work through caveolae and/or Nrf2 signaling to decrease the
toxicity of PCBs and related persistent organic pollutants (POPs). Coplanar PCBs
induce oxidative stress and inflammation, while certain bioactive food components are
anti-inflammatory and may be able and decrease the severity of toxicant-induced
disease.

Figure 1.2 The configuration and amount of chlorines evident in a specific PCB congener
relates directly to the molecular mechanism of toxicity of that congener. A. General structure of
a polychlorinated biphenyl with relevant nomenclature highlighted B. Structure of 3,3’,4,4’,5-
Pentachlorobiphenyl (PCB 126), a coplanar, non-ortho substituted PCB that exerts toxicity
primarily through the AhR C. Structure of 2,2’,4,4’,5,5’-Hexachlorobiphenyl (PCB 153), a non-
coplanar, di-ortho substituted PCB that does not bind the AhR and exerts toxicity primarily
through endocrine disruption.

30
Chapter 2: PCB 126 toxicity is modulated by cross-talk between caveolae and Nrf2
signaling98
2.1 Synopsis
Environmental toxicants such as polychlorinated biphenyls (PCBs) have been
implicated in the promotion of multiple inflammatory disorders including cardiovascular
disease, but information regarding mechanisms of toxicity and cross-talk between
relevant cell signaling pathways is lacking. To examine the hypothesis that cross-talk
between membrane domains called caveolae and nuclear factor (erythroid-derived 2)-
like 2 (Nrf2) pathways alter PCB-induced inflammation, caveolin-1 was silenced in
vascular endothelial cells, resulting in a decreased PCB-induced inflammatory response.
Cav-1 silencing (siRNA treatment) also increased levels of Nrf2-ARE transcriptional
binding, resulting in higher mRNA levels of the antioxidant genes glutathione s-
transferase and NADPH dehydrogenase quinone-1 in both vehicle and PCB-treated
systems. Along with this upregulated antioxidant response, Cav-1 siRNA treated cells
exhibited decreased mRNA levels of the Nrf2 inhibitory protein Keap1 in both vehicle
and PCB-treated samples. Silencing Cav-1 also decreased protein levels of Nrf2
inhibitory proteins Keap1 and Fyn kinase, especially in PCB-treated cells. Further,
endothelial cells from wildtype and Cav-1-/- mice were isolated and treated with PCB to
better elucidate the role of functional caveolae in PCB-induced endothelial inflammation.
Cav-1-/- endothelial cells were protected from PCB-induced cellular dysfunction as
evidenced by decreased vascular cell adhesion molecule (VCAM-1) protein induction.
Compared to wildtype cells, Cav-1-/- endothelial cells also allowed for a more effective
antioxidant response, as observed by higher levels of the antioxidant genes. These data
demonstrate novel cross-talk mechanisms between Cav-1 and Nrf2 and implicate the
reduction of Cav-1 as a protective mechanism for PCB-induced cellular dysfunction and
inflammation.

31
2.2 Introduction
Exposure to persistent environmental pollutants such as polychlorinated
biphenyls has been linked to the induction and/or exacerbation of multiple human
pathologies including diabetes and atherosclerosis24a, 24b, 25b, 49, 148. Specifically, coplanar
polychlorinated biphenyls (PCBs) have been shown to initiate the earliest stages of
atherosclerotic plaque formation, e.g., endothelial cell dysfunction and inflammation12b,
23b, 97.
Once utilized extensively for their productive thermal and electrical capabilities,
the production of PCBs and PCB mixtures, such as aroclors, was banned in the 1970s
due to further data highlighting their substantive public health concerns149. However,
PCBs continue to impact ecosystems and human health due to their environmental
prevalence and persistence (chemical stability)13b. Additionally, the lipophilic nature of
coplanar PCBs allows for their interaction with lipid membranes and lipid storage depots,
leading to bioaccumulation and biomagnification through the food chain. Even today,
PCB-containing products continue to be used in developing nations, further exposing
humans to high occupational levels of these harmful pollutants25a. In countries such as
the United States, the primary sources of exposure stem from air pollution and
contaminated food149a. Although multiple categories of PCBs have been developed,
dioxin-like, non-ortho-substituted coplanar PCBs such as PCB 77 and PCB 126 exhibit
the highest levels of in vitro and in vivo toxicity and pro-inflammatory properties,
especially in the vasculature18.
Once believed to be an innate barrier, endothelial cells now appear to play an
extremely important role in the initiation and progression of atherosclerosis3, 21, 150.
Coplanar PCBs can further promote endothelial cell inflammation and dysfunction
through caveolae lipid micro-domains151. Endothelial cell activation can lead to an
upregulation of adhesion molecules such as Vascular Cell Adhesion Molecule-1 (VCAM-
1) which promotes pro-inflammatory leukocyte infiltration and chemokine production that
left unchecked can lead to the formation of foam cells and subsequent arterial
blockage152. Coplanar PCBs can induce oxidative stress in endothelial cells and in turn
cause the upregulation of pro-inflammatory proteins through an NFκB-mediated
signaling cascade12b. Interestingly, it has been shown that PCBs may also be pro-

32
atherogenic by activating other pro-inflammatory pathways such as the lipid signaling
domain caveolae97.
Lipid raft microdomains known as caveolae are flask-shaped invaginations found
at the lipid membrane and have been shown to play important roles in endocytosis,
atherosclerosis, and environmental pollutant toxicity23b, 93. Caveolin-1 (Cav-1), the major
structural and signaling protein involved in the caveolae pathway, has been shown
through its “Cav-1 binding domain” (CBD) to interact and bind multiple other proteins,
many of which are involved in inflammation and atherosclerosis90, 92, 94. Coplanar PCBs
preferentially sequester in caveolae cellular fractions, and exposure to coplanar PCBs
upregulates Cav-1 protein expression and caveolae formation12b. Silencing Cav-1 via
siRNA technology prevents PCB-induced cytochrome P450-mediated superoxide
production and subsequent endothelial activation and dysfunction12b. Importantly, it has
been shown that aortic endothelial cells isolated from mice that lack the Cav-1 gene are
protected from toxicant-induced cellular dysfunction, but the mechanism of this
protection has yet to be elucidated12a.
Physiological systems have evolved multiple signaling pathways to limit the
toxicity of xenobiotics such as PCBs. The most significant regulator of redox status and
homeostasis, the nuclear factor (erythroid-derived 2)-like 2 (Nrf2) antioxidant pathway,
has been shown to be critical in protecting endothelial cells from PCB toxicity73b. Nrf2 is
primarily regulated by its major inhibitory protein, iNrf2 or Keap1, which promotes Nrf2’s
ubiquitination and maintains basal levels of Nrf2 activation. Nrf2 also can be inhibited by
Fyn kinase, which can promote Nrf2 nuclear exit and degradation153. Nrf2 also can be
directly activated via phosphorylation by kinases such as Akt and PKC delta99a, 154. Nrf2
can become activated by xenobiotic electrophiles, reactive oxygen species (ROS), and
bioactive phytochemicals found in healthful nutrition82a, 100, 123b. Multiple electrophilic
bioactive nutrients including components of ginseng, green tea and vegetables such as
broccoli have been shown to activate Nrf2, but interestingly, different nutrients may
induce Nrf2 through differing mechanisms (e.g., disruption of Keap1/Nrf2 interaction or
increased phosphorylation via relevant kinases137a, 155. Nrf2 has been shown to be
regulated through the cross-talk of multiple signaling cascade pathways such as the aryl
hydrocarbon receptor (AhR) and NFκB pathways86b, 138-139. Many xenobiotics such as
dioxins and coplanar PCBs can activate both AhR and Nrf2 simultaneously, and in fact,
this concordant upregulation can be evolutionarily explained since the gene promoter for

33
AhR contains multiple Nrf2 binding elements (AREs) and the promoter for Nrf2 contains
AhR binding sites (xenobiotic response elements)138. Evidence for direct cross-talk
between Nrf2 and NFκB is not as well understood, but multiple studies have shown that
activation of Nrf2 leads to a diminished pro-inflammatory NFκB response156.
Interestingly, we have previously shown that the AhR is a binding partner of Cav-112b
which has led us to hypothesize that novel cross-talk between Cav-1 and Nrf2 could
exist and that this cross-talk may help to explain mechanistically the protection from
coplanar PCBs observed in Cav-1 -/- animals.
Thus, the current study has been designed to investigate mechanistically how the
cross-talk between Cav-1 and Nrf2 can modulate PCB-induced cellular dysfunction. Our
data provide strong evidence that there are multiple levels of Cav-1/Nrf2 cross-talk and
that Cav-1 inhibits the Nrf2 antioxidant response. Thus, reduction or downregulation of
endothelial Cav-1 may lead to an upregulated antioxidant response regulated by Nrf2,
which could better prime a physiological system prior to toxicological insult.

34
2.3 Materials and Methods:
2.3.1 Materials and Chemicals
3,3′,4,4′,5-pentachlorobiphenyl (PCB 126) was obtained from AccuStandard Inc. (New
Haven, CT). VCAM-1 and Keap1 primary antibodies and horseradish peroxidase-
conjugated goat secondary antibody were purchased from Santa Cruz Biotechnology
(Santa Cruz, CA). β-actin and GST primary antibodies were purchased from Sigma (St.
Louis, MO). The GST antibody used recognized native as well as denatured-reduced
forms of GST protein. NQO1 primary antibody was purchased from Abcam (Cambridge,
MA). Fyn kinase, P-Akt, Akt, P-PKC delta and Nrf2 primary antibodies and horseradish
peroxidase-conjugated rabbit secondary antibody were purchased from Cell Signaling
Technologies (Danvers, MA).
2.3.2 Cell culture and experimental media
Primary vascular endothelial cells were isolated from porcine pulmonary arteries12a. Cells
were cultured in M199 (Gibco, Grand Island, NY), supplemented with fetal bovine serum
(FBS; Gibco). EAhy.926 human endothelial cells were cultured as described
previously12c. Endothelial cells were grown to confluence, followed by incubation
overnight in medium containing 1% FBS prior to cell treatment. Stock solutions of PCB
126 were prepared in DMSO; control cultures were treated with DMSO vehicle. The
levels of DMSO in experimental media were 0.05%. Porcine and human endothelial cells
were treated with PCB 126 at 0.25 μM for 16 h and mouse pulmonary endothelial cells
were treated with 2.5 μM for 24 h, which are established concentrations used previously
in our laboratory12a, 73b. Porcine primary endothelial cells, Eahy.926 human endothelial
cells, and isolated mouse endothelial cells contained Cav-1 protein levels (wildtype) and
exhibited VCAM-1 induction due to PCB 126 treatment, as previously reported12b, 12c.
Endothelial cells isolated from wildtype and Cav-1 -/- mice were identified by
morphology, platelet endothelial cell adhesion molecule-1 (PECAM1) bead pull-down,
and Von Willebrand Factor (VWF) protein expression.
2.3.3 Mouse endothelial cell isolation
Endothelial cells were isolated from Cav-1 deficient (Cav-1−/−) and wildtype mice (both
genotypes were purchased from Jackson Laboratory, Bar Harbor, ME). All animals were
housed in Association for Assessment and Accreditation of Laboratory Animal Care-
certified animal facilities at the University of Kentucky. Age matched C57BL/6 mice

35

were used as controls because Cav-1-deficient mice are backcrossed onto C57BL/6
mice. Endothelial cells were isolated and cultured as described previously157. Briefly,
whole lungs were homogenized in culture media containing type II collagenase and
dispase. Cells were added to gelatin-coated tissue culture plates in DMEM media
containing 20% FBS, heparin, antibiotics, and endothelial cell growth supplement.
Endothelial cells were preferentially selected by using an antibody-coated magnetic
bead mix (Invitrogen, Carlsbad, CA. Briefly, sheep anti-rat IgG beads were prepared
and mixed with rat anti-mouse CD31 PECAM antibodies overnight (BD Biosciences, San
Jose, CA). Bead/antibody conjugates were collected via magnetic separation and
subsequently were incubated for 1 h with cells isolated from lungs. Cells were then
trypsinized, transferred to a magnetic separator, and magnetically bound cells were
seeded in 35mm plates. Endothelial cell isolation was confirmed by cobblestone
morphology and the presence of VWF endothelial cell marker.
2.3.4 Real-time PCR
The levels of mRNA expression were assessed by real-time PCR using a 7300 Real-
Time PCR System (Applied Biosystems,Foster City, CA) and SYBR Green master mix
(Applied Biosystems) as described earlier12a. Sequences were designed using the
Primer Express Software 3.0 for real-time PCR (Applied Biosystems) and synthesized by
Integrated DNA Technologies, Inc. (Coralville, IA). Sequences for porcine VCAM-1 and
β-actin were described in earlier articles published from our laboratory23b, 158. Porcine
NQO1 sequences were: sense, 5′-CCCGGGAACTTTCAGTATCCT-3′; and antisense, 5′-
CTGCGGCTTCCACCTTCTT-3′; porcine GST-omega 1 sequences were: sense, 5′-
GCTGAGCCAAGTGGGAGACA-3′; and antisense, 5′CCTCGGCCATTGAAATAGTGA-
3′; Porcine Keap1 sequences were: sense, 5’ AGCTGGGATGCCTCAGTGTT-3’; and
antisense, 5’-AGGCAAGTTCTCCCAGACATTC-3’; porcine GPx1 sequences were:
sense, 5′-TGCCTTCAATCCGGAGGTAA-3′; and antisense,
5′GAATGGGATGACCTGGAAGTTAGT-3′; porcine MRP1 sequences were: sense, 5′-
GTCCTGTTTGCTGCCTGTT-3′; and antisense, 5′AGTATGCGGTGATCTGCAGTGA-3′;
2.3.5 Cav-1 siRNA and transfection studies
Double stranded small interfering RNA targeting Cav-1 was synthesized as described
previously12c, 159. Porcine endothelial cells and human endothelial cells were transfected
with control or Cav-1 siRNA at a ﬁnal concentration of 80 nM using GeneSilencer
transfection reagent (Genlantis, SanDiego, CA) in OptiMEM serum free media. Cells

36

were incubated with the transfection mixture for 4 h, followed by the addition of 10% FBS
to the cell media. Cells were used for treatments after 48 h incubation.
2.3.6 Immunoblotting
Western blot analyses for VCAM-1, β-actin, NQO1, Keap1, Fyn kinase, GST, Nrf2, P-
PKC delta and P-Akt were performed as described previously12a. Briefly, cells were
lysed in RIPA buffer, centrifuged and the protein concentrations were determined via
Bradford Assay. Proteins were separated via 10% SDS-PAGE, transferred to
nitrocellulose membranes, and blocked in 5% non-fat milk or BSA. Primary antibodies
were added at a concentration of 1:1000 overnight and appropriate secondary
antibodies subsequently were added for 2 h at a concentration of 1:4000.
2.3.7 Preparation of nuclear extracts and electrophoretic mobility shift assay (EMSA)
Nuclear extracts of endothelial cells were prepared using NE-PER nuclear extraction
reagents (Thermo, Rockford, IL) according to the manufacturer’s protocol. Nuclear
extract concentrations were determined using Bradford reagent (Bio-Rad, Richmond,
CA). DNA binding activities of Nrf2 were determined using a LightShift
Chemiluminescent EMSA kit (Pierce, Rockford, IL) according to the manufacturer’s
protocol. DNA-binding reactions were performed with a final volume of 20 µL buffer
containing 5 µg of nuclear extract, 50 ng/µL Poly (dI•dC), and biotin end-labeled
oligonucleotides. Synthetic 5’-biotinylated complementary oligonucleotides were
purchased from Integrated DNA Technologies (Coralville, IA). Oligonucleotides
containing the antioxidant response element (ARE) sequence from the porcine NQO1
promoter (5’-TAGTCACAGTGACTCAGCGAGATTC-3’) were used as described
previously159b.
2.3.8 Statistical analysis
Data were analyzed using SigmaStat software (Systat Software, Point Richmond, CA).
Comparisons between treatments were made by two-way ANOVA with post-hoc
comparisons of the means. To elucidate trends within groups, multiple comparison
procedures were completed for tests that displayed overall significance (p≤0.05-0.1).
Groups were considered significantly different with a determined p value of p<0.05.

37

2.4. Results
2.4.1 Cav-1 silencing prevents PCB-induced endothelial cell dysfunction by increasing
antioxidant gene expression
Previously, we have shown that coplanar PCBs can initiate cellular dysfunction,
as evidenced by an increase in VCAM-1 protein levels, in endothelial cells that contain
functional caveolae12a, 12b. Here, we treated primary porcine vascular endothelial cells
with a single low dose (0.25 µM) of PCB 126 for 16 h and saw a statistically significant
upregulation of VCAM-1 mRNA expression in control siRNA treated cells (Fig. 2.1).
However, this upregulation was not observed in cells treated with Cav-1 siRNA. We
have previously shown that the antioxidant controller Nrf2 is critical for cellular defense
against PCB toxicity, thus we hypothesized that Cav-1 silenced cells were protected
through a Cav-1/Nrf2 cross-talk mechanism. Cav-1 siRNA treated cells displayed
increased Nrf2- antioxidant response element (ARE) transcriptional binding (EMSA)
which was most evident when comparing between baseline levels of vehicle DMSO
treated groups (Fig. 2.2B). We then investigated, via real time PCR (RT-PCR), mRNA
expression levels of two major Nrf2 target genes GST and NQO1 and saw statistically
significant increases of expression for both genes in cells treated with Cav-1 siRNA
compared to control scrambled siRNA (Fig. 2.2A). As with the EMSA results, the most
drastic and significant differences between Cav-1 and control siRNA treated cells were
seen in DMSO vehicle groups. Basal levels of GST expression were approximately 10
fold higher in Cav-1 siRNA treated cells but only approximately 5 fold higher in Cav-1
siRNA treated cells after exposure to PCB. NQO1 levels were also significantly higher in
cells silenced for Cav-1 but to much less of a degree (Fig. 2.2A). Additionally, NQO1
basal protein levels were significantly increased in Cav-1 transfected cells after 48 h
compared to control transfected cells (Supplemental. Fig. 2.1A). Finally, basal mRNA
levels of two additional Nrf2 targets, glutathione peroxidase-1 (GPX1) and multi-drug
resistance protein-1 (MRP1) were compared between Cav-1 and control transfected
cells, and it was determined via RT-PCR that even after just 24 h of Cav-1 transfection,
expression levels of both of these cytoprotective genes were doubled in cells silenced
for Cav-1 (Supplemental Fig. 2.1B).

38
2.4.2 Decreased Cav-1 expression promotes Nrf2 activity by decreasing levels of
multiple Nrf2 inhibitory proteins
Nrf2 is inhibited by multiple factors including Keap1 and Fyn kinase; therefore we
investigated levels of these proteins in an attempt to elucidate further novel mechanisms
of Cav-1/Nrf2 cross-talk (Fig. 2.3). To explain the upregulated Nrf2 activity in Cav-1
depleted cells, we hypothesized that levels of these inhibitory proteins necessarily would
be diminished early on during PCB exposure. Thus, we treated human endothelial cells
(HUVEC fusion) with control or Cav-1 targeted siRNAs and subsequently exposed the
HUVEC-based cell line to 0.25 µM PCB 126 for a minimal time duration (4 h). As
expected, PCB exposure caused a decrease in protein expression of the Nrf2 inhibitory
proteins Keap1 and Fyn kinase in both Cav-1 and control siRNA treated cells. More
importantly, at basal DMSO conditions, cells silenced for Cav-1 also displayed
significantly lower levels of Keap1 and Fyn compared to DMSO-treated control siRNA
cells. Exposing PCB to these Cav-1 silenced cells resulted in a statistically significant
decrease in Fyn and Keap1 compared to Cav-1 silenced cells treated with DMSO.
Although antibodies for Fyn and Keap1 used by our laboratory did not work considerably
well in our mouse and porcine models, we did examine, via RT-PCR, Keap1 mRNA
levels in Cav-1 silenced porcine cells and observed similarly significant trends as with
human endothelial cell protein data (Fig. 2.8). Finally, whole livers were harvested from
wildtype and Cav-1 -/- mice, and via RT-PCR it was determined that Cav-1 -/- mice
expressed approximately 50% mRNA expression levels of Keap1 in the liver compared
to age matched wildtype controls (n=4 for each genotype, Fig. 2.9). This observed
decrease in Keap1 in whole livers of Cav-1 -/- was similar to the diminished levels
observed in endothelial cells from porcine or human silenced for Cav- 1(compare to Fig.
2.3 or Fig. 2.8); which is interesting due to the fact that multiple cell types can be found
in whole liver lysates).
2.4.3 Decreased Cav-1 expression promotes the phosphorylation of Akt but not
phosphorylation of PKC delta.
Alternative mechanisms of Nrf2 activation have been investigated including direct
phosphorylation of Nrf2 by PKC delta and Akt. To investigate the ability of Cav-1
silencing to alter either of these Nrf2 effectors, human endothelial cells were transfected
with either scrambled or Cav-1 targeting siRNAs and subsequently treated with 0.25 µM
PCB 126 for 4 h. Interestingly, Cav-1 silencing decreased levels of phosphorylated PKC

39
delta in both DMSO and PCB treatment groups, although significantly increased levels of
phosphorylated Akt were seen in baseline vehicle treatment groups but not when treated
with PCB (Fig. 2.4).
2.4.4 Cells isolated from Cav-1 -/- mice are protected from PCB-induced inflammation
via upregulated Nrf2 activity
Lung endothelial cells were next isolated from Cav-1 deficient and wildtype mice
of the same background and subsequently exposed to coplanar PCB 126 to confirm the
importance of Cav-1/Nrf2 cross-talk in PCB-induced toxicity. VCAM-1 protein levels
were measured via Western blot and quantified via densitometry. As mirrored in the
siRNA experiments utilizing porcine cells, PCB 126 only increased cellular dysfunction
(VCAM-1 induction) in cells isolated from C57BL/6 mice and not Cav-1 -/- mice (Fig.
2.5). We attribute this protection in Cav-1 -/- mice to the considerably higher protein
levels of antioxidant enzymes such as NQO1 and GST. Cells isolated from Cav-1 -/-
mice displayed approximately 10 fold and 3 fold increases in NQO1 and GST,
respectively, in vehicle treated groups when compared to cells isolated from C57Bl/6
control mice (Fig. 2.5). Treating mouse endothelial cells with PCB resulted in the same
trends observed in the previous porcine siRNA experiments (e.g. decreased levels of
GST and higher levels of NQO1 compared to DMSO vehicle). Importantly, although an
overall interactive effect was not seen, we did see a trend toward significance (P=0.072)
for increased Nrf2 protein levels in cells isolated from Cav-1 -/- mice when comparing
baseline DMSO groups between mouse genotypes (Fig. 2.5). Combining this finding
with the EMSA results displayed in Fig. 2.2B, together, help to show that a decrease in
cellular Cav-1 protein promotes upregulated Nrf2 activity that is evident in multiple
species.
2.5. Discussion
There is a growing body of evidence that implicates human exposure to
persistent organic pollutants (POPs) such as polychlorinated biphenyls with increased
risk of inflammatory related diseases such as atherosclerosis. The endothelium is a
major target of PCB toxicity due to, e.g., constant low dose release from adipose fat
stores caused by dynamic equilibrium and/or weight loss. Understanding the multiple
signaling pathways involved and their cross-talk is a critical step in designing

40

preventative and therapeutic methods to counteract pollutant-induced endothelial cell
dysfunction and inflammation.
The importance of caveolae, lipid rafts, and Cav-1 in inflammation and heart
disease has become a source of much research, but until recently, cross-talk between
caveolae-related proteins and other factors has not been elucidated. Now, evidence
points to interactions between Cav-1, AhR, and Nrf2, all proteins involved in
inflammation and toxicant-induced disease12b, 140, 160. This work shows that a low dose of
coplanar PCB 126 is sufficient to induce a pro-inflammatory endothelial cell environment
and that loss of Cav-1 is protective and results in increased Nrf2 activity via multiple
novel cross-talk mechanisms.
Coplanar PCBs have been shown to induce early stages of atherosclerosis via
altering the cellular redox balance. Treatment with coplanar PCBs such as PCB 77 or
PCB 126 has been shown in endothelial cells to increase oxidative stress, and
inflammatory markers such as MCP-1 expression, and monocyte adhesion, but
protection is seen in cells and mice deficient for the Cav-1 gene12a, 12b, 23b. The pro-
inflammatory effects of PCBs may be linked to their uptake via caveolae, and the work
described here suggests that Cav-1 deficiency protects against PCB-induced cellular
dysfunction by allowing for a more effective Nrf2-controlled antioxidant response.
Previously it was believed that lack of Cav-1 protected these cells and animals from PCB
toxicity through an impaired PCB uptake mechanism. Previous work in our laboratory
further has shown that PCBs preferentially sequester in the caveolae fraction of
endothelial cells and PCB treatment increases the formation of functional caveolae at
the lipid membrane12b. Disruption of functional caveolae and/or downregulation of Cav-1
may protect against toxicant-induced cytotoxicity via multiple mechanisms including
altering the uptake of contaminants, altering toxicity kinetics and, as described in this
work, inducing an upregulated Nrf2 antioxidant response. However, specific uptake
mechanisms of PCBs may vary in different cell types and among congener of PCBs
which may implicate the importance of the upregulated Nrf2 response over other
mechanisms of protection in certain cell types and cellular conditions161. Loss of Cav-1
has been shown by our laboratory and others to cause an upregulated Nrf2 antioxidant
response159b, but until recently, mechanisms of this cross-talk had not been elucidated.
Two groups have now shown that Nrf2 can be added to a growing list of proteins that
can be inhibited by Cav-1 via direct binding within the cell140, 160. These studies,

41

however, did not highlight other possible mechanisms of cross-talk such as decreased
Keap1 or Fyn kinase levels in Cav-1 diminished cells. Here, we show that protein levels
of Keap1 and Fyn are diminished in cells silenced for Cav-1, which may help to
mechanistically explain the observed upregulated Nrf2 response. Keap1 has been
indicated as the major inhibitor of Nrf2 by promoting ubiquitination and subsequent
proteosomal degradation. Very little is known however about cellular regulation of
Keap1 expression levels, especially during transcription. Studies have shown that
Keap1 levels can be decreased by epigenetic mechanisms as well as endogenous
microRNAs, but future work is required to clarify the mechanism connecting diminished
Cav-1 levels with decreased Keap1 expression162. It is important to mention that some
groups have shown that loss of Cav-1 in certain cell types, especially in a cancer
environment, promotes oxidative stress and can drastically alter tumor recurrence163. In
our endothelial cell models, though, we have not observed an increase in ROS levels
with Cav-1 siRNA treatment and have only observed PCB-induced cellular dysfunction in
mice and endothelial cells that have wildtype levels of Cav-112b. It will be important to
create endothelial specific Cav-1 -/- mice in the future to better understand important
connections between endothelial Cav-1, oxidative stress levels, Nrf2, and protection
from xenobiotic-induced toxicity.
Recently, alternative mechanisms of Nrf2 activation have been described
including direct phosphorylation by PKC delta and Akt. Articles have implicated Cav-1
as a direct inhibitor of multiple PKCs, and loss of Cav-1 has resulted in increased PKC
auto-phosphorylation and activation164. Interestingly, we did not observe this trend with
the PKC isotype that has been shown to directly activate Nrf2 (Fig. 2.4). Some groups
have shown, however, that activation of PKC isoform delta can be detrimental to the
vasculature and can play an important role in the promotion of cardiovascular diseases,
indicating that an increase in activated PKC delta may not be all positive165. Activated
Akt, however, was significantly increased in cells treated with Cav-1 siRNA. An
interaction between Cav-1 and Akt has been implicated previously, but more work is
necessary to determine if this observed increase in Akt can be correlated with Nrf2
activation166. Future experiments should also investigate Cav-1’s role in other cellular
Nrf2-related kinases such as phosphatidylinositol 3-kinase (PI3K), mitogen-activated
protein kinase (MAPK), ER-localized pancreatic endoplasmic reticulum kinase (PERK),
and protein kinase CK2167. Here, we add to a growing body of evidence that cross-talk

42

between Cav-1 and Nrf2 exists and that multiple mechanisms of cross-talk may be
evident (Fig. 2.6).
Downregulation of endothelial Cav-1 may prove to be an effective modulator of
toxicant-induced disease as well as other pathologies hallmarked by chronic
inflammation. We have shown previously that healthful nutrition, which is high in
bioactive food components such as polyphenols and omega-3 polyunsaturated fatty
acids, can protect against PCB-induced cellular dysfunction73b, 116a, 155a. Laboratories
have shown that these nutrients may protect through multiple mechanisms including
disruption of functional caveolae, increased Nrf2 activity, and decreased NFκB
activation73b, 115b, 116b, 126, 158. It is plausible to hypothesize that the cross-talk between
Cav-1 and Nrf2 pathways is critical for nutritional and/or pharmacological modulation of
toxicant-induced disease. For example, statin treatment (simvastatin) can downregulate
Cav-1 protein levels and activate endothelial nitric oxide synthase (eNOS)168. Also,
eNOS upregulation via statins was not as profound in Cav-1 deficient human endothelial
cells169. To create more targeted and effective nutritional and pharmacological
therapeutics, more work is needed to better elucidate the impact on the increasingly
complex cross-talk between caveolae and Nrf2 (Fig. 2.6).
Our data suggest that cross-talk between Cav-1 and Nrf2 exists and may be
more complex than described previously. Cav-1 inhibits Nrf2 activation, and decreasing
Cav-1 levels increases the expression of Nrf2 target genes. This increased induction of
protective genes may help to explain why cells and mice lacking Cav-1 are protected
against pro-inflammatory polychlorinated biphenyl exposure. Our studies provide
concordant findings from experiments using cellular models from three different
mammalian species, i.e., pig, mouse, and human, suggesting some relevance of our
findings to human health and risk assessments. Caveolae and Nrf2-related proteins
may prove to be important targets for effective nutritional and/or pharmacological
protection against the toxicity of pro-inflammatory xenobiotics.

43

Fig. 2.1. Expression of VCAM-1 mRNA in porcine vascular endothelial cells exposed to
coplanar PCB 126. Cells were transfected with either scrambled control or Cav-1
targeted siRNA for 48 h and subsequently exposed to PCB 126 at a concentration of
0.25 µM for 16 h. mRNA levels were measured using real-time PCR. Results were
normalized to β-actin and are depicted as fold change compared to control siRNA
DMSO treatments. Results represent the mean± SEM (n=2 for each treatment group).
PCB 126 increases VCAM-1 mRNA levels only in endothelial cells with Cav-1 (*p<0.05).
0
0.5
1
1.5
2
2.5
Control siRNA Cav-1 siRNA
VCAM-1/β-actin(FoldChange)
DMSO
PCB
*
p=0.056

44

Fig. 2.2. Expression of antioxidant enzymes and Nrf2 transcriptional binding in cells
silenced for Cav-1. Porcine endothelial cells were transfected with either scrambled
control or Cav-1 targeted siRNA for 48 h and subsequently exposed to PCB 126 at a
concentration of 0.25 µM for 16 h. mRNA levels of GST and NQO1 were measured
using real-time PCR. Results were normalized to β-actin and graphed as fold change
compared to control siRNA DMSO treatments. Results represent the mean± SEM (n=2
for each treatment group). (A) Cells silenced for Cav-1 display increased mRNA levels
of GST in both vehicle and PCB treated groups compared to control siRNA transfected
cells (*p<0.05). GST levels were diminished in Cav-1 siRNA transfected cells when
exposed to PCB, but these levels were still statistically significantly higher than control
siRNA transfected cells exposed to PCB (*p<0.05). Also, PCB treatment increased the
expression of NQO1 in both Cav-1 siRNA and control siRNA groups (*p<0.05), and there
was a significant trend of increased expression in cells silenced for Cav-1 (p=0.063). (B)
Cells silenced for Cav-1 display increased levels of Nrf2 – ARE binding as determined
by EMSA compared with control siRNA transfected cells.

Fig. 2.3. Expression of Nrf2 inhibitory proteins is decreased in cells silenced for Cav-1.
Human endothelial cells were transfected with either scrambled control or Cav-1
0.25 µM for 4 h. Protein levels of Keap1 and Fyn kinase were measured via western
blot. Results were normalized to β-actin and graphed as fold change compared to
control siRNA DMSO treatments. Results represent the mean±SEM (Fyn: n=2, Keap1:
n=3 for each treatment group). Cells silenced for Cav-1 display decreased protein levels
of Keap1 and Fyn in both vehicle and PCB treated groups compared to control siRNA
transfected cells (*p<0.05). PCB treatment also significantly decreased Fyn and Keap1
levels within transfection groups (*p<0.05). Western blot above shows representative
sample of visual results.
Keap1
Fyn
Kinase
β-actin
0
0.2
0.4
0.6
0.8
1
1.2
Fynprotein/β-actin(Fold
Change)
DMSO
PCB
*
P=0.053
*
0
0.2
0.4
0.6
0.8
1
1.2
Keap1protein/β-actin(Fold
Change)
DMSO
PCB
*
*
*
*
45

46

Fig. 2.4. Expression of phosphorylated Akt and PKC delta proteins in human endothelial
cells exposed to coplanar PCB 126. Cells were transfected with either scrambled
control or Cav-1 targeted siRNA for 48 h and subsequently exposed to PCB 126 at a
concentration of 0.25 µM for 4 h. Protein levels of P-Akt and P-PKC delta were
measured via Western blot. Results were normalized to β-actin and depicted as fold
change compared to control siRNA DMSO treatments. Results represent the
mean±SEM (n=3 for each treatment group). Cells silenced for Cav-1 display decreased
protein levels of P-PKC delta in both vehicle and PCB treated groups. Cells targeted
with Cav-1 siRNA and treated with DMSO vehicle had significantly increased levels of P-
Akt compared to control transfected cells also treated with DMSO (*p<0.05). Western
blot above shows representative sample of visual results.

47

Fig. 2.5. Confirmation of Cav-1 Nrf2 cross-talk in cells isolated from Cav-1 -/- mice.
Endothelial cells from Cav-1 -/- and age matched wildtype control mice were isolated
and subsequently exposed to PCB 126 at a concentration of 2.5 µM for 24 h. Protein
levels of NQO1, VCAM-1, GST and Nrf2 were measured via Western blot. Results were
normalized to β-actin and depicted as fold change compared to control siRNA DMSO
treatments. Results represent the mean±SEM (NQO1, GST, Nrf2: n=3, VCAM-1: n=2 for
each treatment group). Cells isolated from Cav-1 -/- mice did not display PCB-induced
VCAM-1 upregulation and showed significantly increased levels of NQO1 (*p<0.05).
Cells isolated from Cav-1 -/- mice displayed significantly higher levels of GST under
DMSO vehicle conditions compared to wildtype cells treated with DMSO (*p<0.05).
Also, cells isolated from Cav-1 -/- mice displayed a trend toward being significantly
increased compared to vehicle treated control cells. Western blots above show
representative samples of visual results.

48

Fig. 2. 6. The induction of Nrf2 is controlled by multiple inhibitory proteins and a
complex regulatory mechanism. A) Keap1 is the major inhibitory protein of Nrf2 and
facilitates Nrf2’s ubiquitination and destruction. B) Caveolin-1, the major structural
protein of lipid raft caveolae, binds and inhibits Nrf2. Also, caveolae concentrate other
proteins involved in Nrf2 activation such as Akt which is known to phosphorylate and
activate Nrf2. Cav-1 is also a binding partner of the Aryl hydrocarbon receptor which is
known to bind cis-acting sequences in the Nrf2 promotor. C) Upon Nrf2 activation and
subsequent translocation to the nucleus, additional regulatory mechanisms exist to
remove Nrf2. Direct phosphorylation from Fyn kinase or Bach1 decreases the Nrf2
nuclear pool. Cav-1 may also regulate Fyn and/or Bach1 levels via an unknown
mechanism. If Nrf2 evades cellular destruction and remains in the nucleus, the
transcription factor can bind co-activators, bind cis-acting antioxidant response elements
on DNA, and upregulate a battery of antioxidant related proteins such as GST and
NQO1.

49
Fig. 2.7. Expression of antioxidant enzymes in cells silenced for Cav-1. Porcine
endothelial cells were transfected with either scrambled control or Cav-1 targeted
siRNA for (A) 48 h or (B) 24 h. (A) NQO1 protein levels were measured via Western
blot. Results were normalized to β-actin and depicted as fold change compared to
control siRNA groups. Results represent the mean±SEM (n=5-6 for each group).
Silencing of Cav-1 for 48 h increases basal levels of NQO1 protein (*p<0.05). Western
blots above show representative samples of visual results. (B) mRNA levels of the Nrf2
targets Glutathione Peroxidase-1 (GPx1)and Multi-drug resistance protein 1 (MRP1)
were measured using real-time PCR. Results were normalized to β-actin and graphed
as fold change compared to control siRNA groups. Results represent the mean± SEM
(n=7-8 for each group). Cells silenced for Cav-1 display increased mRNA levels of
GPx1 and MRP1(*p<0.05).

50
Fig. 2.8. Expression of Keap1 mRNA in porcine endothelial cells exposed to vehicle and
coplanar PCB 126. Cells were transfected with either scrambled control or Cav-1
0.25 µM for 16 h. mRNA levels of Keap1 were measured via RT-PCR. Results were
normalized to β-actin and depicted as fold change compared to control siRNA DMSO
treatments. Results represent the mean±SEM (n=3 for each treatment group). Silencing
Cav-1 resulted in decreased Keap1 mRNA expression levels in both vehicle and PCB
treated cells (*p<0.05).
0
0.2
0.4
0.6
0.8
1
1.2
Keap1/β-actin
(FoldChange)
DMSO
PCB
*
*

51
Fig. 2.9. Expression of Keap1 mRNA in livers from age matched wild-type C57BL6
mice and Cav-1 -/- mice. mRNA levels of Keap1 were measured via RT-PCR. Results
were normalized to 18S and depicted as fold change compared to control mice.
Results represent the mean±SEM (n=4 for each treatment group). Loss of Cav-1
resulted in decreased Keap1 mRNA expression levels (p=0.049 for one tailed t-test and
p=0.098 for two tailed t-test).
0
0.2
0.4
0.6
0.8
1
1.2
1.4
C57BL6 Control Cav-1 -/-
Keap1/18S(FoldChange)
p=0.049 (one tail)

52

Chapter 3. Green tea diet decreases PCB 126-induced oxidative stress in mice by
upregulating antioxidant enzymes129b
3.1 Synopsis
Superfund chemicals such as polychlorinated biphenyls pose a serious human
health risk due to their environmental persistence and link to multiple diseases such as
atherosclerosis, diabetes, and cancer. Selective bioactive food components such as
flavonoids/polyphenols have been shown to ameliorate PCB toxicity, but primarily in an
in vitro setting. Here, we show that mice fed a green tea-enriched diet and subsequently
exposed to multiple doses of coplanar PCB exhibit decreased overall oxidative stress
levels primarily due to the upregulation of a battery of antioxidant enzymes. C57BL/6
mice were fed a low fat diet supplemented with green tea extract for 12 weeks and
exposed to 5 µmol PCB 126/kg mouse weight (1.63 mg/kg-day) on weeks 10, 11 and 12.
HPLC-MS/MS plasma analysis showed that mice supplemented with green tea extract
and subsequently exposed to PCB displayed a decrease in overall F2-Isoprostane levels
compared to animals on a control diet exposed to PCB. Livers were collected and
harvested for both mRNA and protein analyses, and it was determined that many genes
transcriptionally controlled by the aryl hydrocarbon receptor (AhR) and nuclear factor
(erythroid-derived 2)-like 2 (Nrf2) proteins were upregulated in PCB-exposed mice fed
the green tea supplemented diet. An increased induction of genes such as SOD1, GSR,
NQO1 and GST in these mice (green tea plus PCB) may explain the observed decrease
in overall oxidative stress. A diet supplemented with green tea allows for an efficient
antioxidant response in the presence of PCB 126 which supports the emerging paradigm
that healthful nutrition may be able to bolster and buffer a physiological system against
the toxicities of environmental pollutants.

53

3.2 Introduction
The contamination of soil and groundwater aquifers by toxic chlorinated organic
compounds at Superfund sites, e.g., polychlorinated biphenyls (PCBs) and
trichloroethylene (TCE), is a pervasive environmental problem with serious public health
consequences170. PCBs are persistent organic pollutants found in soil, air, and water,
and a major source of human exposure to PCBs is from dietary intake of contaminated
foods. Because PCBs are lipid soluble, they readily accumulate in human tissues, thus
increasing human health concerns27. For example, results from the recent Aniston
Community Health Survey observed a significant correlation between PCB levels and
diabetes36f, and circulating levels of PCBs were associated with atherosclerotic
plaques171. Prenatal exposure to PCBs also may be associated with increased weight in
children172. The liver is one tissue particularly vulnerable to PCB-induced toxicity
because it is the primary organ associated with detoxification, and there is strong
evidence from NHANES data that PCBs are associated with liver disease in humans173.
There is evidence that nutrition can modulate the toxicity of environmental
pollutants174 and thus affect the vulnerability to environmental insults and compromised
health. For example, PCBs can act as diet-dependent obesogens when administered
with a high-fat diet, and thus worsen nonalcoholic fatty liver disease175. We have
previously shown that PCB insult can modify lipid metabolism while dietary fat
supplementation can ameliorate these negative effects112. For example, we have shown
that PCB exposure increases neutral lipid staining in LDL-R−/− mice fed a corn oil-
enriched diet (i.e., a diet rich in omega-6 fatty acids), indicating increased inflammation,
while inflammation was decreased in mice fed an olive oil-enriched diet. Additionally,
omega-3 fatty acids derived from fish oil are protective and reduce PCB-induced toxicity
in endothelial cells126;116a. Similarly, antioxidant nutrients such as dietary flavonoids can
protect against endothelial cell damage mediated by these persistent organic
pollutants128a;73b. This is important since coplanar PCBs (e.g., PCB 126) exert their
toxicity primarily through activation of the aryl hydrocarbon receptor (AhR) and
subsequent uncoupling of cytochrome P450 1A1 (CYP1A1), which can be a source of
oxidative stress176;177.
Mammalian cells are constantly bombarded with endogenous and exogenous
sources of free radicals which tip the cellular balance towards an overall oxidative stress
condition. To counteract the ubiquitous nature of reactive oxygen species (ROS), such

54

as superoxide (O.- ), and reactive intermediates, such as hydrogen peroxide (H2O2),
mammalian cells have evolved intricate and interrelated protein defenses that can work
efficiently to limit the detrimental effects of these toxic molecules. PCBs have been
shown to cause oxidative stress primarily through a CYP1A1 uncoupling mediated
mechanism178. Production of O.- and related ROS triggers an upregulation of a battery of
antioxidant enzymes such as superoxide dismutase (SOD), catalase, glutathione
reductase (GSR), glutathione transferases (GST), thioredoxins (Trx) and thioredoxin
reductases (TrxR)179. These proteins work in concert to either catalyze the
transformation of ROS to benign molecules such as water and molecular oxygen or to
reactivate enzymes, usually by catalytic reductions (e.g. TrxR reduces oxidized Trx to its
active form180). Such an interconnected system requires the crosstalk of multiple
regulatory pathways including AhR and Nrf2 to function as intended (see Fig. 3.1).
The aryl hydrocarbon receptor (AhR) and nuclear factor (erythroid-derived 2)-like 2
(Nrf2) transcription factors work together to detoxify xenobiotics and to upregulate the
antioxidant response. Upon activation via endogenous ligands, such as arachidonic acid
metabolites, or xenobiotics, such as dioxin (TCDD) or coplanar PCB 126, the AhR
translocates to the nucleus, binds consensus cis-acting sequences known as dioxin or
xenobiotic response elements (DRE or XRE) and facilitates the upregulation of multiple
genes, especially those related to phase II detoxification (e.g. CYP1A1 and UDP-
glucuronosyl S-transferases)181. Certain environmental toxicants with relatively long
half-lives, such as TCDD and PCB 126, can promote sustained AhR activation resulting
in chronic low levels of oxidative stress and inflammation182. The Nrf2 pathway shares
many target genes with AhR, but is generally regarded as more of a redox sensor, as its
dissociation with inhibitory proteins (e.g. Keap1) and subsequent transactivation is
promoted by ROS and electrophiles82a. Binding of Nrf2 to consensus antioxidant
response elements (ARE) upregulates a battery of protective genes including
cytochrome P450s, GSTs and NAD(P)H dehydrogenase [quinone] 1 (NQO1)136a. Nrf2 is
a critical mediator of oxidative stress and xenobiotic toxicity as evidenced by multiple
studies involving Nrf2 KO mice183,184. It appears that the interrelatedness of Nrf2 and
AhR pathways is not a coincidental occurrence as recently intimate cross-talk between
the two xenobiotic related proteins has been illustrated138. In fact, AhR and Nrf2
promoter gene sequences contain binding sites for one another and in instances where
either is absent (e.g., KO) a non-optimal protective response occurs139. Importantly,

55
bioactive nutrients such as tea catechins may work through both Nrf2- and AhR-
mediated mechanisms to prevent toxicant-induced global inflammation73b.
We have demonstrated previously that the tea catechin epigallocatechin-3-gallate
(EGCG) can protect against vascular endothelial cell activation by coplanar PCBs73b, 158,
and that EGCG can inhibit AhR-regulated genes and induce Nrf2-regulated antioxidant
enzymes, thus providing protection against PCB-induced inflammatory responses in
cultured endothelial cells73b. EGCG also can inhibit oxidative damage and attenuate
carbon tetrachloride-induced hepatic fibrosis185. Mechanisms responsible for EGCG-
induced protection against environmental pollutants are not fully understood. In the
current study we provide evidence that green tea extract, composed primarily of EGCG
(see Table 3.3), can decrease oxidative stress in livers of mice exposed to PCB 126
and that part of the protection is due to induction of antioxidant genes. Thus, diet
supplementation with green tea may allow for an efficient antioxidant response to buffer
against toxicities of environmental pollutants in humans129a.
3.3. Materials and Methods
3.3.1 Animals, diets, and dosing treatments
Forty C57BL/6 mice were purchased from Jackson Laboratory (Bar Harbor, ME) at 2
months of age and evenly assigned to the following experimental groups: control diet
(10% kcal as fat) + vehicle, control+1% green tea extract (GTE) + vehicle, control + PCB
126, control+1% GTE + PCB 126. The control diet was purchased from Research Diets,
Inc. (New Brunswick, NJ, catalog number D12450B). Sunphenon 30S-O organic green
tea extract (lot number: 105131, containing 37.4% total polyphenols, 32.0% total
catechins, and 5.3% caffeine) was obtained from Taiyo International Inc. (Minneapolis,
MN) and incorporated into the control diet formulation, as described in Table 3.3. Green
tea extract treatment amounts per body weight coincide with approximately 4 cups of tea
(~200 ml/cup) per day in humans186. Mice were fed the control and GTE-supplemented
diets for 12 weeks and were gavaged with PCB 126 (5 μmol/kg mouse) or vehicle
(stripped safflower oil; Acros Chemical Company, Pittsburgh, PA) in weeks 10, 11, and
12. The PCB 126 gavage concentration was chosen based on observations in
preliminary studies where gavage of 5 μmol/kg PCB 126 showed pro-inflammatory
responses in C57/BL6 mice but not wasting syndrome.

56

3.3.2 Blood and tissue harvesting
In this study, we examined the role that green tea extract catechins play in altering
oxidative stress and inflammation following insult with environmental pollutants (i.e.,
PCB 126). 24 h after week 12 treatment, mice were euthanized with CO2 and quickly
exsanguinated. 10X ethylenediaminetetraacetic acid (EDTA) was added to collected
blood samples, briefly mixed, and centrifuged at 5000 g for 5 min at 4 °C to separate
blood plasma. Plasma samples were frozen in liquid nitrogen and stored at -80 °C until
processing. Livers were harvested, weighed, divided in half, and frozen in liquid nitrogen
for protein studies or stored in RNAlater solution (Life Technologies, Grand Island, NY)
at 4 °C for 24 h then -80 °C prior to mRNA analysis.
3.3.3 Plasma PCB and isoprostane analysis
PCB 126 and one of its metabolites were extracted from plasma samples to
determine systemic PCB and metabolite concentrations and correlate these findings to
potential PCB-induced oxidative stress as well as the role of green tea extract in
mitigating these effects. PCB 126 and its hydroxy metabolites were isolated from plasma
samples (plus 10 μM 13C12-labeled PCB 126 internal standard (IS), Cambridge Isotope
Laboratories, Tewksbury, MA) through extraction with acetonitrile and subsequent
sonication and centrifugation at 15,000 rpm for 5 min to pellet plasma debris.
Supernatants were dried under N2 and reconstituted in 99:1 methanol:dI H2O solvent
mixture with 0.5% formic acid and 0.1% 5 M ammonium formate.
Measurement of F2-Isoprostanes (F2-IsoPs) provides one of the most reliable
assessment methods for oxidative stress in vivo187. For F2-IsoP analysis, plasma
samples were added to 5:1 ethyl acetate: methanol + 0.5% acetic acid (v/v) + 10 μM 8-
iso-PGF2α-D4 (internal standard, Cayman Chemical, Ann Arbor, MI), vortexed briefly,
and centrifuged to pellet plasma debris. Supernatants were transferred and dried under
N2 prior to reconstitution in methanol and addition of acetic acid for subsequent solid
phase extraction (SPE).
Reconstituted F2-IsoP samples were loaded onto pre-conditioned Supel-Select HLB
SPE columns (Sigma-Aldrich, St. Louis, MO) and washed with 0.5% acetic acid followed
by washing with 0.5% acetic acid containing 20% methanol. Columns were eluted with
methanol, eluent was evaporated to dryness with N2, and samples were reconstituted
with 50:50 methanol:dI H2O.

57

Plasma PCB 126 and a hydroxy metabolite as well as extracted plasma F2-IsoPs
were analyzed using a Shimadzu ultra fast liquid chromatography (UFLC) system
coupled with an AB Sciex 4000-Qtrap hybrid linear ion trap quadrupole mass
spectrometer in multiple reaction monitoring (MRM) mode. MRM transitions monitored:
325.9/256.1, 325.9/254.1, and 325.9/184 for PCB 126; 338/268.1, 338/196.1, and
338/265.7 for 13C12 PCB126. In the MRM ion transition, the precursor ion represents
the M+∙ and the product ion represents either [M-Cl]+ or [M-2Cl]+. MRM transitions
monitored with regard to hydroxy PCB metabolites: 340.8/340.9 for hydroxy PCB126
and 386.8/340.9 for dihydroxy PCB126. The precursor ion of the ion transition is a formic
acid adduct: [M+FA-H]- and product ion is [M-H]-. All values were subsequently
normalized for volume added and for IS recovery.
3.3.4 RNA isolation and polymerase chain reaction (PCR) amplification
Liver samples used to analyze oxidative stress and inflammatory mRNA markers
were homogenized and mRNA was isolated with TRIzol reagent (Invitrogen, Carlsbad,
CA) according to the manufacturer’s protocol. mRNA concentrations were then
determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham,
MA). Reverse transcription was performed using the AMV reverse transcription system
(Promega, Madison, MI). The levels of mRNA expression were assessed by quantitative
real-time PCR using a 7300 Real-Time PCR system (Applied Biosystems, Foster City,
CA) and SYBR Green master mix (Applied Biosystems) as compared to constitutively
expressed β-actin (forward primer: 5’-TGTCCACCTTCCAGCAGATGT-3’; reverse
primer: 5’-GCTCAGTAACAGTCCGCCTAGAA-3’) using the relative quantification
method (ΔΔCt). Primer sequences (see Table 1) for SYBR Green reactions were
designed using the Primer Express Software 3.0 for real-time PCR (Applied Biosystems)
and synthesized by Integrated DNA Technologies, Inc. (Coralville, IA).
3.3.5. Immunoblotting assays
Liver samples used for protein analysis were homogenized in extraction RIPA buffer
containing protease inhibitors (Pierce, Rockford, IL). Lysed tissue was centrifuged at
10,000 g for 30 min at 4 ºC followed by Bradford protein assay (Pierce). Protein samples
were separated using 10% SDS-PAGE and subsequently were transferred onto
nitrocellulose membranes. Membranes were blocked with 5% non-fat milk buffer and
incubated overnight at 4 ºC with the following primary antibodies: β-actin (product

58

#A2066, ~42 kD, Sigma, St. Louis, MO), GAPDH (product #sc-20357, ~37 kD, Santa
Cruz Biotechnology, Dallas, TX), GSR (product #ab16801, ~58 kD, Abcam, Cambridge,
MA), and NQO1 (product #ab34173, ~31 kD, Abcam). After washing, membranes were
incubated with secondary antibodies conjugated with horseradish peroxidase and
visualized using ECL detection reagents (Thermo, Waltham, MA).
Liver samples used for nuclear translocation assays were prepared and cytoplasmic
and nuclear protein was extracted according to manufacturer protocol (NE-PER®
Nuclear and Cytoplasmic Extraction Method, Thermo). Translocation samples
subsequently were processed as seen above, and probed with the following primary
antibodies: lamin (product #sc-7292, ~69 kD, Santa Cruz Biotechnology) and Nrf2
(product #sc-722, ~59 kD, Santa Cruz Biotechnology).
3.3.6. Data analyses
Statistical analysis was performed using Student’s t-test for comparison of treatment
groups. Overall, no statistical differences were exhibited between vehicle control
groups, thus Student’s t-test was used to analyze differences between PCB treatment
groups. qRT-PCR mRNA analysis (n=8-10), Western blot protein analysis (n=8), and
nuclear translocation analysis (n=4) represent three experimental replicates. A
probability value of p ≤ 0.05 was considered statistically significant. All statistical
analyses were overseen by staff of the University of Kentucky Department of Statistics.
3.4. Results
3.4.1 Systemic toxicity associated with PCBs
PCB 126 levels in mouse plasma were examined as a measure of systemic PCB
body burden and to determine green tea extract (GTE) diet supplementation’s role in
increasing PCB metabolism/excretion. Ion transitions of PCB 126 and OH-PCB 126
were measured by UFLC-MS/MS, normalized for sample volume, and compared to ion
transitions of internal standard (13C12 PCB 126) with known concentration to determine
PCB parent and metabolite concentrations (pmol/μL plasma). As seen in Fig. 3.2,
plasma PCB 126 was found almost completely as its hydroxylated metabolite, OH-PCB
126, with concentrations of approx. 0.04 pmol PCB 126/μL plasma versus approx. 30
pmol OH-PCB 126/μL, respectively. GTE diet supplementation did not modulate PCB
metabolism or plasma concentrations 24 h following PCB exposure, indicating that it
plays a minimal role in pollutant clearance from the body. It is hypothesized, though, that

59

while GTE supplementation does not increase 24 h pollutant metabolism and clearance,
it prepares the body’s defense mechanisms to more effectively modulate oxidative stress
present during toxicant acute insult.
3.4.2 F2-isoprostane levels are significantly reduced in green tea extract-supplemented,
PCB-exposed mice
Analysis of F2-isoprostanes (F2-IsoPs), prostaglandin-like eicosanoids formed during
fatty acid peroxidation, has emerged as the most reliable method for assessing in vivo
oxidative stress187. Plasma samples from mice fed control and GTE-supplemented diets
and subsequently treated with vehicle or PCB 126 (n=8-10) were analyzed to determine
GTE’s role in modulating environmental toxicant-induced oxidative stress. Plasma F2-
IsoP (including PGF2α, 8-iso-PGF2α, iPF2α-III, 8-epiPGF2α, 8-isoprostane, and 15-F2t
isoprostanes) and F2-IsoP metabolite (13,14-dihydro-15-ketoPGF2α) concentrations
were determined using UFLC-MS/MS and integrating peak area (area under the curve,
AUC) with regard to known internal standard concentrations (AUC/IS). As seen in Fig.
3.3, GTE diet supplementation led to drastically decreased F2-IsoP levels (p<0.05) in
mice treated with PCB 126, indicating that GTE acts as a strong antioxidant to modulate
against environmental toxicant insult. Additionally, GTE drastically decreased PCB-
induced F2-IsoP metabolite production (p<0.05); F2-IsoP metabolite analysis is
developing as an even more sensitive measure of in vivo oxidative stress because the
metabolites do not undergo autoxidation and artificial production as has been seen with
parent F2-IsoP188. Interestingly, GTE supplementation led to no significant modulation of
F2-IsoP parent or metabolite levels under control situations, indicating that antioxidant
modulation occurs primarily when a system is under stress.
3.4.3. Green tea extract increases mRNA antioxidant response
Antioxidant enzyme levels were measured in mouse liver to further develop the role
of GTE diet supplementation in modulating environmental insults in vivo. Table 3.2
highlights antioxidant mRNA markers tested and overall results. qRT-PCR analysis (n=8-
10) shows a significant upregulation in catalase, glutathione peroxidase (Gpx3),
glutaredoxin (Grx2), glutathione reductase (GSR), glutathione S-transferases (GSTa1,
GSTa4, GSTm1, GSTm2, and GSTm3), NAD(P)H dehydrogenase [quinone] 1 (NQO1),
superoxide dismutase 1 (SOD1), thioredoxin 2 (Trx2), and thioredoxin reductase 1
(TrxR1) during the concomitant treatment of PCB 126 and GTE diet supplementation.

60
As before, in most cases GTE supplementation did not significantly modulate antioxidant
response without the presence of secondary external insult. Analysis of NQO1 and
GSTm3, enzymes associated with detoxification, exhibited significantly increased mRNA
levels above vehicle control diet levels in the presence of PCB 126, while GTE diet
supplementation drastically induced antioxidant mRNA expression following PCB insult.
mRNA levels of SOD1, critical for modulating harmful superoxide radicals produced
during toxicant insult, were significantly decreased following PCB gavage, while GTE
supplementation returned mRNA expression to vehicle control diet levels. While PCB
insult did not modulate GSR (an important cellular antioxidant) mRNA levels in mice fed
vehicle control diets, GTE diet supplementation led to a significantly increased
antioxidant response (see Fig. 3.4, p<0.01). Additionally, data shown in Fig. 3.9 further
expounds upon these trends in response to GTE supplementation. For example,
thioredoxin 2 (Trx2, an important redox protein) mRNA levels are significantly
upregulated in the concomitant presence of GTE and PCB 126 although GTE does not
induce increased antioxidant activity without the addition of secondary external insult.
3.4.4 Green tea extract increases NQO1 and GSR antioxidant protein response against
PCB 126
Antioxidant marker protein analysis was performed in order to better understand the
role that GTE diet supplementation plays in increasing the body’s defensive mechanisms
against toxicant insult. Proteins of interest were compared to multiple housekeeping
genes, β-actin and GAPDH, to further substantiate findings. In PCB 126-treated mouse
liver samples, NQO1 protein was significantly upregulated when fed a GTE
supplemented diet, as shown in Fig. 3.5 when quantified against GAPDH (p<0.01). The
associated representative blot continues trends seen in mRNA with a large increase in
antioxidant protein activity in GTE supplemented mice exposed to PCB insult. GSR
protein activity was also statistically increased in response to diet supplementation and
continues the trend seen in mRNA analysis in which neither GTE supplementation nor
PCB treatment led to modulation of antioxidant response while their concomitant
treatment led to significant upregulation (p≤0.05).
3.4.5. Green tea extract drives Nrf2 nuclear translocation in the presence of PCB 126

61

Nuclear translocation assays are commonly used techniques that serve as a
representation of cellular transcriptional activation. Nuclear factor (erythroid-derived 2)-
like 2 (Nrf2) nuclear translocation was analyzed in comparison to lamin, a nuclear
fraction housekeeping gene; liver samples from GTE-supplemented mice exposed to
PCB 126 showed a trend toward increased nuclear abundance of Nrf2 (p=0.1, n=4). As
in antioxidant mRNA and protein studies, GTE without a concomitant insult from PCB did
not modulate Nrf2 activity and translocation. The Nrf2 antioxidant pathway plays a
pivotal role in modulating oxidative stress, and therefore its upregulation by GTE diet
supplementation, as seen in Fig. 3.6, is an important indicator of GTE’s ability to
increase the body’s responsiveness toward environmental stressors.
3.4.6 Green tea extract modulates inflammatory and xenobiotic-related markers in the
presence of PCB 126
Cytochrome P450 (e.g., CYP1A1 and CYP1B1), a family of enzymes controlled by
the aryl hydrocarbon receptor (AhR) and Nrf2 proteins that are vital for the metabolism of
xenobiotic substances, including toxicants, was analyzed from liver samples to
determine potential modulation of its activity in response to GTE diet supplementation.
Substantial CYP upregulation was seen in the presence of PCB insult, as has been
shown in past literature, while concurrent GTE supplementation causes a significant
upregulation in CYP1B1 mRNA analysis (as seen in Fig. 3.7), indicating potential for
higher toxicant degradation and clearance. In mice fed GTE-supplemented diets and
exposed to PCB, major indicators of inflammation including monocyte chemoattractant
protein-1 (MCP-1, also referred to as chemokine (C-C motif) ligand 2, CCL2) and CCL3
(also referred to as macrophage inflammatory protein-1α, MIP-1α) were significantly
decreased back to vehicle control levels. Interestingly, GTE supplementation alone led
to significant increases in inflammatory marker mRNA levels, although these levels
returned to vehicle control levels with concomitant treatment (p<0.05).
3.4.7. The AhR is implicated as a control mechanism both in PCB 126 toxicity and
antioxidant response
As seen in Fig. 3.8, GTE diet supplementation led to significant upregulation of AhR
mRNA levels in liver in the presence of PCB 126, a dioxin-like AhR ligand. PCB 126
insult did not induce AhR mRNA in vehicle control, vehicle + GTE control, and PCB
control settings, but, interestingly, concomitant treatment led to a two-fold upregulation,

62

similarly to that seen in mRNA and protein antioxidant and inflammatory markers, thus
allowing for increased in vivo toxicant clearance (p<0.01). Nrf2 mRNA levels were also
significantly increased during PCB 126 insult, although GTE supplementation did not
cause significant modulation of PCB toxicity. AhR and Nrf2 signaling pathways control
both xenobiotic responses and inflammatory cascades, therefore their modulation by
GTE diet supplementation implicates further GTE’s role in strengthening antioxidant
response toward insult by environmental pollutants.
3.5. Discussion
Healthy nutrition can positively influence, or lessen, the human health risks
associated with exposure to mixtures of environmental chemicals189. The liver is one
tissue particularly vulnerable to environmental pollutants, and especially PCB-induced
toxicity 173. One type of liver disease that affects more than 20% of Americans is
nonalcoholic fatty liver disease, which can lead to nonalcoholic steatohepatitis190.
Industrial toxicants also have been linked to secondary insults that can lead to
steatohepatitis190. Mechanisms defining the involvement of environmental pollutants in
the pathology of liver diseases may include a compromised redox status or toxicant-
induced increase in oxidative stress.
Lifestyle modifications that include healthful nutrition have been suggested as a
powerful means of reducing the vulnerability to environmental insults189 and in reducing
the risk to environmental toxicant-induced liver disease190. For example, green tea
extract has been shown to protect against hepatic steatosis in obese mice by reducing
oxidative stress and enhancing hepatic antioxidant defenses191. In the present study we
observed significant protection against PCB 126-induced oxidative stress by dietary
supplementation with green tea extract. In fact, mice supplemented with green tea
extract and subsequently exposed to PCB displayed a decrease in overall F2-
isoprostane and metabolite levels compared to animals on a control diet exposed to
PCB. We did not see a large increase in oxidative stress as evidenced by an increase in
F2-isoprostane levels in mice fed a control diet and subsequently gavaged with PCB.
This may have been due to the fact that the amount of administered PCB 126 reflects
more physiologically relevant PCB concentrations in humans than previous studies using
high concentrations of PCB congeners (e.g., 150 μmol/kg versus 5 μmol/kg used
herein)192. We hypothesize that levels of PCBs encountered by humans today initiate low
levels of chronic oxidative stress and inflammation that, together with multiple other

63

factors including poor diet and exposures to other environmental stressors, leads to
augmented or exacerbated human disease. The protective properties of green tea have
been studied extensively, and recent human studies suggest that consumption of green
tea may protect against cardiovascular disease and some forms of cancer, have anti-
hypertensive and anti-obesity effects, and contribute to antibacterial and antiviral
activity193.
Certain environmental pollutants, and in particular ligands for the AhR, induce
oxidative stress, in part via induction and uncoupling of cytochrome P450 enzymes20a.
Hepatic changes in lipid composition, altered membrane structure and membrane
functions are well-described phenomena of PCB-induced liver damage194. The protective
properties of green tea extracts against PCB-induced pathologies, and in particular liver
damage, may be numerous. For example, green tea may normalize the formation of lipid
peroxide products induced by exposure to toxicants to prevent hepatic fibrosis185, or
green tea may favorably regulate intestinal tight junction proteins or overall intestinal
barrier function195. It has been proposed that green tea can inhibit the intestinal
absorption of lipids and highly lipophilic organic compounds130. Induction of antioxidant
enzymes by green tea also may contribute to its tissue protective properties196. Our
current study support this concept, and we observed an increased induction of
antioxidant genes such as SOD1, GSR, NQO1 and GST in mice that were fed a green
tea-supplemented diet and subsequently challenged with PCB, compared to animals
exposed to the control diet plus PCB. This may explain in part the observed decrease in
overall oxidative stress due to green tea supplementation. Of particular interest is our
observed induction of NQO1, a Nrf2 target gene, which suggests that green tea protects
in part by modulation of the Nrf2/ARE pathway. In fact, it has been shown that food
polyphenols, including the green tea polyphenol EGCG, the primary component of GTE
tested herein, can modulate Nrf2-mediated antioxidant and detoxifying enzyme
induction197. Our own work with vascular endothelial cells further suggests that multiple
pathways including lipid raft caveolae and the antioxidant defense controller Nrf2 play a
role in nutritional modulation of PCB-induced vascular toxicity13b and that cross-talk
between caveolae-related proteins and cellular Nrf2 may be required for optimal
cytoprotection by green tea catechins and other diet-derived polyphenols.
Many groups, including ours, have shown that green tea catechins such as EGCG
can upregulate basal levels of antioxidant enzymes in vitro116b, 193, 198. Interestingly, our
overall results show that green tea extract supplemented in the diet acts as an

64

antioxidant only in the presence of a secondary stressor, in this case, the pro-
inflammatory coplanar PCB 126. The inconsistencies between in vitro and in vivo studies
may be explained by the relatively high doses of tea catechins usually employed in cell
culture or the fact that most tea catechins are quickly biotransformed in vivo to
metabolites that exhibit differential physiological effects196. There are many other
examples of instances where supplementation with GTE or specific catechins is
protective in in vivo models of inflammation and oxidative stress. For many of our
investigated antioxidant enzymes we saw decreased expression in the presence of PCB
when fed a control diet, but levels were upregulated, many returning to control vehicle
levels in PCB groups fed a GTE-rich diet (e.g., SOD1 in Fig. 3.4). These observations
are in line with other groups who investigated GTE effects on other stressors including
ethanol toxicity and bacterial infection199.
Our past work in cell culture points to the antioxidant controller Nrf2 as a major
player in nutritional modulation of PCB toxicity. Many nutrients other than green tea
catechins, including resveratrol, found in the skins of grapes, and sulforaphane, which is
found in broccoli, have been shown to activate Nrf2123c, 137. Nrf2 can become
transcriptionally active through multiple mechanisms including direct phosphorylation by
PKC delta and loss of contact between Nrf2 and inhibitory kelch-like ECH-associated
protein 1 (Keap1)99b. Upon activation, Nrf2 is able to evade ubiquitination, enter the
nucleus, and bind cis-acting antioxidant response elements in target genes such as
NQO182a. Nrf2 activation leads to decreased overall oxidative stress and inflammation,
which is a hallmark of PCB toxicity100. In this work we observed a relatively significant
trend toward increased NRF2 translocation to the nucleus in animals supplemented with
GTE and subsequently exposed to PCB (Fig. 3.6). More interestingly and novel, we also
saw a drastic increase in AhR mRNA expression in this same treatment group (Fig. 3.8).
This upregulation was mirrored in increases in both CYP1A1 and CYP1B1 mRNA levels
in mice fed a GTE rich diet and subsequently exposed to PCB. An increase in AhR may
help to detoxify the acute exposure to PCB by increasing metabolism-assisted excretion.
Although a consistent, steady upregulation of AhR may create a negatively imbalanced
redox situation, the GTE’s ability to upregulate AhR only in the presence of a toxicant
may in some cases be a protective and positive mechanism. Other groups have shown
that different catechins within GTE display either antagonistic or agonist activities
against CYP1A1200, but to our knowledge no group has reported the mRNA upregulation
as seen in Fig. 3.7. In our analysis of PCB concentrations in plasma we observed a very

65

slight trend towards decreased levels of parent PCB 126 in the plasma of mice
supplemented with GTE (Fig. 3.2). Although plasma levels may be a good overall picture
of body-burden of PCBs, in the future, collecting urine and feces may paint a clearer
picture of GTE’s involvement with detoxification and excretion. Also, we may have been
able to see a more significant decrease in PCB levels and or a modulation of PCB
hydroxy metabolite in mice supplemented with GTE if we sacrificed the mice more than
24 hours after the final PCB dose130a.
PCBs can induce vascular inflammation by upregulating pro-inflammatory mediators
such as MCP-1 and CCL3. We hypothesized that GTE would downregulate basal levels
of these inflammatory markers in vehicle treated mice as well as decrease PCB-
mediated upregulation in PCB 126 treated mice. Interestingly however, for both of our
inflammatory markers we saw a significant increase in mRNA levels in vehicle treated
mice supplemented with GTE (Fig. 3.7). This observation would suggest that the dose
of GTE used in this study may not be optimal, and perhaps toxic to some degree, in
basal levels of oxidative stress and inflammation. Other groups have shown GTE
toxicities at certain doses in vivo201, and interestingly, data illustrating protection seems
to be more conclusive in animal models of oxidative stress and inflammation.
Importantly, for our study, both MCP-1 and CCL3 mRNA levels return to vehicle treated
control diet levels in mice fed GTE and subsequently exposed to PCB. This may point to
GTE as exhibiting possible hormetic activity by inducing a slight response by the
organism that ultimately primes the protective antioxidant system for a future stressor,
i.e., Superfund pollutant exposure. Understanding hormesis and the role that nutrients
can play is an extremely interesting scientific discipline and demands much more future
investigation202.
In summary, our current study supports our in vitro data that green tea catechins can
protect against PCB 126-induced cytotoxicity by reducing oxidative stress73b. Our current
in vivo data contributes to the overall hypothesis that nutrition can modulate
environmental insults. More studies are needed to further understand detailed
mechanisms of protective benefits to consume diets high in protective and healthful
nutrients such as plant-derived polyphenols and other bioactive compounds.

66

Table 3.1. Primers used for qRT-PCR
q
Gene name Forward primer 5'-3' Reverse primer 5'-3' Fragment size
Inflammatory and xenobiotic-related markers
CCL3 CACCCTCTGTCACCTGCTCAA TGGCGCTGAGAAGACTTGGT 100 bp
CYP1A1 TGGAGCTTCCCCGATCCT CATACATGGAAGGCATGATCTAGGT 100 bp
CYP1B1 TGCATCGGTGAGGAACTGTCT CTCATGTTTGAGGACTCATTTTGG 104 bp
MCP-1 GCAGTTAACGCCCCACTCA CCTACTCATTGGGATCATCTTGCT 63 bp
Antioxidant markers
AhR GACCAAACACAAGCTAGACTTCACACC CAAGAAGCCGGAAAACTGTCATGC 200 bp
Catalase CAGAGAGCGGATTCCTGAGAGA CTTTGCCTTGGAGTATCTGGTGAT 100 bp
Gpx2 GTGGCGTCACTCTGAGGAACA CAGTTCTCCTGATGTCCGAACTG 125 bp
Gpx3 CATACCGGTTATGCGCTGGTA CCTGCCGCCTCATGTAAGAC 80 bp
Grx2 CATCCTGCTCTTACTGTTCCATGGCCAA TCATCTTGTGAAGCGCATCTTGAAACTGG 123 bp
GSR TCGGAATTCATGCACGATCA GGCTCACATAGGCATCCCTTT 100 bp
GSTa1 AAGCCCGTGCTTCACTACTTC GGGCACTTGGTCAAACATCAAA 159 bp
GSTa4 TACCTCGCTGCCAAGTACAAC GAGCCACGGCAATCATCATCA 109 bp
GSTm1 ATACTGGGATACTGGAACGTCC AGTCAGGGTTGTAACAGAGCAT 349 bp
GSTm2 ACACCCGCATACAGTTGGC TGCTTGCCCAGAAACTCAGAG 118 bp
GSTm3 CCCCAACTTTGACCGAAGC GGTGTCCATAACTTGGTTCTCCA 208 bp
NQO1 GGCATCCAGTCCTCCATCAA GTTAGTCCCTCGGCCATTGTT 100 bp
Nrf2 GAGTCGCTTGCCCTGGATATC TCATGGCTGCCTCCAGAGAA 100 bp
SOD1 GAAACAAGATGACTTGGGCAAAG TTACTGCGCAATCCCAATCA 100 bp
Trx2 GCTAGAGAAGATGGTCGCCAAGCAGCA TCCTCGTCCTTGATCCCCACAAACTTG 168 bp
TrxR1 GGCCAAAATCGGTGAACACATGGAAG CGCCAGCAACACTGTGTTAAATTCGCCCT 175 bp

67

Table 3.2. The effect of green tea extract (GTE) diet supplementation on PCB 126-
induced mRNA inflammatory, xenobiotic-related, and antioxidant markers.
5 µmol PCB 126/kg mouse (fold change)
Control diet Control + 1% GTE p-value
Inflammatory and xenobiotic-related markers
CCL3 2.051±0.224 0.945±0.116 <0.001
CYP1A1 915.208±136.510 1169.338±78.900 N.S.
CYP1B1 87.504±7.694 146.998±12.329 <0.001
MCP-1 1.909±0.478 0.745±0.235 0.012
Antioxidant markers
AhR 0.771±0.096 1.506±0.131 <0.001
Catalase 0.495±0.057 0.817±0.071 0.003
Gpx2 0.339±0.161 0.682±0.098 0.08
Gpx3 0.925±0.167 1.411±0.159 0.004
Grx2 0.213±0.015 0.486±0.078 0.003
GSR 0.702±0.074 1.245±0.097 0.001
GSTa1 14.771±2.911 22.955±3.975 0.034
GSTa4 0.896±0.117 2.222±0.245 <0.001
GSTm1 2.306±0.450 4.024±0.301 0.006
GSTm2 0.868±0.097 1.366±0.114 0.004
GSTm3 4.469±0.664 18.596±1.819 <0.001
NQO1 1.980±0.051 6.138±0.031 0.006
Nrf2 3.088±0.307 3.212±0.234 N.S.
SOD1 0.311±0.041 0.684±0.063 <0.001
Trx2 0.731±0.050 1.556±0.152 <0.001
TrxR1 1.522±0.143 2.673±0.276 0.002
Gene name

68

Fig. 3.1. Proposed signaling pathway for PCB detoxification in vivo. PCB 126, an AHR
ligand and activator of NRF2, causes CYP1A1 upregulation, which leads to superoxide
production. Green tea extract (GTE) diet supplementation effectively upregulates redox-
related enzymes in the presence of PCB 126 which allows for a more efficient
antioxidant response to environmental insult.

Fig. 3.2. The effect of green tea extract (GTE) diet supplementation on systemic PCB
126 concentration and metabolism. PCB 126 and its hydroxy metabolites were
measured in mouse plasma by UFLC/MS MS and normalized to sample volume and
internal standard recovery. PCB 126 is heavily metabolized in vivo, as seen by very low
levels of parent PCB 126 remaining in plasma samples while its hydroxylated
metabolites predominate. GTE supplementation did not significantly modulate systemic
PCB or metabolite concentrations. Data are presented as mean±S.E.M (n=5).
69

70

Fig.3.3. PCB 126-induced oxidative stress is modulated by green tea extract (GTE) diet
supplementation. Plasma F2-isoprostane and metabolite levels were measured by
HPLC/MS MS to assess in vivo oxidative stress induced by PCB 126 that is potentially
mitigated by GTE supplementation. Relative levels of combined F-2 IsoPs, including
PGF2α, 8-iso-PGF2α, iPF2α-III, 8-epiPGF2α, 8-isoprostane, and 15-F2t isoprostanes,
were determined by averaging the AUC integration values from retention times of 8 and
11.3 minutes (Q1 = 353.144, Q2 =193.1). Additionally, the level of 13,14-dihydro-15-
ketoPGF2α, an F-2 IsoP metabolite, was determined by integrating its peak at 11.3
minutes (Q1 = 355.2, Q2 = 311.4). Data are presented as mean±S.E.M. (n=8-10). GTE
supplementation significantly decreased oxidative stress induced by PCB 126 treatment
(*p<0.01).

71
Fig. 3.4 Relative mRNA levels of representative antioxidant enzyme markers. Overall
GTE supplementation did not significantly increase antioxidant mRNA levels in control
diets, but, in the presence of environmental perturbation (i.e. PCB 126 gavage),
significantly higher antioxidant levels were seen in mouse liver above non-supplemented
diet. All values were determined using the relative quantification method (ΔΔCt) as a fold
change from control. Data are presented as mean±S.E.M (*p<0.01, n=8-10). See Table
3.2 and Fig. 3.9. for more information concerning all antioxidant markers tested.
0.0
2.0
4.0
6.0
8.0
10.0
12.0
Vehicle PCB 126
NQO1mRNAlevel(Foldchange)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
Vehicle PCB 126
SOD1mRNAlevel(Foldchange)
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
Vehicle PCB 126
GSRmRNAlevel(Foldchange)
*
*
*
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
4.0
4.5
5.0
Vehicle PCB 126
GSTm3mRNAlevel(Foldchange)
*
*

72
Fig. 3.5. GTE supplementation leads to increased antioxidant protein expression in the
presence of PCB 126. Protein samples were separated through gel electrophoresis and
probed with NQO1 and GSR primary antioxidant-related antibodies. Statistically
significant increases in antioxidant protein activity were seen in PCB 126-treated mice
that were fed a GTE-supplemented diet. In addition to visualized Western blot
comparison to β-actin, samples were compared to GAPDH for densitometry
quantification to further substantiate findings. GTE supplemented mice exposed to PCB
showed a significant increase in protein expression, indicating a strengthened
antioxidant response due to GTE supplementation (*p<0.01,**p≤0.05, N=8).
NQO1
β-actin
0
0.005
0.01
0.015
0.02
0.025
0.03
Control Diet GTE Supp. Diet
NQO1/GAPDH
Control Diet
Vehicle PCB 126
GTE Supp. Diet
Vehicle PCB 126
GSR
β-actin
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
1.8
Control Diet GTE Supp. DietGSR/GAPDH
*
**
Control Diet
Vehicle PCB 126
GTE Supp. Diet
Vehicle PCB 126
+ PCB + PCB + PCB + PCB

73
Fig. 3.6. Mice fed a 1% GTE-supplemented diet and subsequently exposed to PCB 126
displayed increased Nrf2 activation, as evidenced by increased Nrf2 translocation to the
nucleus, compared to mice fed 10% fat control diet and exposed to PCB. Lamin was
used as a nuclear fraction housekeeping gene for densitometry quantifications. GTE
supplemented mice exposed to PCB showed a trend toward increased nuclear
abundance of Nrf2 (*p=0.1, n=4).
Control Diet
Vehicle PCB 126
Nrf2
Lamin
Vehicle PCB 126
GTE Supp. Diet
0
0.0005
0.001
0.0015
0.002
0.0025
Control Diet GTE Supp. Diet
Nrf2/Lamin
*
+ PCB + PCB

74
Fig. 3.7. Relative mRNA levels of inflammatory and xenobiotic-related markers. GTE
supplementation led to increased cytochrome P450 (CYP1A1 and CYP1B1) mRNA
expression in the presence of both GTE and environmental toxicant (i.e., PCB 126),
indicating increased activity for toxicant degradation and/or excretion. MCP-1 and CCL3
inflammatory markers were statistically increased in GTE-supplemented mice liver
samples but toxicant-induced inflammatory markers returned to control levels due to
GTE supplementation. All values were determined using the relative quantification
method (ΔΔCt) as a fold change from control. Data are presented as mean±S.E.M.
(*p<0.01, **p<0.05, n=8-10).
0
20
40
60
80
100
120
140
160
180
Vehicle PCB 126
CYP1B1mRNALevel(Foldchange)
0
0.5
1
1.5
2
2.5
3
3.5
Vehicle PCB 126
MCP-1mRNAlevel(Foldchange)
0
200
400
600
800
1000
1200
1400
Vehicle PCB 126
CYP1A1mRNAlevel(Foldchange)
*
**
*
0
0.5
1
1.5
2
2.5
3
Vehicle PCB 126
CCL3mRNAlevel(Foldchange)
*
*

75
Fig. 3.8. GTE diet supplementation leads to significant upregulation of AhR mRNA levels
in the presence of PCB 126, thus increasing in vivo toxicant clearance. Nrf2 mRNA
levels are significantly increased during PCB 126 insult, although GTE supplementation
does not cause statistically significant modulation of PCB toxicity. All values were
determined using the relative quantification method (ΔΔCt) as a fold change from
control. Data are presented as mean±S.E.M (n=8-10). GTE supplementation significantly
increased AhR in the presence of PCB 126 treatment (*p<0.01).

76
0
0.2
0.4
0.6
0.8
1
1.2
1.4
Vehicle PCB 126
CatalasemRNAlevel
(Foldchange)
0
0.5
1
1.5
2
2.5
3
3.5
Vehicle PCB 126
Gpx2mRNAlevel
(Foldchange)
0
0.5
1
1.5
2
Vehicle PCB 126
Gpx3mRNAlevel
(Foldchange)
*
*
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
Vehicle PCB 126
Grx2mRNAlevels
(Foldchange)
*
0
5
10
15
20
25
30
Vehicle PCB 126
GSTa1mRNAlevel
(Foldchange)
**
0
0.5
1
1.5
2
2.5
3
Vehicle PCB 126
GSTa4mRNAlevel
(Foldchange)
*
0
1
2
3
4
5
Vehicle PCB 126
GSTm1mRNAlevel
(Foldchange)
0
0.5
1
1.5
2
Vehicle PCB 126
GSTm2mRNAlevel
(Foldchange)
*
*
0
0.5
1
1.5
2
Vehicle PCB 126
Trx2mRNAlevel
(Foldchange)
0
0.5
1
1.5
2
2.5
3
3.5
Vehicle PCB 126
TrxR1mRNAlevel
(Foldchange)
**
*

77
Fig. 3.9. Relative mRNA levels of antioxidant enzyme markers. Overall, GTE
supplementation did not significantly increase antioxidant mRNA levels in control diets,
but, in the presence of environmental perturbation (i.e., PCB 126 gavage), significantly
higher antioxidant levels were seen in mouse liver above non-supplemented diet. All
values were determined using the relative quantification method (ΔΔCt) as a fold change
from control. Vehicle and PCB 126-treated mice with 10% fat control and GTE-
supplemented diets: n=8-10. Data are presented as mean±S.E.M (*p<0.01, **p<0.05).
See Table 3.2 and Fig. 3.4. for more information concerning antioxidant markers tested.

78
Fig. 3.10. PCB 126 exposure leads to a significant increase in liver/body weight ratio
(hepatosomatic index, HSI) in both control and GTE-supplemented diets, although GTE
supplementation did not significantly mitigate this PCB-induced increase. Statistical
analysis was performed using two-way ANOVA followed by Tukey test with *p<0.001. A
trend toward a statistically significant interaction between diet and PCB 126 treatment
(p=0.06) was also seen.
0
0.01
0.02
0.03
0.04
0.05
0.06
0.07
0.08
0.09
Vehicle PCB 126
Liver/BodyWeight(HSI)
*
*

79
Table 3.3. A: Dietary make up of low fat control and low fat 1% green tea extract
mouse diets. B: Polyphenol formulation of Taiyo 1% GTE.
A:
B:
Manufacturer's Description: Certified organic, excellent tea taste, stable in
beverages.
Catechins>15%(ECG average 11.75%), caffeine<10% (average 6.6%)
% Total %Catechins
Caffeine 7.5
EGC 9.3 35.1
EC 2.8 10.6
EGCG 11.7 44.1
ECG 2.7 10.2
Total Catechins 26.6 100.0
pp p
g/kg kcal g/kg kcal
Protein 19 (20%) 19 (20%)
Carbohydrate 67 (70%) 67 (70%)
Fat 4 (10%) 4 (10%)
Casein 190 800 190 800
L-Cystine 3 12 3 12
Corn Starch 299 1260 299 1260
Maltodextrin 10 33 140 33 140
Sucrose 332 1400 332 1400
Cellulose, BW200 47 0 47 0
Soybean Oil 24 225 24 225
Lard 19 180 19 180
Mineral Mix
S10026
9 0 9 0
Vitamin Mix
V10001
9 40 9 40
Green Tea Extract 10 ‐‐ 0 ‐‐
Total 1065 4057 1055 4057
1% GTE-supplemented diet Control diet

80
Chapter 4. Nitration of linoleic acid modulates polychlorinated biphenyl-induced
endothelial cell dysfunction
4.1 Synposis
Data now implicate correlations between persistent organic pollutants, such as
polychlorinated biphenyls, and cardiovascular diseases. We have shown that coplanar
PCBs can initiate endothelial cell dysfunction, oxidative stress, and inflammation. Recent
evidence shows that toxicant-nutrient interactions exist, and a diet high in pro-
inflammatory omega-6 lipids such as linoleic acid, may exacerbate PCB-induced
cardiovascular disease. However, recently discovered anti-inflammatory lipid
metabolites, such as nitro-fatty acids, may limit this exacerbated effect. The aim of our
research was to determine if pro-inflammatory lipids could increase the toxicity of the
coplanar PCB 126, and if nitration of these pro-inflammatory lipids could ameliorate this
exacerbated effect. First, vascular endothelial cells were treated with linoleic acid or
nitrolinoleic acid and harvested for mRNA. Linoleic acid treatment alone increased AhR,
CYP1A1, MCP-1, and VCAM-1 message in a dose dependent manner, but the
upregulation of these pro-inflammatory mediators was not observed in nitrolinoleic
treated cells. Also, nitrolinoleic acid upregulated heme-oxygenase 1, a protective
antioxidant enzyme, which may help to explain the anti-inflammatory role of nitro-fatty
acids. Next, vascular endothelial cells were pretreated with linoleic acid or nitrolinoleic
acid and subsequently exposed to physiologically relevant concentrations of PCB 126.
Treatment with linoleic acid was pro-inflammatory as evidenced by increased mRNA
levels (RT-PCR) of vascular cellular adhesion molecular-1 (VCAM-1), monocyte
chemoattractant protein-1 (MCP-1) and caveolin-1 (Cav-1). Levels of MCP-1 and VCAM-
1 were most exacerbated in linoleic acid/PCB treated cells. Interestingly, the addition of
a nitro group to linoleic acid prevented this exacerbated PCB effect. More research is
necessary to determine if the protective effects observed herein are due to an
upregulated antioxidant defense or rather the nitro group protecting against oxidation
and subsequent formation of toxic pro-inflammatory metabolites. Understanding diet
toxicant interactions is a critical step towards more effective risk assessment and public
health outcomes for at-risk populations who reside near hazardous and Superfund sites

81

4.2 Introduction
Cardiovascular disease is the leading cause of death in the developed world and
can be modified depending on nutritional habits of the individual. Certain dietary choices
have been shown to be pro-atherosclerotic and proinflammatory whereas other, more
healthful choices, have been shown to decrease oxidative stress, inflammation, and
vascular diseases. An increasing body of scientific research now implicates dietary fats
as important mediators of cardiovascular disease. Certain fatty acids such as linoleic
acid (parent omega-6 polyunsaturated fatty acid) have been shown to promote
endothelial cell inflammation primarily by an increase in toxic linoleic acid metabolites.
Many inexpensive plant derived oils are rich in linoleic acid, which makes this
fatty acid a predominate component in Western diets. Reducing the intake of this
nutrient has been shown to be protective against multiple proinflammatory diseases203.
Linoleic acid can be metabolitzed by multiple cell types, including endothelial cells, into
bioactive mediators such as cis-epoxyoctadecenoic acids (9, 10- and 12, 13-EOA), 9-
and 13- hydroxy-octadecadienoic acid (9- and 13-HODE), and 9- and 13-oxo-
octadecadienoic acid (9- and 13-oxoODE)8, 204. The formation of these toxic metabolites
can be due to random radical-mediated oxidation, or enzymatically controlled by 12/15-
lipoxygenases, cyclooxygenases, or even cytochrome P450s8. The monoepoxides of
linoleic acid are commonly referred to as leukotoxins (LTX) and their abundance is
related to cytochrome P450 activation205. There is evidence that links these toxic
metabolites to organ failure, pulmonary edema, and endothelial cell damage205. LTX
have been shown to increase endothelial cell permeability and activation of
proinflammatory NFκB205. There are however, metabolites of linoleic acid that appear to
be anti-inflammatory and may be effective protective mediators of endothelial cell
dysfunction.
Recently identified endogenous fatty acid metabolites known as nitro-fatty acids
have been implicated as possible protective mediators of inflammation and
cardiovascular disease. Unsubstituted fatty acids such as oleic acid (18:1), arachidonic
acid (20:4), and linoleic acid (18:2) can be nitrated endogenously by multiple enzymatic
and non-enzymatic reactions, resulting in the inhibition of pro-inflammatory mediators,
induction of protective heme oxygenase-1, and blood vessel relaxation146. Nitro-fatty
acids can protect via multiple mechanisms including upregulation of PPARγ and Nrf2 as
well as downregulation of pro-inflammatory NFκB147. ApoE-/- animals administered a

82

nitro-fatty acid displayed reduced foam cell formation, decreased lesion formation, and
inhibited pro-inflammatory adhesion molecule expression compared to vehicle treated
control mice144d. Recently, Shin et al., reported that nitro-fatty acids may directly
modulate endothelial cell signaling, specifically by altering caveolin-1 and eNOS
signaling206. Vascular endothelial cells are dynamic modulators of CVD and come in
contact with heterogenous blood components and stimuli such as a wide assortment of
dietary nutrients, lipid soluble toxic pollutants, and endogenous pro-inflammatory signals
and compounds. Once believed to be a relatively unimportant regulatory cell type,
endothelial cells are now known to be critical mediators of platelet adherence,
modulators of vascular tone, regulators of thrombosis, and controllers of immune and
inflammatory responses 5. Since endothelial cells are constantly exposed to blood and
associated proteins, it is not surprising that nutrient and chemical compounds from the
diet may play a critical role in the regulation of endothelial cell dysfunction and
subsequent cardiovascular disease. Due to commonalities between certain dietary
nutrients and toxicants in regards to activation of endothelial cells, more research
describing the interplay between nutrition and toxicology is critical to better understand
the risks of environmental pollutants in a world of multiple concomitant stressors.
Accompanying nutrients from the diet, many lipophilic persistent organic
pollutants (POPs) are also distributed throughout the body via blood flow and plasma
proteins. Developing a body burden of POPs is not rare; for example, in studies
attempting to identify the concentrations of multiple pollutant compounds in human
plasma, it is not uncommon for the researchers to find known toxicants in 99-100% of
their test subjects in the parts per billion range (ppb)10. Not surprisingly, many of these
manmade compounds have been shown to interact and activate endothelial cells; some
causing toxicity via many of the same mechanisms as detrimental nutrient components.
For example, certain toxicants such as PCBs have been shown to increase oxidative
stress, upregulate NFκB, and lead to endothelial cell dysfunction and inflammation12.
Interestingly, it appears that certain nutritional choices, such as diets high in linoleic acid,
may actually exacerbate the toxicity of persistent organic pollutants13.
Previous work has shown that linoleic acid can amplify the endothelial cell toxicity
of polychlorinated biphenyls109. Linoleic acid pretreatment exacerbated PCB-induced
oxidative stress, NFκB DNA binding, and albumin transfer in primary vascular
endothelial cells, which mechanistically may be explained by an observed exacerbated

83

cytochrome P450 1A1 (Cyp1A1) upregulation109. Other groups have also documented
detrimental nutrient/toxicant interactions; elevated levels of linoleic acid may enhance
the cellular bioavailability of PCBs, PCBs can downregulate delta 5 and delta 6
desaturases which are critical for the breakdown of linoleic acid, and PCBs can promote
the transport of linoleic acid from circulating plasma into vascular tissues112, 126. Finally, it
was shown that the exacerbated effects observed may be due to the creation of
metabolites such as LTX and LTXD205. Although it has been shown that detrimental
metabolites of linoleic acid may exacerbate toxicant-induced endothelial cell dysfunction,
it is not known if other endogenously formed metabolites such as nitro-linoleic acid may
be protective.
Thus, the current study has been designed to investigate mechanistically if pro-
inflammatory lipids could increase the toxicity of the coplanar PCB 126, and if nitration of
these pro-inflammatory lipids could ameliorate this exacerbated effect. Our data provide
evidence that free linoleic fatty acid is pro-inflammatory to vascular endothelial cells, and
this toxicity can be exacerbated in the presence of PCBs. On the contrary, our data also
provide evidence that nitration of linoleic acid blunts these exacerbated effects. Since
linoleic acid makes up a large portion of Western diets, it may be beneficial for future
research to investigate mechanisms of endogenously increasing the formation of nitro-
fatty acids in humans.

84

4.3 Materials and methods
4.3.1 Materials and Chemicals
3,3′,4,4′,5-pentachlorobiphenyl (PCB 126) was obtained from AccuStandard Inc. (New
Haven, CT). Linoleic and nitro-linoleic acids were purchased from Cayman Chemical
(Ann Arbor, MI).
4.3.2 Cell culture and experimental media
Primary vascular endothelial cells were isolated from porcine pulmonary arteries (Han et
al., 2010). Cells were cultured in M199 (Gibco, Grand Island, NY), supplemented with
fetal bovine serum (FBS; Gibco). Endothelial cells were grown to confluence, followed
by incubation overnight in medium containing 1% FBS prior to cell treatment. Stock
solutions of linoleic acid or nitro-linoleic acid were purchased or diluted to 1 mg/mL
(EtOH) and subsequently diluted to working stocks. Cells were pretreated with fatty acid
or vehicle control with total volume being 0.1%. Stock solutions of PCB 126 were
prepared in DMSO at 4 mM and subsequently diluted to working stocks in DMSO;
control cultures were treated with DMSO vehicle. The levels of DMSO in experimental
media were 0.05%. Porcine vascular endothelial cells were treated with PCB 126 at 0.03
nM for 6 h.
4.3.3 Real-time PCR
The levels of mRNA expression were assessed by real-time PCR using a CFX96 Touch
Real-Time PCR detection system (BioRad, Hercules, CA) and SYBR Green master mix
(Applied Biosystems) as described earlier (Han et al., 2010). Sequences were designed
using the Primer Express Software 3.0 for real-time PCR (Applied Biosystems) and
synthesized by Integrated DNA Technologies, Inc. (Coralville, IA). Sequences for
porcine VCAM-1 and β-actin were described in earlier articles published from our
laboratory (Ramadass et al., 2003; Majkova et al., 2009). Porcine NQO1 sequences
were: sense, 5′-CCCGGGAACTTTCAGTATCCT-3′; and antisense, 5′-
CTGCGGCTTCCACCTTCTT-3′; porcine HO-1 sequences were: sense, 5’-
GCCATGTGAATGCAACCCTGTGAA-3’; and antisense, 5’-
TTGGGAAAGATGCCACAGACTCCT-3’. Porcine AhR sequences were: sense, 5’-
AGCTGCACTGGGCGTTAAA-3’; and antisense, 5’-GCCACTCGCTTCATCAATTCT-3’.

85

Porcine Cyp1A1 sequences were: sense, 5’-CATCCGGGACATCACAGACA-3’; and
antisense, 5’-GCATTCTCGTCCATCCTCTTG-3’. Porcine MCP-1 sequences were:
sense, 5’-CGGCTGATGAGCTACAGAAGAGT-3’; and antisense, 5’-
GCTTGGGTTCTGCACAGATCT-3’.
4.3.4 Statistical analysis
Data were analyzed using SigmaStat software (Systat Software, Point Richmond, CA).
Comparisons between treatments were made by one-way ANOVA or two-way ANOVA
as appropriate with post-hoc comparisons of the means (Tukey). To elucidate trends
within groups, multiple comparison procedures were completed for tests that displayed
overall significance (p≤0.05-0.1). Interactions between fatty acid treatment and toxicant
exposure were denoted. Groups were considered significantly different with a
determined p value of p≤0.05.
4.4 Results
4.4.1 Parent linoleic acid is pro-inflammatory whereas nitro-linoleic acid is anti-
inflammatory
Previously, we have shown that linoleic acid can promote endothelial cell
dysfunction, as evidenced by a decrease in endothelial barrier function and an increase
in LDL transcytosis109, 207. These studies used fatty acid concentrations up to 90 µM
bound to 30 µM albumen109. Here, we treated primary porcine vascular endothelial cells
with a low concentration (1-3 µM) of free linoleic fatty acid dissolved in EtOH for 6 h and
saw a statistically significant upregulation of VCAM-1 and MCP-1 mRNA expression in a
concentration dependent manner (Fig. 4.1, Fig. 4.2). However, this upregulation was not
observed in cells treated with nitro-linoleic acid. Interestingly, treatment with nitro-
linoleic acid decreased levels of VCAM-1 mRNA approximately 50% compared with
ethanol control (Fig. 4.2).
4.4.2 Parent linoleic acid increases AhR and Cyp1A1 expression, but nitro-linoleic acid
has no effect

86

Since it is known that coplanar PCBs exert their toxicity primarily through the
AhR, we were interested in determining if linoleic or nitro-linoleic acid would modulate
this pathway. Therefore, we treated primary porcine vascular endothelial cells with 1 or
3 µM parent or nitro-metabolite of linoleic acid for 6 hours and harvested for mRNA.
Nitro-linoleic acid had no effect on AhR or Cyp1A1 mRNA expression, however, parent
linoleic acid significantly increased AhR and Cyp1A1 mRNA expression in a dose
dependent manner (Fig. 4.3 and Fig. 4.4).
4.4.3 Nitro-linoleic acid upregulates the antioxidant defense greater than parent linoleic
acid
Recently, it has been shown that certain PUFA metabolites may be protective by
upregulating the endogenous antioxidant defense. Therefore we treated our endothelial
cell model with parent or nitro-linoleic acid for 6 hours and determined mRNA expression
levels of the antioxidant enzymes NQO1 and heme oxygenase-1 (HO-1) via real-time
PCR. Treatment with parent and nitro-linoleic acid both caused an upregulation of
NQO1 at approximately a 4 and 8 fold increased level respectively (Fig. 4.5).
Interestingly, HO-1 was only induced in nitro-fatty acid treated cells and this upregulation
was considerably higher than observed with NQO1 (Fig. 4.5).
4.4.4 PCBs exacerbate linoleic acid-induced increases in Cyp1A1, but pretreatment with
nitro-linoleic acid prevents this exacerbated effect.
In an attempt to determine interactions between diet and toxicant exposure,
primary vascular endothelial cells were pretreated with a low level of linoleic or nitro-
linoleic acid (0.1 μM) for 6 h and then exposed to physiological relevant levels of PCB
126 (0.03 nM) for another 6 h. Since AhR activation has been shown to be necessary for
coplanar PCB toxicity, mRNA levels of the downstream AhR target, Cyp1A1, were
investigated via real time-PCR. Cyp1A1 induction has long been used as a surrogate
marker for coplanar PCB exposure, and in this study, Cyp1A1 was significantly
upregulated in all PCB treatment groups (Fig. 4.6). As was also seen in the experiments
described within section 4.4.2 which utilized 1-3 µM of fatty acid, parent linoleic acid
significantly increased Cyp1A1 mRNA levels in vehicle control (DMSO) treated cells.
Interestingly, in cells that were pretreated with linoleic acid and subsequently exposed to

87

low concentrations of PCB 126, this increase in Cyp1A1 was significantly exacerbated.
However, pretreatment with nitro-linoleic acid returned PCB-induced Cyp1A1 levels back
to vehicle control levels and the observed exacerbated effect was lost.
4.4.5 PCBs exacerbate linoleic acid-induced increases in pro-inflammatory mediators,
but pretreatment with nitro-linoleic acid prevents this exacerbated effect.
Levels of pro-inflammatory mediators such as MCP-1, VCAM-1, and caveolin-1 were
also examined in cells pretreated with fatty acids and subsequently exposed to PCBs.
In ethanol control cells, treatment with low dose of PCB for 6 h did not significantly
upregulate the pro-inflammatory mediators (Fig. 4.7). Parent linoleic acid significantly
increased MCP-1 and VCAM-1 mRNA levels in DMSO treated cells. Interestingly, in
cells that were pretreated with linoleic acid and subsequently exposed to low
concentrations of PCB 126, this increase in MCP-1 and VCAM-1 was significantly
exacerbated. However, pretreatment with nitro-linoleic acid returned PCB-induced
MCP-1 and VCAM-1 levels back to control vehicle levels and the observed exacerbated
effect was lost.
4.5 Discussion
Emerging data now implicate both positive and negative effects related to the
interplay between nutrition and toxicology. Originally, food from the diet were believed to
be an exposure route of toxicants. However, evidence suggests that a person’s diet,
and perhaps more appropriately the specific nutrients found within one’s diet, may either
exacerbate or prevent toxicant-induced diseases13. The protective or detrimental
interactive effects observed may be due to commonalities between toxicant and nutrient
signaling pathways. Nutrients and toxicants can both modulate transcription factors and
signaling mediators related to redox balance, stress response, and inflammation.
Endothelial cells are prime candidates to use as a tool to examine the interplay between
toxicology and nutrition because this cell type normally comes into contact with an array
of circulating nutrients and pollutants. Dysfunction of endothelial cells can occur by
toxicants and be exacerbated by certain pro-oxidative and/or pro-inflammatory diet
derived lipids, which can lead to atherosclerosis and vascular related diseases.

88

Atherosclerosis is a disease of lifelong progression and can be modulated by
many controllable and non-controllable risk factors. Dietary habits, sedentary lifestyle,
and smoking may all be risk factors related to choice, but pollutant exposures leading to
heart disease risk may occur invisibly. Low level exposures occur daily to a wide variety
of environmental stressors including chlorinated toxicants, endocrine disrupting
chemicals, and heavy metals, which by themselves may not elicit life threatening
reactions, but in combination as daily pollutant mixtures or in conjunction with other poor
lifestyle choices (e.g., poor nutritional choices or sedentary lifestyle) may increase the
risk for multiple pro-inflammatory chronic diseases. The results described within this
chapter provide evidence that certain dietary nutrients can exacerbate the toxicity of
physiologically relevant low levels of persistent organic pollutants. Also, it was
determined that the addition of an NO2 moiety to form the nitro-fatty acid version of
linoleic acid effectively eliminated this exacerbated toxicity. This observation is of
importance because linoleic acid can be endogenously nitrated within the body, but the
control mechanisms regulating nitro-fatty acid formation are not well understood.
Nitro-fatty acids are a group of endogenously formed bioactive lipid metabolites
that have been examined for protective roles in multiple chronic diseases. Nitro-oleic
and nitro-linoleic acid are two highly studied fatty acid derivatives due to their observable
presence in human plasma and anti-inflammatory nature in cell and mouse models of
disease. Nitro-oleic acid has been shown to prevent against angiotensin II- induced
hypertension, endotoxin-induced endotoxemia, and LPS-induced lung injury208.
Researchers may be focused primarily on nitro-oleic acid in an attempt to identify novel
mechanisms of protection from the consumption of oleic acid-rich extra virgin olive oil. In
this current study, treatment with nitro-linoleic acid increased the expression of
protective HO-1 (a Nrf2 controllable antioxidant enzyme) and decreased pro-
inflammatory mediators, especially when compared to cells treated with pro-
inflammatory parent linoleic acid. Interestingly, both nitro-linoleic and parent linoleic acid
increased the expression of GST. GST has binding sites for both Nrf2 and AhR, and in
this current study it was observed that parent linoleic acid treatment upregulated AhR209.
AhR and Nrf2 can work in concert to eliminate compounds from the body, but sometimes
AhR activation can lead to the creation of even more toxic metabolites. Identifying the
causative bioactive nutrients within an overall healthful diet is an emerging but still
difficult field of study. Arguably, it may be even more helpful to identify detrimental

89

nutrients and nutrient metabolites that can detrimentally effect health outcomes or act as
biomarkers.
The endogenous metabolism and breakdown of nutrients can lead to the
formation of mediators linked to inflammation and chronic disease. Specifically related
to this chapter, the parent omega-6 fatty acid Linoleic acid can be oxidized enzymatically
and non-enzymatically to produce possibly harmful byproducts. Interestingly,
cytochrome P450s have been shown to be critical mediators of both PCB toxicity and
the formation of toxic linoleic acid metabolites called leukotoxins (LTX and LTXD). In
this current work, it was determined that treatment for 6 h with linoleic acid upregulated
Cyp1A1 mRNA levels, which has routinely been utilized as a marker for AhR activation.
The observed upregulation of Cyp1A1 may have been due to the observed AhR
message increase, but others have shown that Cyp1A1 can be upregulated by fatty
acids and fatty acid metabolites in a PPARα-mediated mechanism210. In similar previous
work, 6 h treatment with linoleic acid lead to an upregulation of another CYP family
member Cyp2C9 and ultimately leading to superoxide formation and oxidative stress211.
Our current work did not examine oxidative stress conditions in our porcine endothelial
cell model, but did look at downstream markers of inflammation such as MCP-1 and
VCAM-1. In each of these cases linoleic acid was pro-inflammatory. Certain omega-6
fatty acids and their metabolites are known to be toxic to endothelial cells. It is unknown
what levels of toxic linoleic acid metabolites are formed within the cell after the exposure
conditions in this current work, but others have reported toxicity of linoleic acid
metabolites such as LTX and LTXD at concentrations of 40 µM205. These low levels
were shown to increase albumin transfer and cause endothelial cell dysfunction.
Linoleic acid is found abundantly in Western diets and may reach 8-12 grams per day in
adults210. Lipid peroxidation products of linoleic acid also exist, and in fact, the pool of
peroxidation productions is dominated by linoleic acid-based compounds212. Cellular
lipoxygenases generate lipid hydroperoxides and reactive oxygen species and the major
metabolites formed from linoleic acid are 9-hydroperoxy-10,12-octadienoic acid (9-
HPODE) and 13-hydroperoxy-9,11-octadecadienoic acid (13-HPODE). Lipid
peroxidation can also lead to the formation of highly reactive and toxic metabolites such
as 4-hydroxynonenal (4-HNE)212. Levels of these toxic metabolites were not examined
in this current work, but would be a beneficial mechanistic link between the observed
toxicity of parent but not nitro-linoleic acid. Perhaps the addition of the NO2 to the
linoleic acid can prevent or slow the enzymatic and non-enzymatic production of toxic

90

metabolites. Therefore, it may be critical to better understand the formation of toxic and
protective linoleic metabolites to better identify and communicate risks with eating diets
high in omega-6 fatty acids.
Understanding the interplay and interactions between toxicants and nutrients will
allow for more effective exposure risk assessments. The exacerbated effect of certain
nutrients on toxicological outcomes has been proposed previously and has been seen
with multiple toxicants and nutrient combinations13. In this work, pretreatment with
linoleic acid but not nitro-linoleic acid exacerbated PCB-induced Cyp1A1, VCAM-1, and
MCP-1 upregulation. This effect may be linked to PCB 126 and linoleic acid treatments
both being able to activate the AhR and subsequently increase oxidative stress
conditions. It would be interesting to examine the interactive effects between a nutrient
and toxicant that activate dissimilar pathways. Pretreatment with nitro-linoleic acid may
be protective by not sensitizing AhR prior to toxicant exposure and in addition may
activate Nrf2 and the antioxidant response. As seen in Chapter 3 of this dissertation,
dietary interventions upregulated the antioxidant response which allowed for a more
efficient and effective physiological response in the presence of PCB.
In summary, our current study supports our previous work illustrating that a major
dietary nutrient found in Western diets, linoleic acid, is pro-inflammatory to endothelial
cells and exerts exacerbated effects in the presence of PCBs. Interestingly, our current
in vitro data contribute to the overall hypothesis that certain nutrients can decrease the
toxicity of environmental insults. Although the parent linoleic acid appeared to be pro-
inflammatory, pretreatment with the endogenously created metabolite, nitro linoleic acid,
prevented this exacerbated effect. More studies are needed to further understand
detailed mechanisms of the creation of endogenously controlled nutrient metabolites and
how to possibly shift the pool of bioactive lipids from detrimental to positive.

Fig. 4.1 Relative mRNA levels of monocyte chemoattractant protein-1 in cells treated for
6 h with parent or nitrated linoleic acid (1 or 3 μM). Parent linoleic acid was pro-
inflammatory and increased MCP-1 levels but this increase was not seen in nitro-fatty
acid treated cells. All values were determined using the relative quantification method
(ΔΔCt) as compared to EtOH control. Data are presented as mean±S.E.M (n=3).
Different letters denote statistical significance between treatment groups.
0.000
0.200
0.400
0.600
0.800
1.000
1.200
1.400
1.600
Vehicle 1.0 µM Linoleic
Acid
1.0 µM Nitro-
Linoleic Acid
MCP-1relativemRNA
(arbitraryunits)
p=0.02p=0.09
0.000
0.500
1.000
1.500
2.000
2.500
3.000
3.500
4.000
EtOH 3.0 µM Linoleic
Acid
3.0 µM Nitro-
Linoleic Acid
MCP-1relativemRNA
(arbitraryunits)
A
B
A
1 way-ANOVA: p=0.023
91

Fig. 4.2 Relative mRNA levels of vascular cell adhesion molecule-1 in cells treated for 6
h with parent or nitrated linoleic acid (1 or 3 μM). Parent linoleic acid was pro-
inflammatory and increased VCAM-1 levels but nitro-fatty acid treatment was anti-
inflammatory. All values were determined using the relative quantification method (ΔΔCt)
as compared to EtOH control. Data are presented as mean±S.E.M (n=3). Different
letters denote statistical significance between treatment groups.
0.000
0.200
0.400
0.600
0.800
1.000
1.200
1.400
Vehicle 1.0 µM Linoleic
Acid
1.0 µM Nitro-
Linoleic Acid
VCAM-1relativemRNA
(arbitraryunits)
A
A
B
0.000
0.500
1.000
1.500
2.000
2.500
3.000
3.500
Acid
3.0 µM Nitro-
Linoleic Acid
VCAM-1relativemRNA
(arbitraryunits)
A
B
B
1 way-ANOVA: p<0.001
92

Fig. 4.3 Relative mRNA levels of Aryl hydrocarbon receptor and cytochrome P4501A1 in
cells treated for 6 h with parent or nitrated linoleic acid (1 μM). Parent linoleic acid
upregulated AhR as well as Cyp1A1, but this upregulation was not seen in nitro-fatty
acid treated cells. All values were determined using the relative quantification method
(ΔΔCt) as compared to EtOH control. Data are presented as mean±S.E.M (n=3).
Different letters denote statistical significance between treatment groups.
0.000
0.500
1.000
1.500
2.000
2.500
3.000
3.500
4.000
Acid
1.0 µM Nitro-
Linoleic Acid
Cyp1A1relativemRNA
(arbitraryunits)
A
0.000
0.200
0.400
0.600
0.800
1.000
1.200
1.400
1.600
1.800
EtoH 1.0 µM Linoleic
Acid
1.0 µM Nitro-
Linoleic Acid
AhRrelativemRNA
(arbitraryunits)
A A
B
B
B
A
93

Fig. 4.4 Relative mRNA levels of aryl hydrocarbon receptor and cytochrome P4501A1 in
cells treated for 6 h with parent or nitrated linoleic acid (3 μM). Parent linoleic acid
upregulated AhR as well as Cyp1A1, but this upregulation was not seen in nitro-fatty
acid treated cells (ptrend=0.09). All values were determined using the relative
quantification method (ΔΔCt) as compared to EtOH control. Data are presented as
mean±S.E.M (n=3). Different letters denote statistical significance between treatment
groups.
0.000
0.500
1.000
1.500
2.000
2.500
3.000
Acid
3.0 µM Nitro-
Linoleic Acid
AhRrelativemRNA
(arbitraryunits)
A
B
A
0.000
2.000
4.000
6.000
8.000
10.000
12.000
Acid
3.0 µM Nitro-
Linoleic Acid
CYP1A1relativemRNA
(arbitraryunits)
A
B
A
94

Fig. 4.5 Relative mRNA levels of heme oxygenase-1 and NADPH quinone oxido-
reducatase-1 (antioxidant enzymes) in cells treated for 6 h with parent or nitrated linoleic
acid (3 μM). Parent linoleic acid upregulated NQO1, but not HO-1 whereas nitro-fatty
acid upregulated both protective enzymes. All values were determined using the relative
mean±S.E.M (n=3). Different letters denote statistical significance between treatment
groups.
0.000
5.000
10.000
15.000
20.000
25.000
Acid
3.0 µM Nitro-
Linoleic Acid
HO-1relativemRNA
(arbitraryunits)
A A
B
0.000
1.000
2.000
3.000
4.000
5.000
6.000
7.000
8.000
9.000
Acid
3.0 µM Nitro-
Linoleic Acid
NQO1relativemRNA
(arbitraryunits)
A
B
C
95

96

Fig. 4.6 Relative mRNA levels of cytochrome p4501A1 in cells pretreated for 6 h with
PCB 126. Cells treated with PCB 126 exhibited an upregulated CYP1A1 response
(*p<0.05). This upregulation of Cyp1A1 was exacerbated in cells treated with parent
linoleic acid, but not in cells pretreated with nitro-fatty acid. All values were determined
using the relative quantification method (ΔΔCt) as compared to EtOH control. Data are
presented as mean±S.E.M (n=3). * denotes p<0.05 compared to corresponding DMSO
control.
0
5
10
15
20
25
30
35
EtOH Linoleic Nitro-Linoleic
CYP1A1relativemRNA
(arbitraryunits)
DMSO PCB
*
*
*
p=0.03
p<0.001p<0.001
2 way-ANOVA
Interaction: p=0.001

97

Fig. 4.7 Relative mRNA levels of MCP1 or VCAM-1 in cells pretreated for 6 h with parent
or nitrated linoleic acid (0.1 μM) and subsequently treated for 6h with 0.03 nM PCB 126.
Control cells treated with PCB 126 exhibited low induction of the pro-inflammatory
markers after an acute exposure to PCB (6 h). Parent linoleic acid was pro-inflammatory
and significantly exacerbated the PCB effect. Cells pretreated with nitro-fatty acid
mirrored control cells’ responses. All values were determined using the relative
mean±S.E.M (n=3). * denotes p<0.05 compared to corresponding DMSO control.
0
2
4
6
8
10
12
14
MCP-1relativemRNA
(arbitraryunits)
DMSO PCB
* p<0.001p<0.001
0
2
4
6
8
10
12
VCAM-1relativemRNA
(arbitraryunits)
DMSO PCB
2 way-ANOVA
p<0.001 p<0.001
p=0.009 p=0.006
2 way-ANOVA

Chapter Five. Overall discussion
5.1. Discussion
5.1.1 Summary
The research presented within this dissertation provides new mechanistic
toxicological insights into polychlorinated biphenyl-induced endothelial cell dysfunction
and inflammation. Ultimately, we are interested in decreasing the negative health risks
associated with pollutant exposures; thus this dissertation also provides novel evidence
that diets high in healthful bioactive nutrients may be a sensible means of modulating
associated disease risks. Caveolae harbor numerous inflammatory proteins, and Nrf2 is
considered the master antioxidant controller in most cell types including those that make
up vascular tissues. Caveolae and Nrf2 pathways are critical mediators of PCB-induced
endothelial cell dysfunction as well as nutritional modulation of PCB vascular toxicity.
Decreasing Cav-1 in endothelial cells prevents PCB-induced upregulation of pro-
inflammatory mediators, and this protection may be due to a direct upregulation of
protective antioxidant enzymes under the control of the transcription factor Nrf2. Dietary
intervention strategies utilizing flavonoid or bioactive fatty acids can modulate the toxicity
of coplanar PCB 126. We demonstrated that a diet enriched in green tea polyphenols
can decrease oxidative stress and inflammation in mice subsequently exposed to PCB.
Finally, we also examined the role of bioactive nutrient metabolites, such as the
endogenously formed nitro-fatty acids, as possible novel modulators of toxicant-induced
endothelial cell dysfunction.
5.1.2 Decreasing Cav-1 upregulates the Nrf2 antioxidant response
Endothelial cells come in to contact with an array of persistent organic pollutants
daily and have evolved multiple means of protecting against associated cellular stresses.
Coplanar PCBs, the most toxic to endothelial cells, have been shown to induce an
increase in ROS and RNS primarily through an AhR and Cyp1A1 mediated
mechanism12b, 12c. AhR has been shown to locate and concentrate within caveolae lipid
domains and specifically has been shown to co-immunoprecipitate with the major
structural protein of caveolae, Cav-112b. In fact, treatment of endothelial cells with
coplanar PCBs induces Cav-1 expression and increases this partnership with AhR. Our
98

laboratory determined that loss of Cav-1, either through siRNA knockdown in cells or the
use of Cav-1 null mice, was protective and mitigated PCB-induced endothelial cell
dysfunction and the earliest stages of PCB-induced atherosclerosis12a, 23b. Multiple
hypotheses were postulated to explain this protection including decreased uptake of
PCBs into endothelial cells, modulation of AhR signaling due to the loss of Cav-1, and
perhaps modulation of cross-talk with other signaling partners related to inflammation
and PCB-induced endothelial cell toxicity. This dissertation has investigated this final
hypothesis and determined that Cav-1 signaling can modulate the antioxidant defense
within a cell by altering the Nrf2 pathway.
Recently it has been shown that downregulation of Cav-1 leads to an increase in
protective HO-1, an antioxidant controlled by Nrf2116b. This observation led us to
investigate mechanistically the link between Cav-1 and Nrf2. We determined that
decreasing the protein levels of Cav-1 upregulated Nrf2 activation leading to an increase
in cellular levels of multiple antioxidant enzymes and ultimately prevented PCB-induced
endothelial cell activation. Interestingly, two other independent research groups also
recently published similar results detailing Cav-1’s inhibitory role of Nrf298, 140, 160. These
highly mechanistic works focused on direct inhibition of Nrf2 through Cav-1’s binding
domain. Their work suggests that one of the interaction mechanisms linking Cav-1 and
Nrf2 pathways is a direct binding and inhibition, much like in the case of eNOS/Cav-1
interaction. The work described within this dissertation details other possible
mechanisms of Cav-1 Nrf2 cross-talk, including the modulation of Nrf2 inhibitor proteins
such as Keap1 and Fyn kinase. Mechanisms linking the downregulation of Cav-1 levels
to also downregulation of Keap1 and Fyn are unknown and present the possibility for
multiple future studies. A better understanding of this “blackbox” could lead to new
therapeutic targets that ultimately activate Nrf2 and prevent inflammation and oxidative
stress.
The crosstalk between caveolae and Nrf2 signaling pathways appears to be
evolutionarily conserved among mammalian species. A strength of chapter two of this
dissertation is that cross-talk between Cav-1 and Nrf2 was observed in three distinct
species; human, pig, and mouse. This may support the hypothesis that caveolae and
specifically Cav-1 are critical mediators of inflammation and oxidative stress within
endothelial cells, and targeted downregulation of endothelial cell Cav-1 may protect
against atherosclerosis, inflammation, and toxicant-induced disease. A goal of our
99

laboratory is to determine therapeutic bioactive nutrients that can modulate caveolae
and/or Nrf2 signaling mechanisms and ultimately protect against environmentally-
induced stress and disease.
5.1.3 A diet high in green tea polyphenols modulates the toxicity of PCB 126
Nutrients found within fruits and vegetables are gaining much attention for their
possible anti-inflammatory and cardioprotective effects. Our laboratory has focused
primarily on flavonoids and polyphenols and their protective effects related to PCB-
induced endothelial cell dysfunction. Recently we determined, in our porcine endothelial
cell model, that pretreatment with a flavonoid found within green tea, epigallocatechin
gallate (EGCG), limited PCB-induced upregualtion of MCP-1 and VCAM-1. This
protection may have been due to an increase in Nrf2 controlled antioxidant genes in the
cells pretreated with the bioactive nutrient73b. In work described within chapter three of
this dissertation we attempted to further substantiate this previous study by
supplementing mice with a diet high in green tea catechins and subsequently treating
with low level does of coplanar PCB.
Green tea supplementation in the diet had interesting effects on PCB toxicity
and overall was anti-inflammatory when in the presence of PCB. We originally
hypothesized, based off of previous cell culture work, that supplementation with green
tea catechins would increase Nrf2 activation, decrease AhR signaling, and ultimately act
as an anti-inflammatory agent in both vehicle and PCB-treated groups. Interestingly, we
saw barely any green tea-induced upregulation of Nrf2-controlled genes in the
associated DMSO group, but saw drastic and consistent responses in mice fed a green
tea supplemented diet and subsequently exposed to PCBs. Concerning AhR, green tea
supplementation did not decrease basal levels of AhR or AhR targets such as Cyp1A1
and Cyp1B1, but interestingly caused an increase in these three targets in mice
supplemented with green tea and subsequently exposed to PCB. Ultimately however,
we determined that the unexpected upregulation of both AhR and Nrf2 in the
concomitant group resulted in a significant decrease in in vivo oxidative stress markers
and a downregulation of pro-inflammatory mediators. Our current working hypothesis is
that the green tea extract worked as a hormetic and ultimately primed the mouse’s
antioxidant and xenobiotic defenses prior to the subsequent PCB exposure. Thus, once
a secondary stressor was encountered, a set of more efficient and effective anti-
100

inflammatory events occurred. AhR upregulation can lead to increased metabolism and
excretion of xenobiotics and this was examined partially in this study. Unfortunately,
feces and urine were not collected and only plasma levels of PCB 126 and PCB126-OH
metabolites were examined. We believe that certain nutrients can increase the excretion
of toxicants ultimately decreasing the body burden and decreasing the potential toxicity
of lipid soluble pollutants. Proof of principle studies have investigated this hypothesis
and the exciting results garner further future investigation129a, 133a. Although the mice
were supplemented with an extract of green polyphenols, more than likely the individual
catechins were quickly metabolized to multiple breakdown products. An emerging field
of nutrition now is interested in determining the kinetics of formation and
pharmacological effects (either positive or negative) of nutrient metabolites. It is
unknown if the interaction between PCBs and green tea diet altered the cellular pool of
catechins or catechin metabolites, but this would be an interesting future study that may
help mechanistically explain protection observed only in the concomitant group. In
chapter four of this dissertation, this emerging area of nutrition research was examined
by comparing the detrimental and protective effects of parent versus an endogenous
metabolite using an omega-6 fatty acid as a model.
5.1.4 Parent linoleic acid exacerbates PCB-induced endothelial cell dysfunction whereas
treatment with the endogenously formed metabolite, nitro-linoleic acid, is anti-
inflammatory.
The endogenous metabolism of nutrients can lead to toxic and/or protective
bioactive mediators. Many inexpensive plant derived oils are rich in linoleic acid, which
makes this fatty acid a predominate component in Western diets. Reducing the intake of
this nutrient has been shown to be protective against multiple proinflammatory
diseases203. Linoleic acid can be broken down by multiple metabolic enzymes including
cytochrome P450s leading to toxic metabolites such as leukotoxin (LTX) 205. However,
emerging evidence now shows that linoleic acid can be metabolized into protective anti-
inflammatory mediators such as the recently identified nitro-linoleic acid. Nitro-fatty
acids can activate Nrf2 and inhibit pro-inflammatory NFκB, and in mouse models of
disease, have been shown to prevent atherosclerosis, sepsis, and vascular injury144c, 144d,
147a, 208a. Understanding the cellular control mechanisms governing the formation of
either protective or detrimental metabolites is important, but more work is needed so that
101

these pathways can be effectively manipulated. Western diets are high in linoleic acid
but can also include other pro-inflammatory compounds that result in exacerbated toxic
effects.
Environmental pollutants such as lipophilic polychlorinated biphenyls enter the
body primarily through ingestion and can be stored for long durations in adipose tissues.
Endothelial cells are prime candidates to study the interactions between pollutants and
nutrients because this cell type routinely comes in to contact with a myriad of
compounds via the circulation. Our laboratory previously reported that endothelial cells
pretreated with an omega-6 fatty acid were at greater risk for PCB-induced
complications including exacerbated oxidative stress and decreased endothelial cell
barrier function109. Also, it was determined in a more recent study that pretreatment with
linoleic acid exacerbated tumor necrosis factor alpha (TNF-alpha) induced oxidative
stress and endothelial cell dysfunction213. Interestingly, caveolae and Cav-1 may be
upregulated both by linoleic acid and coplanar PCBs, and silencing of Cav-1 has been
shown in our laboratory to prevent linoleic acid as well as PCB-induced endothelial cell
activation23b, 214. A recent publication implicated nitro-fatty acids as possible
downregulators of Cav-1, so we investigated the hypothesis that pretreatment with nitro-
linoleic acid could prevent PCB-induced endothelial cell toxicity. In our current study we
again determined that linoleic acid was pro-inflammatory, when treated alone, as
evidenced by increases in expression levels of MCP-1 and VCAM-1. The levels of these
pro-inflammatory mediators were significantly exacerbated once PCB added. On the
contrary, treatment with nitro-linoleic acid was anti-inflammatory and did not result in an
exacerbated PCB response. Importantly, the low concentrations of PCB utilized within
this study mirror blood levels found in humans, and since linoleic acid is found also at
high levels in humans, interactive exacerbatory effects may be physiologically common.
5.2 Future directions and conclusions
The interplay between nutrition and toxicology is a growing field of discovery
worthy of intense investigation. Data described within this dissertation and elsewhere
now implicate either a protective or detrimental modulatory role of nutrients on the
toxicity of environmentally relevant pollutants. Numerous synthetic chemicals exist that
may exert stress on physiological systems, and countless more emerging pollutants will
be introduced into the environment as a growing number of countries become ever more
102

industrialized. Toxicologists have long studied the detrimental effects of individual
compounds, and their perseverance has helped to impact change at the highest levels of
industry and government. However, as body burdens of complex mixtures increase and
the production of potential dangerous compounds overtakes the capacity for in-depth
toxicity testing, it is important to identify sensible means of biomedically reducing the
risks of environmental pollutant-induced diseases.
There is strong evidence that diets rich in bioactive lipids and plant-derived
polyphenols protect against cardiovascular diseases generally215. This may be due in
part to a significant improvement in endothelial function and a decrease in inflammatory
cytokines216. Polyphenols (e.g., flavonoids and other bioactive compounds) are found in
fruits and vegetables217 and share antioxidant and anti-inflammatory properties218. The
health effects of polyphenols depend on the amount consumed and on their
bioavailability217, 219. Little is known about the effects of bioactive lipids and other
antioxidant and anti-inflammatory plant-derived nutrients (e.g., polyphenols) on
environmental contaminant-induced cytotoxicity. Potential protective mechanisms of
nutrients may involve modification of AhR and CYP1A1 expression and activation200, 220.
Our own data suggest that protective effects of bioactive fatty acids and flavonoids are
initiated upstream from Cyp1A1 and that these nutrients may be of value for inhibiting
the toxic effects of PCBs on vascular endothelial cells 97, 221.
We hypothesize that bioactive compounds common in fruits and vegetables protect
the vascular endothelium against toxic insults by induction of Nrf2 signaling and
subsequent upregulation of detoxifying or antioxidant enzymes. We have generated
evidence indicating that the complex interplay between toxicant exposure and nutritional
profile is integral to the development of new multi-faceted, thus more precise, risk
assessment models that accomplish a more comprehensive set of perspectives on true
risk to an at-risk population. Traditional risk assessment is limited to studying the harmful
effects to human health/ecological systems resulting solely from exposure to an
environmental stressor. However, multiple stressors, chemical and non-chemical in
origin, likely contribute to the overall disease risk that is related to exposure to a toxicant
or mixture of pollutants. To better qualify cumulative risk in an individual or a population,
non-chemical stressors, including psychosocial, physical, and/or dietary components
need to be considered. We propose a paradigm shift whereby nutritional status or
dietary health is a critical player in the overall vulnerability to environmental
103

stressors, and thus nutrition must be considered in overall risk assessment222. A body of
evidence suggests that healthful nutrition offers a viable modulator that could markedly
buffer the body against toxic chemical insult from persistent chlorinated organics.
Multiple future directions can be examined related to the work described within
this dissertation. First off, our laboratory has long investigated the role endothelial cell
caveolae play in PCB-induced endothelial cell dysfunction. Endothelial cell dysfunction
is just one important component of the initiation of atherosclerosis, and impacts of
immunological cells such as macrophages may also play a critical role. Interestingly,
Cav-1 appears to be critical for the differentiation of monocytes into macrophages and
Cav-1 is increased once monocytes adhere to the endothelium223. Therefore in the
future we could examine the impact of downregulating Cav-1 in macrophages and the
impact on PCB-induced vascular toxicity. It would be interesting to observe similar Cav-
1 Nrf2 crosstalk in macrophages and other vascular related cell types.
Another future direction for the laboratory will be to continue to better identify and
mirror true human exposures to environmental pollutants. Throughout this dissertation
we have utilized a single PCB congener, PCB 126, as a model toxicant. Since human
exposures to a single PCB congener rarely occur, we could study primarily PCB 126 and
a simple mixture consiting of a coplanar (126), noncoplanar (153) and mixed congener
(118) PCBs, all of which are detectable in human serum at significant levels224; 46.
Concentrations of the individual congeners to be used in these studies would reflect
levels found in human plasma225. Our laboratory has long been priviledged to be part of
the NIEHS-funded Superfund Research Program, and this funding has allowed for us to
create strong collaborations with analytical instrumentation experts that can help identify
concentrations of a wide variety of environmental pollutants within plasma and tissues of
people. Also, these collaborations have helped our nutritional modulation studies by
identifying levels of bioactive mediators within our samples. We plan to identify
biomarkers which can predict successful nutritional interventions against environmental
pollutants and associated diseases. Personally, I have worked with the Superfund
Research Support Core to identify levels of nitro-fatty acids in human and mouse
plasma, and hopefully these preliminary studies can lead to future directions for our
laboratory (see Appendix A). It would be extremely interesting to identfiy correlations
between nutrition, toxicant body burden, and predisposition to cardiovascular disease in
populations residing near hazardous waste sites.
104

In conclusion, we were able to demonstrate that PCB 126 induces endothelial
cell dysfunction in a Cav-1 mediated mechanism. Downregulating Cav-1 was shown to
upregulate the protective Nrf2 pathway which helped to block PCB-induced endothelial
cell toxicity. We have shown that dietary nutrients can modulate the toxicity of PCBs
through Cav-1 and/or Nrf2 pathways, and nutritional modulation may be an effective
means of preventing toxicant-associated diseases. Within this dissertation, we
demonstrated that a flavonoid-rich diet could decrease oxidative stress and inflammation
when in the presence of PCB. Additionally, we also showed that certain pro-
inflammatory nutrients could exacerbate PCB-induced endothelial cell toxicity whereas a
bioactive nutrient metabolite was anti-inflammatory. Together, these data support the
paradigm that nutritional modulation may be a sensible means of reducing disease risks
associated with exposure to environmental pollutants.
105

106

Appendices
Appendix A. Novel analytical methodologies to study anti-inflammatory nitro-
fatty acids
A.1 Synopsis
It is widely hypothesized that the possible beneficial health effects of certain
polyunsaturated fatty acids involves their enzymatic or non-enzymatic conversion to
biologically active metabolites. Accordingly, definitive identification and quantitation of
bioactive fatty acid derivatives is essential for both evaluating the beneficial effects of
these nutrients and identifying biological markers to monitor the therapeutic efficacy of
fatty acid administration in clinical or preclinical settings. Nitro-fatty acids are a class of
fatty acid metabolites that are formed by chemical nitration of the double bonds of
unsaturated fatty acids, and in mouse models, nitro-fatty acids decrease systemic
oxidative stress and inflammation suggesting that these could be biologically relevant
mediators. However, in large part due to inherent limitations of currently used analytical
approaches for the detection and quantitation of free and esterified nitro-fatty acids,
many questions remain to be elucidated regarding their abundance endogenous
metabolism and biological actions. In this study we developed a sensitive and specific
method for detection and quantitation of nitro fatty acids by combining chemical
derivatization with electrospray ionization high resolution tandem mass spectrometry.
This method involves formation of methyl pyridinium derivatives of nitro-fatty acids which
ionize very strongly in positive mode resulting in increased sensitivity of more than 500-
fold over underivatized fatty acids monitored in negative ionization mode. These
derivatives were analyzed by HPLC electrospray ionization tandem mass spectrometry
using an AB Sciex 5600 quadrupole TOF MS. Together, these methods allow us to
identify the ions of the parent nitro-fatty acid derivative at high resolution and confirm
their identities by high resolution analysis of their product ion spectra. To validate these
methods, we demonstrate detection and quantitation of nitro oleate in plasma following
intraperitoneal administration to mice. In conclusion, we have developed and validated
novel analytical methodologies to study anti-inflammatory nitro-fatty acids which may

107

aide in advancing research of nitro-fatty acids as a therapeutic agent against
inflammation and atherosclerosis.
A.2 Introduction
Nitro-fatty acids are a relatively newly discovered class of modified lipids that exhibit
anti-inflammatory properties via multiple mechanisms. Unsubstituted fatty acids such as
oleic acid (18:1) and arachidonic acid (20:4) can be nitrated endogenously by multiple
enzymatic and non-enzymatic reactions such as peroxynitrite mediated events145. The
addition of NO2 moieties to unsaturated fatty acids has been shown to result in
generation of strongly anti-inflammatory mediators as evidenced by their ability to inhibit
production of pro-inflammatory mediators, to induce expression of protective heme
oxygenase-1 and to promote relaxation of blood vessels146. Most notably,
atherosclerosis prone ApoE mice administered nitro-oleic acid were protected from
tissue oxidation, foam cell formation, and overall inflammation144d. Mechanistically, this
class of bioactive lipid can protect via multiple mechanisms including upregulation of
PPARγ and Nrf2 as well as downregulation of pro-inflammatory NFκB147. Importantly,
recent evidence suggests that activation of these pathways exhibits specificity for the
chain length and positional substitution of the nitro group147a. Although a large body of
evidence supports the paradigm that nitro-fatty acids are anti-inflammatory and
protective, many unresolved and controversial issues remain.
Integrally important to the progress and advancement of nitro-fatty acid research
is the ability to sensitively and accurately measure these species in plasma and tissues.
Even though nitro-fatty acids have been studied for over a decade, there still is no
universally agreed upon method to extract, identify, and quantitate these species. Due
to technological limitations explained in more detail below, relatively basic problems,
such as the identification and quantification of free nitro-fatty acid levels in plasma,
remain unresolved. For example, depending on what extraction and analysis techniques
were utilized, published baseline levels of nitro-oleic acid have ranged from pM to nM
concentrations, and no true consensus exists if the observed levels are skewed by
artifacts created during sample preparation226.

108

Current analytical limitations concerning nitro-fatty acid detection
To date, published measurements of nitro-fatty acids have used electrospray
ionization tandem mass spectrometry using triple quadrupole instruments operated in
selected ion monitoring mode. A common problem with this approach for free fatty acids
is that these species only ionize in negative mode which can result in skewed data due
to the acidic conditions necessary for reverse phase chromatography. Nitro-fatty acids
do ionize in negative mode but the diagnostic nitrite product ion formed is not truly
conclusive of the parent nitro-fatty acid species. An additional issue is that because of
the chemical diversity of fatty acids in biological samples, theoretically, these could
contain multiple nitro-fatty acid species (or their isotopomers) at every mass unit which
traditional quadrupole instruments could misconstrue. Although some of the published
work in this field likely provides convincing evidence for the presence of particular nitro-
fatty acids in biological samples, these described concerns probably account for much of
the uncertainty and confusion in the field regarding the spectrum and absolute levels of
nitro-fatty acids present in biological samples. To address these issues we adapted a
chemical derivatization approach used in conjunction with high resolution tandem mass
spectrometry using a quadrupole time of flight (TOF) instrument to provide a sensitive
and specific way to profile and quantitate nitro-fatty acids.
As explained above, a second concern is that nitro-fatty acid parent ions may not
be selected specifically at the resolution of quadrupole mass analyzers. To circumvent
this problem we next developed methods for analysis of methyl pyridinium derivatives of
nitro-fatty acids using our AB Sciex 5600 quadrupole TOF mass spectrometer. In brief,
these methods allow us to identify the ions of the parent nitro-fatty acid derivative at high
resolution and confirm their identities by other state of the art LC/MS/MS techniques
such as mass defect and isotopomer ratio pattern analyses. Further identification of
these species is then accomplished by generating high resolution product ion spectra
which can help to confirm the presence of the nitronium ion that is diagnostic of nitro-
fatty acids.
Nitro-fatty acids are anti-inflammatory and anti-atherosclerotic lipid species that
hold much clinical promise, however, due to technological limitations, multiple
controversial issues remain unsolved. This proposed study will (1) validate an effective,
specific and sensitive nitro-fatty acid extraction procedure; (2) use chemical
derivatization HR electrospray ionization tandem mass spectrometry and stable isotope
dilution to profile and quantitate nitro-fatty acids in biological samples.

109

A.3 Materials and methods:
A.3.1 Animal handling and use
Animal procedures were conducted under the approval of the University Committee on
Use and Care of Animals at the University of Kentucky and conform to the Guide for the
Care and Use of Laboratory Animals, US National Institutes of Health. The animals
used in this study, C57BL/6J mice, were obtained from the Jackson Laboratory. Mice
were injected with 2 nanomoles/gram mouse of 10-nitro-oleate for 10 minutes or vehicle
and plasma was collected via cardiac puncture.
A.3.2 Mass spectrometric analysis of nitro-oleate
Quantification of Nitro-oleate in plasma was conducted by high-performance liquid
chromatography electrospray ionization tandem mass spectrometry (HPLC-ESI-MS/MS)
using an ABSciex 5600 “Triple TOF” hybrid quadrupole time of flight mass spectrometer.
9 and 10-nitro-octadecenoic acid was purchased from Cayman Chemical. Quantification
of nitro-oleate in plasma was determined by calibration curve of infused nitro-oleate
standard and extraction recovery was normalized to C17 fatty acid internal standard.
Plasma (20 μl) were extracted with 80 μl of cold acetonitrile in the presence of C17 fatty
acid internal standard (1µM). Samples were vortexed, centrifuged at 14000g 4ºC, for 10
min and supernatant transferred directly into vials to be analyzed by HPLC-MSMS. Nitro
FA were measured either in the negative mode or as methyl pyridinium derivatives in
positive mode. Samples were derivatized with 2-bromo-1-methylpyridinium iodide
(BMP) and 3-carbinol-1-methylpyridinium iodide (CMP), forming 3-acyloxymethyl-1-
methylpyridinium iodide (AMMP). Samples were dried, reconstituted in 99/1
methanol/water containing 0.1% ammonium formate and 0.5% formic acid, and analyzed
using the ABSciex 5600 instrument. Underivatized Nitro-fatty acids in negative mode
were resolved using a Agilent Eclipse XDB C8 column, 5 µM, 4.6 X 150 mm with water
+ 0.05% formic acid as solvent A and / 95/5- acetonitrile/ water+ 0.05% formic as solvent
B. AMMP derivatized nitro-FAs were resolved using a 75/25 of methanol/ water with
formic acid (0.5%) and 5 mM ammonium formate (0.1%) (A) & 99/1of methanol/ water
with formic acid (0.5%) and 5 mM ammonium formate (0.1%) (B) solvent system.

110

HR product ion spectrum of (Nitrooleate, m/z 326.233 M-H-) in the negative mode
resulted in product ions of 45.998 and 170.155, which are representative of nitro-oleate.
HR MRM scans of 433.2 (AMMP-Nitrooleate) in the positive mode resulted in product
ions of m/z 107.07, 122.06, and 386.31 which are derived from AMMP-nitro-oleate.
A.3.3 Acidic chloroform lipid extraction
Ice cold MeOH was added to chloroform and 0.1M HCl. 50 µL of plasma was added
to each sample vial along with 50 µL of 1 µM internal standard. Too separate phases,
CHCl3 and 1.3 ml 0.1M HCl were added. The lower phase was transferred to 4ml screw
cap vial using a pasteur pipette. This was volume was evaporate to dryness under N2
using N-evap in fume hood and subsequently suspended in 100 µL methanol or
derivatized as described above.
A.4 Results
A.4.1 Nitro-oleic acid identification in positive mode is more efficient due to chemical
derivatization.
We developed methods for detection and quantitation of nitro-oleic and other
nitro-fatty acids using both negative and positive analysis modes using HPLC
electrospray ionization tandem high resolution mass spectroscopy. Fragmentation of
nitro-oleic acid resulted in ions representing loss of NO2 (45.99), parent nitro-oleic acid
(326.23), and others (Fig. A.1). For positive mode analysis, fatty acids were extracted
from plasma and subsequently chemically derivatized to methylpyridinium derivatives.
Fragmentation of AMMP-nitro-oleic acid resulted in a TOF product ion scan illustrating
ions representing AMMP-nitro-oleic minus loss of NO2 (386.31), parent AMMP-nitro-oleic
acid (433.31), and others (Fig. A.2). The use of derivatization and positive ion mode
resulted in approximately a 500 fold enhancement of sensitivity compared to negative
mode analysis.
A.4.2 Confirmation of analytical methods using mice exogenously administered nitro-
oleic acid.
To test our analytical methodologies in an in vivo system, mice were injected with
2 nanomoles/gram mouse nitro-oleic acid and were sacrificed 10 minutes after injection.
Blood plasma was collected at this early time point due to nitro-fatty acids’ propensity to

111

adduct to nucleophilic proteins and endogenous glutathione. Nitro-oleic acid was
identified both in negative and positive mode (A.4, 5). We were able to detect increases
in nitro-oleic acid in mouse plasma following intra peritoneal administration of a single
dose (Fig. A.6).
A.4.3 Comparison of two fatty acid extraction procedures
To identify possible alternative extraction procedures that may be more efficient
than the acetonitrile extraction commonly used, a secondary extraction procedure was
attempted. Use of the acidified chloroform extraction resulted in approximately a 4 fold
increase in observable nitro-oleic acid from mouse plasma (Fig. A.7). It is unknown
however if the chloroform extraction is more efficient, or produces additional artifact
nitro-oleic acid due to the acidified nature of the procedure.
A.5 Discussion
Unsaturated fatty acids and notably certain polyunsaturated fatty acids exhibit
beneficial effects in clinical settings and experimental models of cardiovascular and
metabolic disease, in part through mechanisms that involve attenuation of oxidative
stress and inflammation. It is widely hypothesized that these effects involve enzymatic
or non-enzymatic conversion of unsaturated fatty acids to biologically active metabolites.
Inconsistencies and/or inter individual variation in formation of these active metabolites
may account for variable observations that have plagued this field. Accordingly,
definitive identification and quantitation of bioactive fatty acid derivatives is essential for
both evaluating the beneficial effects of these nutrients and identifying biological markers
to monitor the therapeutic efficacy of fatty acid administration. Nitro-fatty acids are a
class of fatty acid metabolites that are formed by chemical nitration of the double bonds
of unsaturated fatty acids. Several laboratories have shown that nitro-derivatives of
some unsaturated fatty acids can decrease inflammation by down regulation of pro-
inflammatory mediators such as NFκB and by activating the antioxidant master controller
Nrf2. In mouse models, exogenously supplied nitro-fatty acids decrease systemic
oxidative stress and inflammation suggesting that these could be biologically relevant
mediators. However, the role of endogenously generated nitro-fatty acids as protective
mediators of the actions of dietary unsaturated fatty acids is less clear, in large part due
to inherent limitations of currently used analytical approaches for the detection and
quantitation of free and esterified nitro-fatty acids. To address these issues we have

112

developed sensitive, quantitative, and specific methods for analysis of nitro-fatty acids
using chemical derivatization and high resolution (HR) tandem mass spectrometry. With
these methods in hand we are now in a position to investigate nitro-fatty acid metabolism
in vivo and evaluate the relationship of nitro-fatty acid formation, vascular inflammation,
and toxicant modulation.
The capability to identify and quantitate these and other bioactive lipid species
opens up many possible future directions. We have begun to profile levels of nitro-fatty
acids in humans and hope to identify previously un-discovered metabolites including
nitro-DHA and nitro-EPA fatty acids. PUFAs are known to form multiple anti-
inflammatroy bioactive metabolites such as E and D-series resolvins, and the formation
of nitro-EPA or nitro-DHA may also be beneficial127. It will also be interesting to gain a
better understanding of the endogenous control mechanisms of nitro-fatty acid
formation. One possible mechanism could be the upregulation eNOS or related NOS
enzymes.
Endothelial NOS activation is known to increase cellular nitric oxide levels and is
integral to proper cardiovascular function. Normally inhibited by the caveolae associated
protein Caveolin-1 (Cav-1), eNOS activation can lead to improved blood pressure and
decreased atherosclerotic risk. Endothelial nitric oxide synthase generates nitric oxide
which is a key player in vasodilation, thrombosis and cell growth, and decreased
activation of eNOS can contribute to hypertension and atherosclerosis 227. Normally
inhibited within caveolae by Cav-1, eNOS can be activated by multiple signaling
cascades and molecules such as PI3 kinase, calcium, HDL and estrogen227. Activation
of eNOS leads to a conversion of L-arginine to L-citrulline which results in the formation
of diffusible nitric oxide. If nitric oxide interacts with cellular reactive oxygen species,
then nitro-fatty acids are likely to be formed144b. Activation of eNOS leads to a greater
abundance of nitric oxide and may increase the probability that unsaturated fatty acids
become nitrated. Not surprisingly, mice lacking inhibitory Cav-1 exhibit increased eNOS
activation, higher levels of nitric oxide, and protection from inflammation and
atherosclerosis. Endothelial nitric oxide synthase can be activated during inflammatory
responses which may lead to higher levels of anti-inflammatory nitro-fatty acids. A
biological system may utilize nitro-fatty acid formation as a mechanism to keep harmful
inflammation in-check. It would be interesting to examine the levels of nitro-fatty
acids before and after exposure to environmental pollutants or other stressors,

113

and also determine if upregulation of eNOS or related enzymes prior to the
exposure would be protective. Interestingly, multiple lifestyle modifications such
as exercise228
or nutritional modulation have been shown to alter eNOS signaling
which may be prime candidates to increase the levels of nitrated fatty acid
species.

114

Figure A.1. HR-LC/MS/MS analysis of nitro-oleic acid. A. Extracted ion chromatogram
showing the ability to detect nitro-oleic acid by infusing standards. B. Fragmentation
pattern of 9 nitro-oleic acid. C. TOF Product ion spectra of nitro-oleic acid. Stars
delineate observed ions corresponding to identified fragment ions.

115

Figure A.2. HR-LC/MS/MS analysis of AMMP-derivatized- 9 nitro-oleic acid. A.
Extracted ion chromatogram showing the ability to quantitate AMMP-nitro-oleic acid. B.
Fragmentation pattern of AMMP-9 nitro-oleic acid. C. TOF Product ion spectra of
AMMP-nitro-oleic acid. Stars delineate observed ions corresponding to identified
fragment ions.

116

y = 2329.3x
R² = 1
1.00E+00
1.00E+01
1.00E+02
1.00E+03
1.00E+04
1.00E+05
1.00E+06
1 10 100
Area(Log)
pmoles (Log)
y = 20853x
R² = 0.9997
1.00E+00
1.00E+01
1.00E+02
1.00E+03
1.00E+04
1.00E+05
1.00E+06
1.00E+07
1 10 100
Area(Log)
pmoles (Log)
y = 33970x
R² = 1
1
10
100
1000
10000
100000
1000000
1 10
Area(Log)
pmoles (Log)
A
B
C
Figure A.3. Quantitation of nitro-oleate using high resolution methodologies. A.
Concentration curve for nitro-oleate standard. B. Concentration curve for AMMP-
nitro-oleate. C. Concentration curve for AMMP-C17 fatty acid internal standard.

117

Figure A.4:.Methodologies confirmed using mice exogenously injected with nitro-
oleate (negative mode) A: HR-LC/MS/MS analysis of nitro-oleic acid in negative
ionization mode from plasma obtained from mice injected for 10 minutes post
administration of 10-Nitro-oleate. No nitro-oleate was observed in vehicle treated
mice.

118

Figure A.5. Methodologies confirmed using mice exogenously injected with nitro-
oleate (positive mode) HR-LC/MS/MS analysis of AMMP-10-nitro-oleic acid in
positive ionization mode from plasma from mice injected for 10 minutes with 10-Nitro-
Oleate. AMMP-10-nitro-oleic acid was observed in both control and exogenously
administered mice, but to a higher degree in mice injected for 10 minutes with nitro-
oleate.

119

Figure A.6. Concentration of nitro-oleate in mice exogenously administered nitro-oleate.
Mice were I.P. injected with 2 nano mole per gram of mouse and sacrificed 10 minutes
post injection. Plasma concentrations were determined using AMMP-derivatization
technique and positive mode high resolution analysis.
0
0.002
0.004
0.006
0.008
0.01
0.012
0.014
0.016
2 nanomol per gram
mouse nitro-oleate
injection
control
Nitro-oleate/InternalStandard
(femtoMolar)
p=0.06

120

Figure A.7. Comparison of nitro-fatty acid extraction procedures. A. Standard curve of
AMMP-nitro oleic acid used for quantitation. B. Two extraction procedures were
compared (see materials and methods) and the acidic chloroform extraction resulted in
~4 fold increase in observable nitro oleic acid in plasma.
y = 12693x
R² = 0.9414
0.00E+00
5.00E+05
1.00E+06
1.50E+06
2.00E+06
2.50E+06
3.00E+06
3.50E+06
4.00E+06
0 50 100 150 200 250 300 350
Area
pmoles
0.00
0.50
1.00
1.50
2.00
2.50
Acetonitrile Extraction Acidic Chloroform
Extraction
Nitro-Oleate(picomoles)
A
B

121

Appendix B. Lab protocols
1. mRNA related protocols:
Trizol Harvest
 Warm up Trizol reagent in water bath for about 20-30 minutes prior to harvest
 For 6 well plates (in vitro experiments)
o Wash each well once with 1 mL cold PBS and aspirate
o Add 600 µL Trizol to each well and scrape with reusable cell scraper
o For each well, pipet up and down 7 times to homogenize liquid and
transfer to new autoclaved 1.7 mL Eppendorf tube.
o Place in -80 freezer overnight.
 For mouse tissues (e.g., liver and hearts)
o Harvest tissues and place in RNA Later solution (enough solution to cover
tissue)
o Place in 4 degree fridge for short term (few days) or -20 freezer for longer
o In 2 mL colored tubes (round bottomed) add 1 mL Trizol reagent, 50-100
mg tissue of interest, and 2 autoclaved homogenizer balls (ball bearings).
o Use the Cassis lab’s homogenizer per their instructions for your tissue of
interest.
o Remove ball bearings with “super magnet” and freeze tubes at -80
overnight.
mRNA isolation:
 For 6 well plates (in vitro experiments)
o Let tubes thaw at room temperature in hood.
o Add 120 µL Chloroform to each tube and calmly shake for 15 seconds.
Incubate at room temperature for 5 minutes
o Centrifuge tubes at 12,000 X g for 15 minutes at 4 degrees. Upon
completion you should see distinct phase separation.
o Using a p200 pipet, carefully collect the clear phase without disrupting
the cloudy or red phases (I pipet 150 µL twice in to a new tube).
o Add 300 µL of isopropyl alcohol to each tube and invert each tube just
twice to mix.
o Centrifuge at 12,000 x g for 10 minutes at 4 degrees. Hopefully you can
see a pellet.
o Remove the supernatant by decanting and then place each tube inverted
on kim wipe to remove excess isopropyl alcohol
o Wash the pellet with 600 µL of 75% ethanol solution (made up with
rnase/dnase free water). Vortex briefly.
o Centrifuge at 7,500 x g at 4 degrees for only 5 minutes.
o Decant the ethanol and then place each tube inverted on Kim wipe to
remove excess. Cap tubes and do a quick spin to collect all remaining

122

liquid. Using small pipet, carefully remove all remaining liquid without
sucking up pellet. Dry pellet for 5 minutes.
o Add 12 µL of dnase/rnase free water and pipet up and down 3 times to
dissolve pellet.
o Quantify RNA concentration using the nanodrop down the hall.
 For mouse tissues
o Let tubes thaw at room temperature in hood.
o To remove tissues, centrifuge at 12,000 x g for 10 minutes at 4 degrees.
Pipet supernatant to new tube.
o Add 200 µL Chloroform to each tube and calmly shake for 15 seconds.
Incubate at room temperature for 5 minutes
o Centrifuge tubes at 12,000 X g for 15 minutes at 4 degrees. Upon
completion you should see distinct phase separation.
o Using a p200 pipet, carefully collect the clear phase without disrupting
the cloudy or red phases (I pipet 210 µL multiple times in to a new tube).
o Add 500 µL of isopropyl alcohol to each tube and invert each tube just
twice to mix.
o Centrifuge at 12,000 x g for 10 minutes at 4 degrees. Hopefully you can
see a pellet.
o Remove the supernatant by decanting and then place each tube inverted
on kim wipe to remove excess isopropyl alcohol
o Wash the pellet with 1 mL of 75% ethanol solution (made up with
rnase/dnase free water). Vortex briefly.
o Centrifuge at 7,500 x g at 4 degrees for only 5 minutes.
o Decant the ethanol and then place each tube inverted on Kim wipe to
remove excess. Cap tubes and do a quick spin to collect all remaining
liquid. Using small pipet, carefully remove all remaining liquid without
sucking up pellet. Dry pellet for 5 minutes.
o Add 50-250 µL of dnase/rnase free water depending on the size of pellet
and pipet up and down 3 times to dissolve pellet. If not sure always be
conservative and then check via Spec. Can always dilute more in front of
the nanodrop.
o Quantify RNA concentration using the nanodrop down the hall.
Reverse Transcription protocol: AMV reverse transcription system (Promega)
 Make 1-2 µg cDNA per sample depending on your spec values.
o Use “Spec spreadsheet” to determine how much mRNA and water is
needed to have 2 ug in 9.9 µL total volume. Spin down using small
table top centrifuge.
o Place PCR tubes in thermo cycler and run “LEI/HEAT” program (~10
minutes).
o Make Master Mix for all samples in 1.7 mL Eppendorf. If you have 20
samples, make the mix for 22 or 23 samples. See below. All values
are micro liters

123

x40
MgCl2 4 160
RT 10x buffer 2 80
dNTP 2 80
RNAsin 0.5 20
Random Primers 1 40
AMV
RT 0.6 24
Total 10.1 404
o Add 10.1 µL of Master Mix to each tube containing mRNA and spin
with small centrifuge.
o Place tubes in thermo cycler and run “LEI/RT” (~90 minutes).
o When finished, dilute 1:10 with dnase/rnase water.
Real Time PCR
*Every plate contains 96 wells. You must always run a control such as Actin or GAPDH
on EVERY plate. Run every sample with duplicates or triplicates.
Set up plate as shown in template.
 Add 2 µl of cDNA per well.
 Make a master mix for each gene of interest (e.g., actin gets one tube and
AhR gets a second Eppendorf).
o If you have 48 rxns. Make master mix for 51 or 52:
 10 µl of Cyber Green reagent
 5.6 µl of dnase/rnase free water
 1.2 µl Forward primer of interest
 1.2 µl Reverse primer of interest
o Seal tightly with plastic plate sealer and centrifuge for 5 minutes (800
rpm).
2. Isolation of mouse lung endothelial cells
DAY 1:
Lung tissue isolation:
 Use lung tissue from 2-3 mice per isolation

124

 Record the weight, #, genotype, and punch of each mouse
 Anaesthetize mice using Isoflurane and euthanize by cervical dislocation
 Sterilize skin with 70% ethanol and remove underlying tissues (the heart should be
beating)
 Locate and cut the right atrium flap at the base of the heart
 Insert an 18 gauge needle (connected to a 50ml syringe filled with PBS) into the left
ventricle and perfuse SLOWLY with (5ml of pre-warmed heparinized PBS with
heparin to prevent clotting (3ml heparin/500ml PBS; prepared on same day)
 If perfusion is done properly:
o Perfused fluid should flow out of the right atrium
o Liver color will change from dark red to light brown
o Fast perfusion may cause damage to blood vessels and endothelial cells
 Isolate lungs using forceps and immerse into pre-chilled 0.1% BSA/DMEM (High
glucose) solution until ready for the next step (up to 6 hrs)
Homogenization:
 Mince tissue (using a blade) into 1.1-2mm pieces and place in a 50ml conical tube
filled with pre-warmed culture media (prepared on the same day) containing
o DMEM (45ml)
o 1% fatty acid free BSA (5ml of 10% stock solution)
o Type II Collagenase- 2.0mg/ml (100mg)
o Dispase II- 4mg/ml (200mg)
 Cap tubes tightly and wrap with parafilm; shake horizontally at 37°C for exactly 1hr
at 225rpm
 Filter the homogenized tissue through a stainless mesh into a pre-labeled 50ml
conical tube
 Centrifuge the filtered tissue at 37°C for 8min at 1000rpm
 Discard the supernatant using suction and resuspend the pellet in 1ml of lung
endothelial cell growth media (LECM) containing the following:
o DMEM (387ml)
o 20% FBS (100ml)
o 100ug/ml heparin (3ml)
o P/S antibiotics (10ml)
 Aliquot LECM into pre-labeled 50ml conical tubes and store in the 4°C refrigerator
 Thaw and add 1ml of Endothelial Cell Growth Supplement (ECGS stored in -80
freezer) to each 50ml aliquot to prepare complete LECM prior to use (on the same
day and up to 1wk)

125

Plating cells (P0):
 Coat 35mm plates (preferably in 6 well plates) with 0.5% gelatin (prepared fresh and
stored in 15ml aliquots in the 4°C refrigerator) and incubate under UV light for 1hr
(on the same day)
 Label the plate clearly with the date, generation (P0) and genotype for each well
 Add 1ml of complete LECM to each well and pre-warm in the 37°C incubator
 Resuspend each pellet in 1ml of complete LECM and transfer to the corresponding
well in the 6-well plate (final volume of 2ml LECM/well)
 Swirl gently to spread cells homogenously and incubate at 37°C, 5% CO2 overnight
DAY 2:
Washing cells:
 Wash P0 plates 5 times with pre-warmed PBS to eliminate cellular debris
DAY 3:
Preparing antibody coated bead mix for bead selection:
 Amounts of beads and antibody are scaled to one 35mm plate
 Add 25ul of M450 sheep anti-rat IgG beads in a 1.5ml eppendorf tube
 Wash the beads:
o Add 1ml of PBS to the tube, and gently invert the tube 3 times to suspend the
beads
o Place the tube in the Dynacare magnet, gently invert the tube 3 times
o After beads adhere to the wall of the tube, aspirate PBS using suction
o Repeat the steps described above 3 times
 Resuspend the beads with 1ml PBS, add 2.5ul of rat anti-mouse ICAM-2 or CD31
PECAM antibody
 Cap the tube tightly and incubate for 1hr/overnight on the nutator under UV light
 Pull the ICAM-2 antibody bound beads using the magnet and wash 3 times with 1ml
LECM
 Resuspend the ICAM-2 antibody bound beads in 1ml of LECM and incubate at 37°
until P0 plates are ready for bead selection
First bead purification of endothelial cells (P1):
 Wash P0 endothelial cells (in 35mm plates/wells) 3 times with pre-warmed PBS
 Aspirate PBS and add 1ml of LECM
 Add 1 ml of the antibody-bound beads suspended in LECM
 Incubate the plates at 37°C, 5% CO2 for 1hr, and gently shake every 15min
 Wash plates with 2-3 times with PBS, add 1ml trypsin/35mm plate, and incubate at
37°C, 5% CO2 for 5min or until cells are afloat
 When cells are dissociated, add 0.5ml of LECM to stop trypsin reaction

126

 Transfer the contents of each 35mm plate to a pre-labeled 1.5ml eppendorf tubes
and apply to the Dynal magnetic separator
 Wash bead-bound endothelial cells 4-5 times with DMEM/0.1% FBS
 Resuspend cells in ECGM and count the cells using the hemacytometer (described
below)
 Seed 2.0-4.0x105 cells in a final volume of 1ml ECGM/35mm plate
 Shake gently to mix and incubate at 37°C, 5% CO2 overnight
 Label plates with date, phenotype, Passage number (P1)
 Change LECM every 2-3 days
3. Silencing protocol
 Label 3, 15mL Falcon tubes
o Cav-1, Ctl, Gene Silencer
Tube X10
siRNA diluent 24 240
1 optimem 15 150
ctl siRNA 1 10
2 cav‐1 (2) 0.5 5
cav‐1 (5) 0.5 5
X20
3 Gene Silencer 5 100
Optimem 25 500
 Add dilluent, Optimem, and appropriate siRNA to tubes 1 & 2
o Mix by flicking tube ~15 times
 Add Gene silencer and Optimem to tube 3
o Mix by hand gently by slightly inverting tube.
 INCUBATE ALL 3 TUBES FOR 5 MINUTES
 Take half of volume in Gene Silencer tube (tube 3) and pipet directly into tube 1.
Other half to tube 2.
o Mix tube 1 & 2 gently by hand by slightly inverting tube
 INCUBATE FOR 20 MINUTES
o After 10 minutes prepare cells for transfection by washing twice with
Optimem.
 1 mL for 6 well plate & 0.5 mL for 12 well plate
 After 15 minutes, dilute tubes 1 & 2 with Optimem up to total volume necessary
for amount of wells (Use graduations on Falcon Tube).
o For Example : 10mls total in each tube for 1, 6 well plate and 8 wells of a
single 12 well plate

127

 Add 1 mL per well in 6 well plate, and 0.5 mL per well in 12 well.
o DROP BY DROP using large serological pipet
 After 4 hours add 20% FBS M199 without antibiotics
 Incubate for 48 hours before continuing with experiments.
4. Acidic chloroform lipid extraction
 Need 8 ml borosilicate glass tubes with Teflon cap
 Add 2ml ice cold MeOH and add 1ml CHCl3
 Add 450 µL 0.1M HCl to tube
 Add 50 µL of plasma to each sample
 Add 50 µL of 1 µM internal standard to each tube
 Vortex for 5 minutes (works best if you have a multi tube vortexer)
 Place on ice or at 4 degrees for at least 1 hour
 Add 1 ml CHCl3 and 1.3 ml 0.1M HCl to separate phases
 Vortex for 5 minutes
 Centrifuge at >3,000 x g for 10 minutes
 Transfer lower phase to 4ml screw cap vial using a pasteur pipette. Take care to
avoid the protein interface and upper phase. Leave behind ~50 microliters if
needed (don’t worry about being more accurate than this- we have an internal
standard to correct for recovery)
 Evaporate to dryness under N2 using N-evap in fume hood
 Resuspend in 100 µL methanol
 Transfer to autosampler vial with glass or polypropylene insert for LC MS
analysis

128

References
1. Martin-Timon, I.; Sevillano-Collantes, C.; Segura-Galindo, A.; Del Canizo-
Gomez, F. J., Type 2 diabetes and cardiovascular disease: Have all risk factors the
same strength? World journal of diabetes 2014, 5 (4), 444-70.
2. Pober, J. S.; Sessa, W. C., Evolving functions of endothelial cells in
inflammation. Nature reviews. Immunology 2007, 7 (10), 803-15.
3. Libby, P., Inflammation in atherosclerosis. Arteriosclerosis, thrombosis, and
vascular biology 2012, 32 (9), 2045-51.
4. Bobryshev, Y. V., Monocyte recruitment and foam cell formation in
atherosclerosis. Micron 2006, 37 (3), 208-22.
5. Sumpio, B. E.; Riley, J. T.; Dardik, A., Cells in focus: endothelial cell. The
international journal of biochemistry & cell biology 2002, 34 (12), 1508-12.
6. Brown, A. A.; Hu, F. B., Dietary modulation of endothelial function: implications
for cardiovascular disease. Am J Clin Nutr 2001, 73 (4), 673-86.
7. Hennig, B.; Meerarani, P.; Ramadass, P.; Watkins, B. A.; Toborek, M., Fatty
acid-mediated activation of vascular endothelial cells. Metabolism: clinical and
experimental 2000, 49 (8), 1006-13.
8. Ramsden, C. E.; Ringel, A.; Feldstein, A. E.; Taha, A. Y.; MacIntosh, B. A.;
Hibbeln, J. R.; Majchrzak-Hong, S. F.; Faurot, K. R.; Rapoport, S. I.; Cheon, Y.; Chung,
Y. M.; Berk, M.; Mann, J. D., Lowering dietary linoleic acid reduces bioactive oxidized
linoleic acid metabolites in humans. Prostaglandins, leukotrienes, and essential fatty
acids 2012, 87 (4-5), 135-41.
9. Tachibana, H.; Koga, K.; Fujimura, Y.; Yamada, K., A receptor for green tea
polyphenol EGCG. Nature structural & molecular biology 2004, 11 (4), 380-1.
10. Gallo, M. V.; Schell, L. M.; DeCaprio, A. P.; Jacobs, A., Levels of persistent
organic pollutant and their predictors among young adults. Chemosphere 2011, 83 (10),
1374-82.
11. Baker, N. A.; Karounos, M.; English, V.; Fang, J.; Wei, Y.; Stromberg, A.;
Sunkara, M.; Morris, A. J.; Swanson, H. I.; Cassis, L. A., Coplanar polychlorinated
biphenyls impair glucose homeostasis in lean C57BL/6 mice and mitigate beneficial
effects of weight loss on glucose homeostasis in obese mice. Environmental health
perspectives 2013, 121 (1), 105-10.
12. (a) Han, S. G.; Eum, S. Y.; Toborek, M.; Smart, E.; Hennig, B., Polychlorinated
biphenyl-induced VCAM-1 expression is attenuated in aortic endothelial cells isolated
from caveolin-1 deficient mice. Toxicology and applied pharmacology 2010, 246 (1-2),
74-82; (b) Lim, E. J.; Majkova, Z.; Xu, S.; Bachas, L.; Arzuaga, X.; Smart, E.; Tseng, M.
T.; Toborek, M.; Hennig, B., Coplanar polychlorinated biphenyl-induced CYP1A1 is
regulated through caveolae signaling in vascular endothelial cells. Chem Biol Interact
2008, 176 (2-3), 71-8; (c) Lim, E. J.; Smart, E. J.; Toborek, M.; Hennig, B., The role of
caveolin-1 in PCB77-induced eNOS phosphorylation in human-derived endothelial cells.
American journal of physiology. Heart and circulatory physiology 2007, 293 (6), H3340-
7.
13. (a) Petriello, M. C.; Newsome, B. J.; Dziubla, T. D.; Hilt, J. Z.; Bhattacharyya, D.;
Hennig, B., Modulation of persistent organic pollutant toxicity through nutritional
intervention: emerging opportunities in biomedicine and environmental remediation. The
Science of the total environment 2014, 491-492, 11-6; (b) Petriello, M. C.; Newsome, B.;

129
Hennig, B., Influence of nutrition in PCB-induced vascular inflammation. Environmental
science and pollution research international 2014, 21 (10), 6410-8.
14. Arsenescu, V.; Arsenescu, R. I.; King, V.; Swanson, H.; Cassis, L. A.,
Polychlorinated biphenyl-77 induces adipocyte differentiation and proinflammatory
adipokines and promotes obesity and atherosclerosis. Environmental health
perspectives 2008, 116 (6), 761-8.
15. Lundqvist, C.; Zuurbier, M.; Leijs, M.; Johansson, C.; Ceccatelli, S.; Saunders,
M.; Schoeters, G.; ten Tusscher, G.; Koppe, J. G., The effects of PCBs and dioxins on
child health. Acta paediatrica (Oslo, Norway : 1992). Supplement 2006, 95 (453), 55-64.
16. Crinnion, W. J., Polychlorinated biphenyls: persistent pollutants with
immunological, neurological, and endocrinological consequences. Alternative medicine
review : a journal of clinical therapeutic 2011, 16 (1), 5-13.
17. Kim, M. J.; Marchand, P.; Henegar, C.; Antignac, J. P.; Alili, R.; Poitou, C.;
Bouillot, J. L.; Basdevant, A.; Le Bizec, B.; Barouki, R.; Clement, K., Fate and complex
pathogenic effects of dioxins and polychlorinated biphenyls in obese subjects before and
after drastic weight loss. Environmental health perspectives 2011, 119 (3), 377-83.
18. Giesy, J. P.; Kannan, K.; Blankenship, A. L.; Jones, P. D.; Hilscherova, K.,
Dioxin-like and non-dioxin-like toxic effects of polychlorinated biphenyls (PCBs):
implications for risk assessment. Central European journal of public health 2000, 8
Suppl, 43-5.
19. Schulze, P. C.; Lee, R. T., Oxidative stress and atherosclerosis. Current
atherosclerosis reports 2005, 7 (3), 242-8.
20. (a) Schlezinger, J. J.; Struntz, W. D.; Goldstone, J. V.; Stegeman, J. J.,
Uncoupling of cytochrome P450 1A and stimulation of reactive oxygen species
production by co-planar polychlorinated biphenyl congeners. Aquatic toxicology 2006, 77
(4), 422-32; (b) Schlezinger, J. J.; White, R. D.; Stegeman, J. J., Oxidative inactivation of
cytochrome P-450 1A (CYP1A) stimulated by 3,3',4,4'-tetrachlorobiphenyl: production of
reactive oxygen by vertebrate CYP1As. Mol Pharmacol 1999, 56 (3), 588-97.
21. Libby, P., Inflammation in atherosclerosis. Nature 2002, 420 (6917), 868-74.
22. Hennig, B.; Meerarani, P.; Slim, R.; Toborek, M.; Daugherty, A.; Silverstone, A.
E.; Robertson, L. W., Proinflammatory properties of coplanar PCBs: in vitro and in vivo
evidence. Toxicology and applied pharmacology 2002, 181 (3), 174-83.
23. (a) Eske, K.; Newsome, B.; Han, S. G.; Murphy, M.; Bhattacharyya, D.; Hennig,
B., PCB 77 dechlorination products modulate pro-inflammatory events in vascular
endothelial cells. Environmental science and pollution research international 2014, 21
(10), 6354-64; (b) Majkova, Z.; Smart, E.; Toborek, M.; Hennig, B., Up-regulation of
endothelial monocyte chemoattractant protein-1 by coplanar PCB77 is caveolin-1-
dependent. Toxicol Appl Pharmacol 2009, 237 (1), 1-7.
24. (a) Uemura, H., [Associations of exposure to dioxins and polychlorinated
biphenyls with diabetes: based on epidemiological findings]. Nihon eiseigaku zasshi.
Japanese journal of hygiene 2012, 67 (3), 363-74; (b) Carpenter, D., Exposure to
Polychlorinated Biphenyls Is Associated With an Increased Risk of Hypertension and
Cardiovascular Disease. Epidemiology 2011, 22 (1), S147-S147; (c) Goncharov, A.;
Haase, R. F.; Santiago-Rivera, A.; Morse, G.; McCaffrey, R. J.; Rej, R.; Carpenter, D.
O., High serum PCBs are associated with elevation of serum lipids and cardiovascular
disease in a Native American population. Environmental research 2008, 106 (2), 226-39.
25. (a) Schettgen, T.; Gube, M.; Esser, A.; Alt, A.; Kraus, T., Plasma polychlorinated
biphenyls (PCB) levels of workers in a transformer recycling company, their family
members, and employees of surrounding companies. Journal of toxicology and
environmental health. Part A 2012, 75 (8-10), 414-22; (b) Gustavsson, P.; Hogstedt, C.,

130

A cohort study of Swedish capacitor manufacturing workers exposed to polychlorinated
biphenyls (PCBs). American journal of industrial medicine 1997, 32 (3), 234-9.
26. Butler Walker, J.; Seddon, L.; McMullen, E.; Houseman, J.; Tofflemire, K.;
Corriveau, A.; Weber, J. P.; Mills, C.; Smith, S.; Van Oostdam, J., Organochlorine levels
in maternal and umbilical cord blood plasma in Arctic Canada. The Science of the total
environment 2003, 302 (1-3), 27-52.
27. Hopf, N. B.; Ruder, A. M.; Succop, P., Background levels of polychlorinated
biphenyls in the U.S. population. The Science of the total environment 2009, 407 (24),
6109-19.
28. Ha, M. H.; Lee, D. H.; Jacobs, D. R., Association between serum concentrations
of persistent organic pollutants and self-reported cardiovascular disease prevalence:
results from the National Health and Nutrition Examination Survey, 1999-2002.
Environmental health perspectives 2007, 115 (8), 1204-9.
29. Labarthe, D. R.; Briss, P. A., Urinary sodium excretion and cardiovascular
disease mortality. JAMA : the journal of the American Medical Association 2011, 306
(10), 1084-5; author reply 1086-7.
30. Organization, W. H., Global status report on noncommunicable diseases 2010.
WHO 2011.
31. Wild, S.; Roglic, G.; Green, A.; Sicree, R.; King, H., Global prevalence of
diabetes: estimates for the year 2000 and projections for 2030. Diabetes care 2004, 27
(5), 1047-53.
32. Tang, M.; Chen, K.; Yang, F.; Liu, W., Exposure to organochlorine pollutants and
type 2 diabetes: a systematic review and meta-analysis. PloS one 2014, 9 (10), e85556.
33. Fox, C. S.; Coady, S.; Sorlie, P. D.; D'Agostino, R. B., Sr.; Pencina, M. J.; Vasan,
R. S.; Meigs, J. B.; Levy, D.; Savage, P. J., Increasing cardiovascular disease burden
due to diabetes mellitus: the Framingham Heart Study. Circulation 2007, 115 (12), 1544-
50.
34. Fox, C. S.; Coady, S.; Sorlie, P. D.; Levy, D.; Meigs, J. B.; D'Agostino, R. B., Sr.;
Wilson, P. W.; Savage, P. J., Trends in cardiovascular complications of diabetes. JAMA :
the journal of the American Medical Association 2004, 292 (20), 2495-9.
35. European Association for Cardiovascular, P.; Rehabilitation; Reiner, Z.;
Catapano, A. L.; De Backer, G.; Graham, I.; Taskinen, M. R.; Wiklund, O.; Agewall, S.;
Alegria, E.; Chapman, M. J.; Durrington, P.; Erdine, S.; Halcox, J.; Hobbs, R.; Kjekshus,
J.; Filardi, P. P.; Riccardi, G.; Storey, R. F.; Wood, D.; Guidelines, E. S. C. C. f. P.;
Committees, ESC/EAS Guidelines for the management of dyslipidaemias: the Task
Force for the management of dyslipidaemias of the European Society of Cardiology
(ESC) and the European Atherosclerosis Society (EAS). European heart journal 2011,
32 (14), 1769-818.
36. (a) Airaksinen, R.; Rantakokko, P.; Eriksson, J. G.; Blomstedt, P.; Kajantie, E.;
Kiviranta, H., Association between type 2 diabetes and exposure to persistent organic
pollutants. Diabetes care 2011, 34 (9), 1972-9; (b) Codru, N.; Schymura, M. J.; Negoita,
S.; Rej, R.; Carpenter, D. O., Diabetes in relation to serum levels of polychlorinated
biphenyls and chlorinated pesticides in adult Native Americans. Environmental health
perspectives 2007, 115 (10), 1442-7; (c) Everett, C. J.; Frithsen, I. L.; Diaz, V. A.;
Koopman, R. J.; Simpson, W. M., Jr.; Mainous, A. G., 3rd, Association of a
polychlorinated dibenzo-p-dioxin, a polychlorinated biphenyl, and DDT with diabetes in
the 1999-2002 National Health and Nutrition Examination Survey. Environmental
research 2007, 103 (3), 413-8; (d) Gasull, M.; Pumarega, J.; Tellez-Plaza, M.; Castell,
C.; Tresserras, R.; Lee, D. H.; Porta, M., Blood concentrations of persistent organic
pollutants and prediabetes and diabetes in the general population of Catalonia.
Environmental science & technology 2012, 46 (14), 7799-810; (e) Grandjean, P.;

131
Henriksen, J. E.; Choi, A. L.; Petersen, M. S.; Dalgard, C.; Nielsen, F.; Weihe, P., Marine
food pollutants as a risk factor for hypoinsulinemia and type 2 diabetes. Epidemiology
2011, 22 (3), 410-7; (f) Silverstone, A. E.; Rosenbaum, P. F.; Weinstock, R. S.; Bartell,
S. M.; Foushee, H. R.; Shelton, C.; Pavuk, M., Polychlorinated biphenyl (PCB) exposure
and diabetes: results from the Anniston Community Health Survey. Environ Health
Perspect 2012, 120 (5), 727-32; (g) Vasiliu, O.; Cameron, L.; Gardiner, J.; Deguire, P.;
Karmaus, W., Polybrominated biphenyls, polychlorinated biphenyls, body weight, and
incidence of adult-onset diabetes mellitus. Epidemiology 2006, 17 (4), 352-9.
37. Arrebola, J. P.; Gonzalez-Jimenez, A.; Fornieles-Gonzalez, C.; Artacho-Cordon,
F.; Olea, N.; Escobar-Jimenez, F.; Fernandez-Soto, M. L., Relationship between serum
concentrations of persistent organic pollutants and markers of insulin resistance in a
cohort of women with a history of gestational diabetes mellitus. Environmental research
2015, 136, 435-40.
38. American Diabetes, A., Gestational diabetes mellitus. Diabetes care 2004, 27
Suppl 1, S88-90.
39. Lee, D. H.; Steffes, M. W.; Sjodin, A.; Jones, R. S.; Needham, L. L.; Jacobs, D.
R., Jr., Low dose organochlorine pesticides and polychlorinated biphenyls predict
obesity, dyslipidemia, and insulin resistance among people free of diabetes. PloS one
2011, 6 (1), e15977.
40. Jensen, T. K.; Timmermann, A. G.; Rossing, L. I.; Ried-Larsen, M.; Grontved, A.;
Andersen, L. B.; Dalgaard, C.; Hansen, O. H.; Scheike, T.; Nielsen, F.; Grandjean, P.,
Polychlorinated biphenyl exposure and glucose metabolism in 9-year-old danish
children. The Journal of clinical endocrinology and metabolism 2014, 99 (12), E2643-51.
41. (a) Jorgensen, M. E.; Borch-Johnsen, K.; Bjerregaard, P., A cross-sectional study
of the association between persistent organic pollutants and glucose intolerance among
Greenland Inuit. Diabetologia 2008, 51 (8), 1416-22; (b) Persky, V.; Piorkowski, J.;
Turyk, M.; Freels, S.; Chatterton, R., Jr.; Dimos, J.; Bradlow, H. L.; Chary, L. K.; Burse,
V.; Unterman, T.; Sepkovic, D.; McCann, K., Associations of polychlorinated biphenyl
exposure and endogenous hormones with diabetes in post-menopausal women
previously employed at a capacitor manufacturing plant. Environmental research 2011,
111 (6), 817-24; (c) Persky, V.; Piorkowski, J.; Turyk, M.; Freels, S.; Chatterton, R., Jr.;
Dimos, J.; Bradlow, H. L.; Chary, L. K.; Burse, V.; Unterman, T.; Sepkovic, D. W.;
McCann, K., Polychlorinated biphenyl exposure, diabetes and endogenous hormones: a
cross-sectional study in men previously employed at a capacitor manufacturing plant.
Environmental health : a global access science source 2012, 11, 57.
42. Lee, D. H.; Lee, I. K.; Porta, M.; Steffes, M.; Jacobs, D. R., Jr., Relationship
between serum concentrations of persistent organic pollutants and the prevalence of
metabolic syndrome among non-diabetic adults: results from the National Health and
Nutrition Examination Survey 1999-2002. Diabetologia 2007, 50 (9), 1841-51.
43. (a) Lim, J. E.; Jee, S. H., Association between serum levels of adiponectin and
polychlorinated biphenyls in Korean men and women. Endocrine 2014; (b) Mullerova, D.;
Kopecky, J.; Matejkova, D.; Muller, L.; Rosmus, J.; Racek, J.; Sefrna, F.; Opatrna, S.;
Kuda, O.; Matejovic, M., Negative association between plasma levels of adiponectin and
polychlorinated biphenyl 153 in obese women under non-energy-restrictive regime.
International journal of obesity 2008, 32 (12), 1875-8.
44. Mullerova, D.; Kopecky, J., White adipose tissue: storage and effector site for
environmental pollutants. Physiological research / Academia Scientiarum
Bohemoslovaca 2007, 56 (4), 375-81.
45. Luzardo, O. P.; Henriquez-Hernandez, L. A.; Valeron, P. F.; Lara, P. C.; Almeida-
Gonzalez, M.; Losada, A.; Zumbado, M.; Serra-Majem, L.; Alvarez-Leon, E. E.; Boada,

132

L. D., The relationship between dioxin-like polychlorobiphenyls and IGF-I serum levels in
healthy adults: evidence from a cross-sectional study. PloS one 2012, 7 (5), e38213.
46. Organization, W. H., A global brief on hypertension: Silent killer, global public
health crisis. WHO 2013.
47. (a) Peters, J. L.; Fabian, M. P.; Levy, J. I., Combined impact of lead, cadmium,
polychlorinated biphenyls and non-chemical risk factors on blood pressure in NHANES.
Environmental research 2014, 132, 93-9; (b) Yorita Christensen, K. L.; White, P., A
methodological approach to assessing the health impact of environmental chemical
mixtures: PCBs and hypertension in the National Health and Nutrition Examination
Survey. International journal of environmental research and public health 2011, 8 (11),
4220-37.
48. Ha, M. H.; Lee, D. H.; Son, H. K.; Park, S. K.; Jacobs, D. R., Jr., Association
between serum concentrations of persistent organic pollutants and prevalence of newly
diagnosed hypertension: results from the National Health and Nutrition Examination
Survey 1999-2002. Journal of human hypertension 2009, 23 (4), 274-86.
49. Goncharov, A.; Bloom, M.; Pavuk, M.; Birman, I.; Carpenter, D. O., Blood
pressure and hypertension in relation to levels of serum polychlorinated biphenyls in
residents of Anniston, Alabama. J Hypertens 2010, 28 (10), 2053-60.
50. Goncharov, A.; Pavuk, M.; Foushee, H. R.; Carpenter, D. O.; Anniston
Environmental Health Reseach, C., Blood pressure in relation to concentrations of PCB
congeners and chlorinated pesticides. Environmental health perspectives 2011, 119 (3),
319-25.
51. Uemura, H.; Arisawa, K.; Hiyoshi, M.; Kitayama, A.; Takami, H.; Sawachika, F.;
Dakeshita, S.; Nii, K.; Satoh, H.; Sumiyoshi, Y.; Morinaga, K.; Kodama, K.; Suzuki, T.;
Nagai, M.; Suzuki, T., Prevalence of metabolic syndrome associated with body burden
levels of dioxin and related compounds among Japan's general population.
Environmental health perspectives 2009, 117 (4), 568-73.
52. Huang, X.; Lessner, L.; Carpenter, D. O., Exposure to persistent organic
pollutants and hypertensive disease. Environmental research 2006, 102 (1), 101-6.
53. (a) Akagi, K.; Okumura, M., Association of blood pressure and PCB level in
yusho patients. Environmental health perspectives 1985, 59, 37-9; (b) Stehr-Green, P.
A.; Ross, D.; Liddle, J.; Welty, E.; Steele, G., A pilot study of serum polychlorinated
biphenyl levels in persons at high risk of exposure in residential and occupational
environments. Archives of environmental health 1986, 41 (4), 240-4.
54. (a) Kenchaiah, S.; Evans, J. C.; Levy, D.; Wilson, P. W.; Benjamin, E. J.; Larson,
M. G.; Kannel, W. B.; Vasan, R. S., Obesity and the risk of heart failure. The New
England journal of medicine 2002, 347 (5), 305-13; (b) Poirier, P.; Giles, T. D.; Bray, G.
A.; Hong, Y.; Stern, J. S.; Pi-Sunyer, F. X.; Eckel, R. H.; American Heart, A.; Obesity
Committee of the Council on Nutrition, P. A.; Metabolism, Obesity and cardiovascular
disease: pathophysiology, evaluation, and effect of weight loss: an update of the 1997
American Heart Association Scientific Statement on Obesity and Heart Disease from the
Obesity Committee of the Council on Nutrition, Physical Activity, and Metabolism.
Circulation 2006, 113 (6), 898-918; (c) Van Gaal, L. F.; Mertens, I. L.; De Block, C. E.,
Mechanisms linking obesity with cardiovascular disease. Nature 2006, 444 (7121), 875-
80.
55. (a) Ferrante, M. C.; Amero, P.; Santoro, A.; Monnolo, A.; Simeoli, R.; Di Guida,
F.; Mattace Raso, G.; Meli, R., Polychlorinated biphenyls (PCB 101, PCB 153 and PCB
180) alter leptin signaling and lipid metabolism in differentiated 3T3-L1 adipocytes.
Toxicology and applied pharmacology 2014, 279 (3), 401-8; (b) Kim, M. J.; Pelloux, V.;
Guyot, E.; Tordjman, J.; Bui, L. C.; Chevallier, A.; Forest, C.; Benelli, C.; Clement, K.;
Barouki, R., Inflammatory pathway genes belong to major targets of persistent organic

133

pollutants in adipose cells. Environmental health perspectives 2012, 120 (4), 508-14; (c)
Myre, M.; Imbeault, P., Persistent organic pollutants meet adipose tissue hypoxia: does
cross-talk contribute to inflammation during obesity? Obesity reviews : an official journal
of the International Association for the Study of Obesity 2014, 15 (1), 19-28.
56. (a) Donat-Vargas, C.; Gea, A.; Sayon-Orea, C.; Carlos, S.; Martinez-Gonzalez,
M. A.; Bes-Rastrollo, M., Association between dietary intakes of PCBs and the risk of
obesity: the SUN project. J Epidemiol Commun H 2014, 68 (9), 834-841; (b) Gladen, B.
C.; Ragan, N. B.; Rogan, W. J., Pubertal growth and development and prenatal and
lactational exposure to polychlorinated biphenyls and dichlorodiphenyl dichloroethene.
The Journal of pediatrics 2000, 136 (4), 490-6; (c) Lee, D. H.; Lind, L.; Jacobs, D. R., Jr.;
Salihovic, S.; van Bavel, B.; Lind, P. M., Associations of persistent organic pollutants
with abdominal obesity in the elderly: The Prospective Investigation of the Vasculature in
Uppsala Seniors (PIVUS) study. Environment international 2012, 40, 170-8; (d) Verhulst,
S. L.; Nelen, V.; Hond, E. D.; Koppen, G.; Beunckens, C.; Vael, C.; Schoeters, G.;
Desager, K., Intrauterine exposure to environmental pollutants and body mass index
during the first 3 years of life. Environmental health perspectives 2009, 117 (1), 122-6.
57. (a) Lignell, S.; Aune, M.; Darnerud, P. O.; Hanberg, A.; Larsson, S. C.; Glynn, A.,
Prenatal exposure to polychlorinated biphenyls (PCBs) and polybrominated diphenyl
ethers (PBDEs) may influence birth weight among infants in a Swedish cohort with
background exposure: a cross-sectional study. Environ Health-Glob 2013, 12; (b) Valvi,
D.; Mendez, M. A.; Martinez, D.; Grimalt, J. O.; Torrent, M.; Sunyer, J.; Vrijheid, M.,
Prenatal Concentrations of Polychlorinated Biphenyls, DDE, and DDT and Overweight in
Children: A Prospective Birth Cohort Study. Environmental health perspectives 2012,
120 (3), 451-457.
58. Glynn, A. W.; Granath, F.; Aune, M.; Atuma, S.; Darnerud, P. O.; Bjerselius, R.;
Vainio, H.; Weiderpass, E., Organochlorines in Swedish women: Determinants of serum
concentrations. Environmental health perspectives 2003, 111 (3), 349-355.
59. (a) Ben Hassine, S.; Hammami, B.; Ben Ameur, W.; El Megdiche, Y.; Barhoumi,
B.; El Abidi, R.; Driss, M. R., Concentrations of organochlorine pesticides and
polychlorinated biphenyls in human serum and their relation with age, gender, and BMI
for the general population of Bizerte, Tunisia. Environmental science and pollution
research international 2014, 21 (10), 6303-13; (b) Karmaus, W.; Osuch, J. R.; Eneli, I.;
Mudd, L. M.; Zhang, J.; Mikucki, D.; Haan, P.; Davis, S., Maternal levels of
dichlorodiphenyl-dichloroethylene (DDE) may increase weight and body mass index in
adult female offspring. Occupational and environmental medicine 2009, 66 (3), 143-9.
60. (a) Blanck, H. M.; Marcus, M.; Rubin, C.; Tolbert, P. E.; Hertzberg, V. S.;
Henderson, A. K.; Zhang, R. H., Growth in girls exposed in utero and postnatally to
polybrominated biphenyls and polychlorinated biphenyls. Epidemiology 2002, 13 (2),
205-10; (b) Dirinck, E. L.; Dirtu, A. C.; Govindan, M.; Covaci, A.; Van Gaal, L. F.; Jorens,
P. G., Exposure to persistent organic pollutants: relationship with abnormal glucose
metabolism and visceral adiposity. Diabetes care 2014, 37 (7), 1951-8; (c) Dirinck, E.;
Jorens, P. G.; Covaci, A.; Geens, T.; Roosens, L.; Neels, H.; Mertens, I.; Van Gaal, L.,
Obesity and Persistent Organic Pollutants: Possible Obesogenic Effect of
Organochlorine Pesticides and Polychlorinated Biphenyls. Obesity 2011, 19 (4), 709-
714; (d) Wu, K. S.; Xu, X. J.; Liu, J. X.; Guo, Y. Y.; Huo, X., In utero exposure to
polychlorinated biphenyls and reduced neonatal physiological development from Guiyu,
China. Ecotoxicology and environmental safety 2011, 74 (8), 2141-2147.
61. (a) Imbeault, P.; Chevrier, J.; Dewailly, E.; Ayotte, P.; Despres, J. P.; Tremblay,
A.; Mauriege, P., Increase in plasma pollutant levels in response to weight loss in
humans is related to in vitro subcutaneous adipocyte basal lipolysis. International journal
of obesity and related metabolic disorders : journal of the International Association for

134
the Study of Obesity 2001, 25 (11), 1585-91; (b) Yu, G. W.; Laseter, J.; Mylander, C.,
Persistent organic pollutants in serum and several different fat compartments in humans.
Journal of environmental and public health 2011, 2011, 417980.
62. (a) Baillie-Hamilton, P. F., Chemical toxins: a hypothesis to explain the global
obesity epidemic. Journal of alternative and complementary medicine 2002, 8 (2), 185-
92; (b) Grun, F.; Blumberg, B., Environmental obesogens: organotins and endocrine
disruption via nuclear receptor signaling. Endocrinology 2006, 147 (6 Suppl), S50-5.
63. (a) Huffman, M. D.; Lloyd-Jones, D. M.; Ning, H.; Labarthe, D. R.; Guzman
Castillo, M.; O'Flaherty, M.; Ford, E. S.; Capewell, S., Quantifying options for reducing
coronary heart disease mortality by 2020. Circulation 2013, 127 (25), 2477-84; (b)
Martin, S. S.; Blaha, M. J.; Blankstein, R.; Agatston, A.; Rivera, J. J.; Virani, S. S.;
Ouyang, P.; Jones, S. R.; Blumenthal, R. S.; Budoff, M. J.; Nasir, K., Dyslipidemia,
coronary artery calcium, and incident atherosclerotic cardiovascular disease:
implications for statin therapy from the multi-ethnic study of atherosclerosis. Circulation
2014, 129 (1), 77-86; (c) Riche, D. M.; McClendon, K. S., Role of statins for the primary
prevention of cardiovascular disease in patients with type 2 diabetes mellitus. American
journal of health-system pharmacy : AJHP : official journal of the American Society of
Health-System Pharmacists 2007, 64 (15), 1603-10.
64. Tenenbaum, A.; Klempfner, R.; Fisman, E. Z., Hypertriglyceridemia: a too long
unfairly neglected major cardiovascular risk factor. Cardiovasc Diabetol 2014, 13 (1),
159.
65. (a) Bell, F. P.; Iverson, F.; Arnold, D.; Vidmar, T. J., Long-term effects of Aroclor
1254 (PCBs) on plasma lipid and carnitine concentrations in rhesus monkey. Toxicology
1994, 89 (2), 139-53; (b) Nagaoka, S.; Miyazaki, H.; Aoyama, Y.; Yoshida, A., Effects of
dietary polychlorinated biphenyls on cholesterol catabolism in rats. The British journal of
nutrition 1990, 64 (1), 161-9; (c) Nagaoka, S.; Kato, M.; Aoyama, Y.; Yoshida, A.,
Comparative studies on the hypercholesterolaemia induced by excess dietary tyrosine or
polychlorinated biphenyls in rats. The British journal of nutrition 1986, 56 (2), 509-17.
66. (a) Baker, E. L., Jr.; Landrigan, P. J.; Glueck, C. J.; Zack, M. M., Jr.; Liddle, J. A.;
Burse, V. W.; Housworth, W. J.; Needham, L. L., Metabolic consequences of exposure
to polychlorinated biphenyls (PCB) in sewage sludge. Am J Epidemiol 1980, 112 (4),
553-63; (b) Chase, K. H.; Wong, O.; Thomas, D.; Berney, B. W.; Simon, R. K., Clinical
and metabolic abnormalities associated with occupational exposure to polychlorinated
biphenyls (PCBs). Journal of occupational medicine. : official publication of the Industrial
Medical Association 1982, 24 (2), 109-14; (c) Smith, A. B.; Schloemer, J.; Lowry, L. K.;
Smallwood, A. W.; Ligo, R. N.; Tanaka, S.; Stringer, W.; Jones, M.; Hervin, R.; Glueck,
C. J., Metabolic and health consequences of occupational exposure to polychlorinated
biphenyls. British journal of industrial medicine 1982, 39 (4), 361-9; (d) Stehrgreen, P.
A.; Welty, E.; Steele, G.; Steinberg, K., Evaluation of Potential Health-Effects Associated
with Serum Polychlorinated Biphenyl Levels. Environmental health perspectives 1986,
70, 255-259.
67. (a) Aminov, Z.; Haase, R. F.; Pavuk, M.; Carpenter, D. O.; Anniston
Environmental Health Research, C., Analysis of the effects of exposure to
polychlorinated biphenyls and chlorinated pesticides on serum lipid levels in residents of
Anniston, Alabama. Environmental health : a global access science source 2013, 12,
108; (b) Penell, J.; Lind, L.; Salihovic, S.; van Bavel, B.; Lind, P. M., Persistent organic
pollutants are related to the change in circulating lipid levels during a 5 year follow-up.
Environmental research 2014, 134, 190-7.
68. Tokunaga, S.; Kataoka, K., [A longitudinal analysis on the association of serum
lipids and lipoproteins concentrations with blood polychlorinated biphenyls level in

135

chronic "Yusho" patients]. Fukuoka igaku zasshi = Hukuoka acta medica 2003, 94 (5),
110-7.
69. Linsel-Nitschke, P.; Tall, A. R., HDL as a target in the treatment of atherosclerotic
cardiovascular disease. Nature reviews. Drug discovery 2005, 4 (3), 193-205.
70. Beischlag, T. V.; Luis Morales, J.; Hollingshead, B. D.; Perdew, G. H., The aryl
hydrocarbon receptor complex and the control of gene expression. Critical reviews in
eukaryotic gene expression 2008, 18 (3), 207-50.
71. Cox, M. B.; Miller, C. A., 3rd, Cooperation of heat shock protein 90 and p23 in
aryl hydrocarbon receptor signaling. Cell stress & chaperones 2004, 9 (1), 4-20.
72. Korashy, H. M.; El-Kadi, A. O., The role of aryl hydrocarbon receptor in the
pathogenesis of cardiovascular diseases. Drug metabolism reviews 2006, 38 (3), 411-
50.
73. (a) Xiao, L.; Zhang, Z.; Luo, X., Roles of xenobiotic receptors in vascular
pathophysiology. Circ J 2014, 78 (7), 1520-30; (b) Han, S. G.; Han, S. S.; Toborek, M.;
Hennig, B., EGCG protects endothelial cells against PCB 126-induced inflammation
through inhibition of AhR and induction of Nrf2-regulated genes. Toxicology and applied
pharmacology 2012, 261 (2), 181-8.
74. Guengerich, F. P., Cytochrome p450 and chemical toxicology. Chemical
research in toxicology 2008, 21 (1), 70-83.
75. (a) Ceriello, A.; Motz, E., Is oxidative stress the pathogenic mechanism
underlying insulin resistance, diabetes, and cardiovascular disease? The common soil
hypothesis revisited. Arteriosclerosis, thrombosis, and vascular biology 2004, 24 (5),
816-23; (b) Marseglia, L.; Manti, S.; D'Angelo, G.; Nicotera, A.; Parisi, E.; Di Rosa, G.;
Gitto, E.; Arrigo, T., Oxidative Stress in Obesity: A Critical Component in Human
Diseases. International journal of molecular sciences 2014, 16 (1), 378-400; (c) Ward, N.
C.; Croft, K. D., Hypertension and oxidative stress. Clinical and experimental
pharmacology & physiology 2006, 33 (9), 872-6.
76. Dhalla, N. S.; Temsah, R. M.; Netticadan, T., Role of oxidative stress in
cardiovascular diseases. J Hypertens 2000, 18 (6), 655-73.
77. Cai, H.; Harrison, D. G., Endothelial dysfunction in cardiovascular diseases: the
role of oxidant stress. Circulation research 2000, 87 (10), 840-4.
78. Heitzer, T.; Schlinzig, T.; Krohn, K.; Meinertz, T.; Munzel, T., Endothelial
dysfunction, oxidative stress, and risk of cardiovascular events in patients with coronary
artery disease. Circulation 2001, 104 (22), 2673-8.
79. Wu, F.; Zheng, Y.; Gao, J.; Chen, S.; Wang, Z., Induction of oxidative stress and
the transcription of genes related to apoptosis in rare minnow (Gobiocypris rarus) larvae
with Aroclor 1254 exposure. Ecotoxicology and environmental safety 2014, 110, 254-60.
80. Baker, R. G.; Hayden, M. S.; Ghosh, S., NF-kappaB, inflammation, and
metabolic disease. Cell metabolism 2011, 13 (1), 11-22.
81. (a) Collins, T.; Cybulsky, M. I., NF-kappaB: pivotal mediator or innocent
bystander in atherogenesis? J Clin Invest 2001, 107 (3), 255-64; (b) Mangge, H.;
Becker, K.; Fuchs, D.; Gostner, J. M., Antioxidants, inflammation and cardiovascular
disease. World journal of cardiology 2014, 6 (6), 462-77.
82. (a) Baird, L.; Dinkova-Kostova, A. T., The cytoprotective role of the Keap1-Nrf2
pathway. Archives of toxicology 2011, 85 (4), 241-72; (b) Kansanen, E.; Jyrkkanen, H.
K.; Levonen, A. L., Activation of stress signaling pathways by electrophilic oxidized and
nitrated lipids. Free radical biology & medicine 2012, 52 (6), 973-82.
83. (a) Kopf, P. G.; Huwe, J. K.; Walker, M. K., Hypertension, cardiac hypertrophy,
and impaired vascular relaxation induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin are
associated with increased superoxide. Cardiovascular toxicology 2008, 8 (4), 181-93; (b)
Kopf, P. G.; Scott, J. A.; Agbor, L. N.; Boberg, J. R.; Elased, K. M.; Huwe, J. K.; Walker,

136

M. K., Cytochrome P4501A1 is required for vascular dysfunction and hypertension
induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicological sciences : an official
journal of the Society of Toxicology 2010, 117 (2), 537-46.
84. (a) Zhang, N., The role of endogenous aryl hydrocarbon receptor signaling in
cardiovascular physiology. Journal of cardiovascular disease research 2011, 2 (2), 91-5;
(b) Nguyen, L. P.; Bradfield, C. A., The search for endogenous activators of the aryl
hydrocarbon receptor. Chemical research in toxicology 2008, 21 (1), 102-16.
85. Huang, S.; Shui, X.; He, Y.; Xue, Y.; Li, J.; Li, G.; Lei, W.; Chen, C., AhR
expression and polymorphisms are associated with risk of coronary arterial disease in
Chinese population. Scientific reports 2015, 5, 8022.
86. (a) Pascussi, J. M.; Gerbal-Chaloin, S.; Duret, C.; Daujat-Chavanieu, M.;
Vilarem, M. J.; Maurel, P., The tangle of nuclear receptors that controls xenobiotic
metabolism and transport: crosstalk and consequences. Annu Rev Pharmacol Toxicol
2008, 48, 1-32; (b) Wakabayashi, N.; Slocum, S. L.; Skoko, J. J.; Shin, S.; Kensler, T.
W., When NRF2 talks, who's listening? Antioxidants & redox signaling 2010, 13 (11),
1649-63.
87. (a) Tian, Y., Ah receptor and NF-kappaB interplay on the stage of epigenome.
Biochemical pharmacology 2009, 77 (4), 670-80; (b) Zordoky, B. N.; El-Kadi, A. O., Role
of NF-kappaB in the regulation of cytochrome P450 enzymes. Current drug metabolism
2009, 10 (2), 164-78.
88. Frank, P. G.; Woodman, S. E.; Park, D. S.; Lisanti, M. P., Caveolin, caveolae,
and endothelial cell function. Arteriosclerosis, thrombosis, and vascular biology 2003, 23
(7), 1161-8.
89. Smart, E. J.; Graf, G. A.; McNiven, M. A.; Sessa, W. C.; Engelman, J. A.;
Scherer, P. E.; Okamoto, T.; Lisanti, M. P., Caveolins, liquid-ordered domains, and
signal transduction. Molecular and cellular biology 1999, 19 (11), 7289-304.
90. Sowa, G., Caveolae, caveolins, cavins, and endothelial cell function: new
insights. Frontiers in physiology 2012, 2, 120.
91. Trigatti, B. L.; Anderson, R. G.; Gerber, G. E., Identification of caveolin-1 as a
fatty acid binding protein. Biochemical and biophysical research communications 1999,
255 (1), 34-9.
92. Panneerselvam, M.; Patel, H. H.; Roth, D. M., Caveolins and heart diseases.
Advances in experimental medicine and biology 2012, 729, 145-56.
93. Pavlides, S.; Gutierrez-Pajares, J. L.; Danilo, C.; Lisanti, M. P.; Frank, P. G.,
Atherosclerosis, caveolae and caveolin-1. Advances in experimental medicine and
biology 2012, 729, 127-44.
94. Frank, P. G.; Lee, H.; Park, D. S.; Tandon, N. N.; Scherer, P. E.; Lisanti, M. P.,
Genetic ablation of caveolin-1 confers protection against atherosclerosis.
Arteriosclerosis, thrombosis, and vascular biology 2004, 24 (1), 98-105.
95. Fernandez-Hernando, C.; Yu, J.; Davalos, A.; Prendergast, J.; Sessa, W. C.,
Endothelial-specific overexpression of caveolin-1 accelerates atherosclerosis in
apolipoprotein E-deficient mice. The American journal of pathology 2010, 177 (2), 998-
1003.
96. Frank, P. G., Endothelial caveolae and caveolin-1 as key regulators of
atherosclerosis. The American journal of pathology 2010, 177 (2), 544-6.
97. Majkova, Z.; Toborek, M.; Hennig, B., The role of caveolae in endothelial cell
dysfunction with a focus on nutrition and environmental toxicants. J Cell Mol Med 2010,
14 (10), 2359-70.
98. Petriello, M. C.; Han, S. G.; Newsome, B. J.; Hennig, B., PCB 126 toxicity is
modulated by cross-talk between caveolae and Nrf2 signaling. Toxicology and applied
pharmacology 2014, 277 (2), 192-9.

137

99. (a) Niture, S. K.; Khatri, R.; Jaiswal, A. K., Regulation of Nrf2-an update. Free
radical biology & medicine 2014, 66, 36-44; (b) Niture, S. K.; Jain, A. K.; Jaiswal, A. K.,
Antioxidant-induced modification of INrf2 cysteine 151 and PKC-delta-mediated
phosphorylation of Nrf2 serine 40 are both required for stabilization and nuclear
translocation of Nrf2 and increased drug resistance. Journal of cell science 2009, 122
(Pt 24), 4452-64.
100. Kim, J.; Cha, Y. N.; Surh, Y. J., A protective role of nuclear factor-erythroid 2-
related factor-2 (Nrf2) in inflammatory disorders. Mutation research 2010, 690 (1-2), 12-
23.
101. Turpaev, K. T., Keap1-Nrf2 signaling pathway: mechanisms of regulation and
role in protection of cells against toxicity caused by xenobiotics and electrophiles.
Biochemistry. Biokhimiia 2013, 78 (2), 111-26.
102. Singh, S.; Vrishni, S.; Singh, B. K.; Rahman, I.; Kakkar, P., Nrf2-ARE stress
response mechanism: a control point in oxidative stress-mediated dysfunctions and
chronic inflammatory diseases. Free Radic Res 44 (11), 1267-88.
103. Kim, J.; Cha, Y. N.; Surh, Y. J., A protective role of nuclear factor-erythroid 2-
related factor-2 (Nrf2) in inflammatory disorders. Mutat Res 690 (1-2), 12-23.
104. Howden, R., Nrf2 and cardiovascular defense. Oxidative medicine and cellular
longevity 2013, 2013, 104308.
105. Takabe, W.; Warabi, E.; Noguchi, N., Anti-atherogenic effect of laminar shear
stress via Nrf2 activation. Antioxidants & redox signaling 2011, 15 (5), 1415-26.
106. Hosoya, T.; Maruyama, A.; Kang, M. I.; Kawatani, Y.; Shibata, T.; Uchida, K.;
Warabi, E.; Noguchi, N.; Itoh, K.; Yamamoto, M., Differential responses of the Nrf2-
Keap1 system to laminar and oscillatory shear stresses in endothelial cells. The Journal
of biological chemistry 2005, 280 (29), 27244-50.
107. Lu, H.; Cui, W.; Klaassen, C. D., Nrf2 protects against 2,3,7,8-
tetrachlorodibenzo-p-dioxin (TCDD)-induced oxidative injury and steatohepatitis.
Toxicology and applied pharmacology 2011, 256 (2), 122-35.
108. (a) Ganguly, R.; Pierce, G. N., Trans fat involvement in cardiovascular disease.
Molecular nutrition & food research 2012, 56 (7), 1090-6; (b) Baum, S. J.; Kris-Etherton,
P. M.; Willett, W. C.; Lichtenstein, A. H.; Rudel, L. L.; Maki, K. C.; Whelan, J.; Ramsden,
C. E.; Block, R. C., Fatty acids in cardiovascular health and disease: a comprehensive
update. Journal of clinical lipidology 2012, 6 (3), 216-34; (c) Kuipers, R. S.; de Graaf, D.
J.; Luxwolda, M. F.; Muskiet, M. H.; Dijck-Brouwer, D. A.; Muskiet, F. A., Saturated fat,
carbohydrates and cardiovascular disease. The Netherlands journal of medicine 2011,
69 (9), 372-8.
109. Hennig, B.; Slim, R.; Toborek, M.; Robertson, L. W., Linoleic acid amplifies
polychlorinated biphenyl-mediated dysfunction of endothelial cells. Journal of
biochemical and molecular toxicology 1999, 13 (2), 83-91.
110. Wu, J.; Liu, J.; Waalkes, M. P.; Cheng, M. L.; Li, L.; Li, C. X.; Yang, Q., High
dietary fat exacerbates arsenic-induced liver fibrosis in mice. Experimental biology and
medicine (Maywood, N.J.) 2008, 233 (3), 377-84.
111. Harris, D. L.; Niaz, M. S.; Morrow, J. D.; Mary, K.; Ramesh, A., Diet as a Modifier
of Benzo (a) pyrene Metabolism and Benzo (a) pyrene—Induced Colon Tumors in
ApcMin mice. Interdisciplinary Studies on Environmental Chemistry—Environmental
Research in Asia 2009, 2, 227-238.
112. Hennig, B.; Reiterer, G.; Toborek, M.; Matveev, S. V.; Daugherty, A.; Smart, E.;
Robertson, L. W., Dietary fat interacts with PCBs to induce changes in lipid metabolism
in mice deficient in low-density lipoprotein receptor. Environmental health perspectives
2005, 113 (1), 83-7.

138

113. NCI, Table 2. Food sources of the total omega 6 fatty acids ( 18:2 + 20:4), listed
in descending order by percentages of their contribution to intake, based on data from
the national health and nutrition examination survey 2005–2006. NIH 2013.
114. (a) Fresno, M.; Alvarez, R.; Cuesta, N., Toll-like receptors, inflammation,
metabolism and obesity. Archives of physiology and biochemistry 2011, 117 (3), 151-64;
(b) Nebert, D. W.; Karp, C. L., Endogenous functions of the aryl hydrocarbon receptor
(AHR): intersection of cytochrome P450 1 (CYP1)-metabolized eicosanoids and AHR
biology. The Journal of biological chemistry 2008, 283 (52), 36061-5; (c) Tompkins, L.
M.; Wallace, A. D., Mechanisms of cytochrome P450 induction. Journal of biochemical
and molecular toxicology 2007, 21 (4), 176-81.
115. (a) Slim, R.; Toborek, M.; Robertson, L. W.; Hennig, B., Antioxidant protection
against PCB-mediated endothelial cell activation. Toxicological sciences : an official
journal of the Society of Toxicology 1999, 52 (2), 232-9; (b) Watkins, B. A.; Hannon, K.;
Ferruzzi, M.; Li, Y., Dietary PUFA and flavonoids as deterrents for environmental
pollutants. The Journal of nutritional biochemistry 2007, 18 (3), 196-205.
116. (a) Majkova, Z.; Layne, J.; Sunkara, M.; Morris, A. J.; Toborek, M.; Hennig, B.,
Omega-3 fatty acid oxidation products prevent vascular endothelial cell activation by
coplanar polychlorinated biphenyls. Toxicol Appl Pharmacol 2011, 251 (1), 41-9; (b)
Zheng, Y.; Morris, A.; Sunkara, M.; Layne, J.; Toborek, M.; Hennig, B., Epigallocatechin-
gallate stimulates NF-E2-related factor and heme oxygenase-1 via caveolin-1
displacement. The Journal of nutritional biochemistry 2012, 23 (2), 163-8.
117. Terao, J., Dietary flavonoids as antioxidants. Forum of nutrition 2009, 61, 87-94.
118. Morita, K.; Matsueda, T.; Iida, T., Effect of green tea (matcha) on gastrointestinal
tract absorption of polychlorinated biphenyls, polychlorinated dibenzofurans and
polychlorinated dibenzo-p-dioxins in rats. Fukuoka igaku zasshi = Hukuoka acta medica
1997, 88 (5), 162-8.
119. Ciftci, O.; Ozdemir, I., Protective effects of quercetin and chrysin against 2,3,7,8-
tetrachlorodibenzo-p-dioxin (TCDD) induced oxidative stress, body wasting and altered
cytokine productions in rats. Immunopharmacology and immunotoxicology 2011, 33 (3),
504-8.
120. Zheng, Y.; Toborek, M.; Hennig, B., Epigallocatechin gallate-mediated protection
against tumor necrosis factor-alpha-induced monocyte chemoattractant protein-1
expression is heme oxygenase-1 dependent. Metabolism: clinical and experimental
2010, 59 (10), 1528-35.
121. Tutel'yan, V. A.; Gapparov, M. M.; Telegin, L. Y.; Devichenskii, V. M.; Pevnitskii,
L. A., Flavonoids and resveratrol as regulators of Ah-receptor activity: protection from
dioxin toxicity. Bulletin of experimental biology and medicine 2003, 136 (6), 533-9.
122. Wu, J. M.; Wang, Z. R.; Hsieh, T. C.; Bruder, J. L.; Zou, J. G.; Huang, Y. Z.,
Mechanism of cardioprotection by resveratrol, a phenolic antioxidant present in red wine
(Review). International journal of molecular medicine 2001, 8 (1), 3-17.
123. (a) Baur, J. A.; Sinclair, D. A., Therapeutic potential of resveratrol: the in vivo
evidence. Nature reviews. Drug discovery 2006, 5 (6), 493-506; (b) Higgins, L. G.;
Hayes, J. D., Mechanisms of induction of cytosolic and microsomal glutathione
transferase (GST) genes by xenobiotics and pro-inflammatory agents. Drug metabolism
reviews 2011, 43 (2), 92-137; (c) Kang, H. J.; Hong, Y. B.; Kim, H. J.; Wang, A.; Bae, I.,
Bioactive food components prevent carcinogenic stress via Nrf2 activation in BRCA1
deficient breast epithelial cells. Toxicology letters 2012, 209 (2), 154-60; (d) Nadtochiy,
S. M.; Redman, E. K., Mediterranean diet and cardioprotection: the role of nitrite,
polyunsaturated fatty acids, and polyphenols. Nutrition (Burbank, Los Angeles County,
Calif.) 2011, 27 (7-8), 733-44; (e) Zakkar, M.; Van der Heiden, K.; Luong le, A.;
Chaudhury, H.; Cuhlmann, S.; Hamdulay, S. S.; Krams, R.; Edirisinghe, I.; Rahman, I.;

139
Carlsen, H.; Haskard, D. O.; Mason, J. C.; Evans, P. C., Activation of Nrf2 in endothelial
cells protects arteries from exhibiting a proinflammatory state. Arteriosclerosis,
thrombosis, and vascular biology 2009, 29 (11), 1851-7.
124. (a) Turkez, H.; Geyikoglu, F.; Yousef, M. I., Ameliorative effect of
docosahexaenoic acid on 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced histological
changes, oxidative stress, and DNA damage in rat liver. Toxicology and industrial health
2012, 28 (8), 687-96; (b) Mozaffarian, D.; Wu, J. H., Omega-3 fatty acids and
cardiovascular disease: effects on risk factors, molecular pathways, and clinical events.
Journal of the American College of Cardiology 2011, 58 (20), 2047-67.
125. (a) Watkins, B. A.; Li, Y.; Seifert, M. F., Dietary ratio of n-6/n-3 PUFAs and
docosahexaenoic acid: actions on bone mineral and serum biomarkers in
ovariectomized rats. The Journal of nutritional biochemistry 2006, 17 (4), 282-9; (b)
Gomez Candela, C.; Bermejo Lopez, L. M.; Loria Kohen, V., Importance of a balanced
omega 6/omega 3 ratio for the maintenance of health: nutritional recommendations.
Nutricion hospitalaria : organo oficial de la Sociedad Espanola de Nutricion Parenteral y
Enteral 2011, 26 (2), 323-9.
126. Wang, L.; Reiterer, G.; Toborek, M.; Hennig, B., Changing ratios of omega-6 to
omega-3 fatty acids can differentially modulate polychlorinated biphenyl toxicity in
endothelial cells. Chemico-biological interactions 2008, 172 (1), 27-38.
127. Eske, K. Coplanar PCB-induced inflammation and dietary interventions.
University of Kentucky, UKnowledge, 2013.
128. (a) Choi, Y. J.; Arzuaga, X.; Kluemper, C. T.; Caraballo, A.; Toborek, M.; Hennig,
B., Quercetin blocks caveolae-dependent pro-inflammatory responses induced by co-
planar PCBs. Environment international 2010, 36 (8), 931-4; (b) Ciftci, O.; Aydin, M.;
Ozdemir, I.; Vardi, N., Quercetin prevents 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced
testicular damage in rats. Andrologia 2012, 44 (3), 164-73; (c) Sciullo, E. M.; Vogel, C.
F.; Wu, D.; Murakami, A.; Ohigashi, H.; Matsumura, F., Effects of selected food
phytochemicals in reducing the toxic actions of TCDD and p,p'-DDT in U937
macrophages. Archives of toxicology 2010, 84 (12), 957-66.
129. (a) Morita, K.; Matsueda, T.; Iida, T., [Effect of green tea (matcha) on
gastrointestinal tract absorption of polychlorinated biphenyls, polychlorinated
dibenzofurans and polychlorinated dibenzo-p-dioxins in rats]. Fukuoka igaku zasshi =
Hukuoka acta medica 1997, 88 (5), 162-8; (b) Newsome, B. J.; Petriello, M. C.; Han, S.
G.; Murphy, M. O.; Eske, K. E.; Sunkara, M.; Morris, A. J.; Hennig, B., Green tea diet
decreases PCB 126-induced oxidative stress in mice by up-regulating antioxidant
enzymes. The Journal of nutritional biochemistry 2014, 25 (2), 126-35.
130. (a) Kim, J.; Koo, S. I.; Noh, S. K., Green tea extract markedly lowers the
lymphatic absorption and increases the biliary secretion of 14C-benzo[a]pyrene in rats.
The Journal of nutritional biochemistry 2012, 23 (8), 1007-11; (b) Koo, S. I.; Noh, S. K.,
Green tea as inhibitor of the intestinal absorption of lipids: potential mechanism for its
lipid-lowering effect. The Journal of nutritional biochemistry 2007, 18 (3), 179-83.
131. Yaktine, A. L.; Harrison, G. G.; Lawrence, R. S., Reducing exposure to dioxins
and related compounds through foods in the next generation. Nutrition reviews 2006, 64
(9), 403-9.
132. (a) Aozasa, O.; Ohta, S.; Nakao, T.; Miyata, H.; Nomura, T., Enhancement in
fecal excretion of dioxin isomer in mice by several dietary fibers. Chemosphere 2001, 45
(2), 195-200; (b) De Vos, S.; De Schrijver, R., Polychlorinated biphenyl distribution and
faecal excretion in rats fed wheat bran. Chemosphere 2005, 61 (3), 374-82; (c) Sera, N.;
Morita, K.; Nagasoe, M.; Tokieda, H.; Kitaura, T.; Tokiwa, H., Binding effect of
polychlorinated compounds and environmental carcinogens on rice bran fiber. The
Journal of nutritional biochemistry 2005, 16 (1), 50-8.

140

133. (a) Arguin, H.; Sanchez, M.; Bray, G. A.; Lovejoy, J. C.; Peters, J. C.; Jandacek,
R. J.; Chaput, J. P.; Tremblay, A., Impact of adopting a vegan diet or an olestra
supplementation on plasma organochlorine concentrations: results from two pilot
studies. The British journal of nutrition 2010, 103 (10), 1433-41; (b) Geusau, A.;
Tschachler, E.; Meixner, M.; Sandermann, S.; Papke, O.; Wolf, C.; Valic, E.; Stingl, G.;
McLachlan, M., Olestra increases faecal excretion of 2,3,7,8-tetrachlorodibenzo-p-dioxin.
Lancet 1999, 354 (9186), 1266-7; (c) Geusau, A.; Schmaldienst, S.; Derfler, K.; Papke,
O.; Abraham, K., Severe 2,3,7,8-tetrachlorodibenzo- p-dioxin (TCDD) intoxication:
kinetics and trials to enhance elimination in two patients. Archives of toxicology 2002, 76
(5-6), 316-25; (d) Jandacek, R. J.; Rider, T.; Keller, E. R.; Tso, P., The effect of olestra
on the absorption, excretion and storage of 2,2',5,5' tetrachlorobiphenyl; 3,3',4,4'
tetrachlorobiphenyl; and perfluorooctanoic acid. Environment international 2010, 36 (8),
880-3.
134. Moser, G. A.; McLachlan, M. S., A non-absorbable dietary fat substitute
enhances elimination of persistent lipophilic contaminants in humans. Chemosphere
1999, 39 (9), 1513-21.
135. Redgrave, T. G.; Wallace, P.; Jandacek, R. J.; Tso, P., Treatment with a dietary
fat substitute decreased Arochlor 1254 contamination in an obese diabetic male. The
136. (a) Singh, S.; Vrishni, S.; Singh, B. K.; Rahman, I.; Kakkar, P., Nrf2-ARE stress
response mechanism: a control point in oxidative stress-mediated dysfunctions and
chronic inflammatory diseases. Free radical research 2010, 44 (11), 1267-88; (b) Itoh,
K.; Mimura, J.; Yamamoto, M., Discovery of the negative regulator of Nrf2, Keap1: a
historical overview. Antioxidants & redox signaling 2010, 13 (11), 1665-78.
137. (a) Miao, X.; Bai, Y.; Sun, W.; Cui, W.; Xin, Y.; Wang, Y.; Tan, Y.; Miao, L.; Fu,
Y.; Su, G.; Cai, L., Sulforaphane prevention of diabetes-induced aortic damage was
associated with the up-regulation of Nrf2 and its down-stream antioxidants. Nutrition &
metabolism 2012, 9 (1), 84; (b) Nair, S.; Barve, A.; Khor, T. O.; Shen, G. X.; Lin, W.;
Chan, J. Y.; Cai, L.; Kong, A. N., Regulation of Nrf2- and AP-1-mediated gene
expression by epigallocatechin-3-gallate and sulforaphane in prostate of Nrf2-knockout
or C57BL/6J mice and PC-3 AP-1 human prostate cancer cells. Acta pharmacologica
Sinica 2010, 31 (9), 1223-40.
138. Hayes, J. D.; Dinkova-Kostova, A. T.; McMahon, M., Cross-talk between
transcription factors AhR and Nrf2: lessons for cancer chemoprevention from dioxin.
Toxicological sciences : an official journal of the Society of Toxicology 2009, 111 (2),
199-201.
139. Yeager, R. L.; Reisman, S. A.; Aleksunes, L. M.; Klaassen, C. D., Introducing the
"TCDD-inducible AhR-Nrf2 gene battery". Toxicological sciences : an official journal of
the Society of Toxicology 2009, 111 (2), 238-46.
140. Li, W.; Liu, H.; Zhou, J. S.; Cao, J. F.; Zhou, X. B.; Choi, A. M.; Chen, Z. H.;
Shen, H. H., Caveolin-1 inhibits expression of antioxidant enzymes through direct
interaction with nuclear erythroid 2 p45-related factor-2 (Nrf2). The Journal of biological
chemistry 2012, 287 (25), 20922-30.
141. (a) Wang, L. X.; Heredia, A.; Song, H.; Zhang, Z.; Yu, B.; Davis, C.; Redfield, R.,
Resveratrol glucuronides as the metabolites of resveratrol in humans: characterization,
synthesis, and anti-HIV activity. Journal of pharmaceutical sciences 2004, 93 (10), 2448-
57; (b) Urpi-Sarda, M.; Zamora-Ros, R.; Lamuela-Raventos, R.; Cherubini, A.; Jauregui,
O.; de la Torre, R.; Covas, M. I.; Estruch, R.; Jaeger, W.; Andres-Lacueva, C., HPLC-
tandem mass spectrometric method to characterize resveratrol metabolism in humans.
Clinical chemistry 2007, 53 (2), 292-9.

141

142. Rechner, A. R.; Kuhnle, G.; Bremner, P.; Hubbard, G. P.; Moore, K. P.; Rice-
Evans, C. A., The metabolic fate of dietary polyphenols in humans. Free radical biology
& medicine 2002, 33 (2), 220-35.
143. (a) Fam, S. S.; Murphey, L. J.; Terry, E. S.; Zackert, W. E.; Chen, Y.; Gao, L.;
Pandalai, S.; Milne, G. L.; Roberts, L. J.; Porter, N. A.; Montine, T. J.; Morrow, J. D.,
Formation of highly reactive A-ring and J-ring isoprostane-like compounds (A4/J4-
neuroprostanes) in vivo from docosahexaenoic acid. The Journal of biological chemistry
2002, 277 (39), 36076-84; (b) Gao, L.; Wang, J.; Sekhar, K. R.; Yin, H.; Yared, N. F.;
Schneider, S. N.; Sasi, S.; Dalton, T. P.; Anderson, M. E.; Chan, J. Y.; Morrow, J. D.;
Freeman, M. L., Novel n-3 fatty acid oxidation products activate Nrf2 by destabilizing the
association between Keap1 and Cullin3. The Journal of biological chemistry 2007, 282
(4), 2529-37; (c) Musiek, E. S.; Brooks, J. D.; Joo, M.; Brunoldi, E.; Porta, A.; Zanoni, G.;
Vidari, G.; Blackwell, T. S.; Montine, T. J.; Milne, G. L.; McLaughlin, B.; Morrow, J. D.,
Electrophilic cyclopentenone neuroprostanes are anti-inflammatory mediators formed
from the peroxidation of the omega-3 polyunsaturated fatty acid docosahexaenoic acid.
The Journal of biological chemistry 2008, 283 (29), 19927-35.
144. (a) Khoo, N. K.; Rudolph, V.; Cole, M. P.; Golin-Bisello, F.; Schopfer, F. J.;
Woodcock, S. R.; Batthyany, C.; Freeman, B. A., Activation of vascular endothelial nitric
oxide synthase and heme oxygenase-1 expression by electrophilic nitro-fatty acids. Free
radical biology & medicine 2010, 48 (2), 230-9; (b) Khoo, N. K.; Freeman, B. A.,
Electrophilic nitro-fatty acids: anti-inflammatory mediators in the vascular compartment.
Current opinion in pharmacology 2010, 10 (2), 179-84; (c) Rudolph, V.; Rudolph, T. K.;
Schopfer, F. J.; Bonacci, G.; Woodcock, S. R.; Cole, M. P.; Baker, P. R.; Ramani, R.;
Freeman, B. A., Endogenous generation and protective effects of nitro-fatty acids in a
murine model of focal cardiac ischaemia and reperfusion. Cardiovascular research 2010,
85 (1), 155-66; (d) Rudolph, T. K.; Rudolph, V.; Edreira, M. M.; Cole, M. P.; Bonacci, G.;
Schopfer, F. J.; Woodcock, S. R.; Franek, A.; Pekarova, M.; Khoo, N. K.; Hasty, A. H.;
Baldus, S.; Freeman, B. A., Nitro-fatty acids reduce atherosclerosis in apolipoprotein E-
deficient mice. Arteriosclerosis, thrombosis, and vascular biology 2010, 30 (5), 938-45;
(e) Tsujita, T.; Li, L.; Nakajima, H.; Iwamoto, N.; Nakajima-Takagi, Y.; Ohashi, K.;
Kawakami, K.; Kumagai, Y.; Freeman, B. A.; Yamamoto, M.; Kobayashi, M., Nitro-fatty
acids and cyclopentenone prostaglandins share strategies to activate the Keap1-Nrf2
system: a study using green fluorescent protein transgenic zebrafish. Genes to cells :
devoted to molecular & cellular mechanisms 2011, 16 (1), 46-57.
145. Freeman, B. A.; Baker, P. R.; Schopfer, F. J.; Woodcock, S. R.; Napolitano, A.;
d'Ischia, M., Nitro-fatty acid formation and signaling. The Journal of biological chemistry
2008, 283 (23), 15515-9.
146. Baker, P. R.; Schopfer, F. J.; O'Donnell, V. B.; Freeman, B. A., Convergence of
nitric oxide and lipid signaling: anti-inflammatory nitro-fatty acids. Free radical biology &
medicine 2009, 46 (8), 989-1003.
147. (a) Kansanen, E.; Bonacci, G.; Schopfer, F. J.; Kuosmanen, S. M.; Tong, K. I.;
Leinonen, H.; Woodcock, S. R.; Yamamoto, M.; Carlberg, C.; Yla-Herttuala, S.;
Freeman, B. A.; Levonen, A. L., Electrophilic nitro-fatty acids activate NRF2 by a KEAP1
cysteine 151-independent mechanism. The Journal of biological chemistry 2011, 286
(16), 14019-27; (b) Borniquel, S.; Jansson, E. A.; Cole, M. P.; Freeman, B. A.; Lundberg,
J. O., Nitrated oleic acid up-regulates PPARgamma and attenuates experimental
inflammatory bowel disease. Free radical biology & medicine 2010, 48 (4), 499-505.
148. Goncharov, A.; Haase, R. F.; Santiago-Rivera, A.; Morse, G.; Akwesasne Task
Force on the, E.; McCaffrey, R. J.; Rej, R.; Carpenter, D. O., High serum PCBs are
associated with elevation of serum lipids and cardiovascular disease in a Native
American population. Environmental research 2008, 106 (2), 226-39.

142

149. (a) ATSDR, Polychlorinated Biphenyls (PCB) Toxicity
Exposure Pathways. HEALTH, D. O.; SERVICES, A. H., Eds.
http://www.atsdr.cdc.gov/csem/csem.asp?csem=22&po=4, 2000; (b) Faroon, O.; Samuel
Keith, L.; Smith-Simon, C.; De Rosa, C., POLYCHLORINATED BIPHENYLS:HUMAN
HEALTH ASPECTS. Organization, W. H., Ed. Geneva, 2003; pp 1-64.
150. Libby, P., What have we learned about the biology of atherosclerosis? The role
of inflammation. The American journal of cardiology 2001, 88 (7B), 3J-6J.
151. Layne, J.; Majkova, Z.; Smart, E. J.; Toborek, M.; Hennig, B., Caveolae: a
regulatory platform for nutritional modulation of inflammatory diseases. The Journal of
nutritional biochemistry 2011, 22 (9), 807-11.
152. Croce, K.; Libby, P., Intertwining of thrombosis and inflammation in
atherosclerosis. Current opinion in hematology 2007, 14 (1), 55-61.
153. Niture, S. K.; Khatri, R.; Jaiswal, A. K., Regulation of Nrf2-an update. Free radical
biology & medicine 2013.
154. Wang, L.; Chen, Y.; Sternberg, P.; Cai, J., Essential roles of the PI3 kinase/Akt
pathway in regulating Nrf2-dependent antioxidant functions in the RPE. Investigative
ophthalmology & visual science 2008, 49 (4), 1671-8.
155. (a) Newsome, B.; Petriello, M.; Han, S.; Murphy, M.; Eske, K.; Sunkara, M.;
Morris, A.; Hennig, B., Green tea diet decreases PCB 126-induced oxidative stress in
mice by upregulating antioxidant
enzymes. Journal of nutritional biochemistry 2013; (b) Park, S. H.; Jang, J. H.; Chen, C.
Y.; Na, H. K.; Surh, Y. J., A formulated red ginseng extract rescues PC12 cells from
PCB-induced oxidative cell death through Nrf2-mediated upregulation of heme
oxygenase-1 and glutamate cysteine ligase. Toxicology 2010, 278 (1), 131-9.
156. (a) Bellezza, I.; Tucci, A.; Galli, F.; Grottelli, S.; Mierla, A. L.; Pilolli, F.; Minelli, A.,
Inhibition of NF-kappaB nuclear translocation via HO-1 activation underlies alpha-
tocopheryl succinate toxicity. The Journal of nutritional biochemistry 2012, 23 (12), 1583-
91; (b) Yang, Y. C.; Lii, C. K.; Wei, Y. L.; Li, C. C.; Lu, C. Y.; Liu, K. L.; Chen, H. W.,
Docosahexaenoic acid inhibition of inflammation is partially via cross-talk between
Nrf2/heme oxygenase 1 and IKK/NF-kappaB pathways. The Journal of nutritional
biochemistry 2013, 24 (1), 204-12.
157. Salous, A. K.; Panchatcharam, M.; Sunkara, M.; Mueller, P.; Dong, A.; Wang, Y.;
Graf, G. A.; Smyth, S. S.; Morris, A. J., Mechanism of rapid elimination of
lysophosphatidic acid and related lipids from the circulation of mice. Journal of lipid
research 2013, 54 (10), 2775-84.
158. Ramadass, P.; Meerarani, P.; Toborek, M.; Robertson, L. W.; Hennig, B., Dietary
flavonoids modulate PCB-induced oxidative stress, CYP1A1 induction, and AhR-DNA
binding activity in vascular endothelial cells. Toxicological sciences : an official journal of
the Society of Toxicology 2003, 76 (1), 212-9.
159. (a) Repetto, S.; Salani, B.; Maggi, D.; Cordera, R., Insulin and IGF-I
phosphorylate eNOS in HUVECs by a caveolin-1 dependent mechanism. Biochemical
and biophysical research communications 2005, 337 (3), 849-52; (b) Zheng, Y.; Morris,
A.; Sunkara, M.; Layne, J.; Toborek, M.; Hennig, B., Epigallocatechin-gallate stimulates
NF-E2-related factor and heme oxygenase-1 via caveolin-1 displacement. The Journal
of nutritional biochemistry 2012.
160. Volonte, D.; Liu, Z.; Musille, P. M.; Stoppani, E.; Wakabayashi, N.; Di, Y. P.;
Lisanti, M. P.; Kensler, T. W.; Galbiati, F., Inhibition of nuclear factor-erythroid 2-related
factor (Nrf2) by caveolin-1 promotes stress-induced premature senescence. Molecular
biology of the cell 2013, 24 (12), 1852-62.

143

161. (a) Bourez, S.; Van den Daelen, C.; Le Lay, S.; Poupaert, J.; Larondelle, Y.;
Thome, J. P.; Schneider, Y. J.; Dugail, I.; Debier, C., The dynamics of accumulation of
PCBs in cultured adipocytes vary with the cell lipid content and the lipophilicity of the
congener. Toxicology letters 2013, 216 (1), 40-6; (b) Bourez, S.; Joly, A.; Covaci, A.;
Remacle, C.; Larondelle, Y.; Schneider, Y. J.; Debier, C., Accumulation capacity of
primary cultures of adipocytes for PCB-126: influence of cell differentiation stage and
triglyceride levels. Toxicology letters 2012, 214 (3), 243-50.
162. Eades, G.; Yang, M.; Yao, Y.; Zhang, Y.; Zhou, Q., miR-200a regulates Nrf2
activation by targeting Keap1 mRNA in breast cancer cells. The Journal of biological
chemistry 2011, 286 (47), 40725-33.
163. Pavlides, S.; Tsirigos, A.; Vera, I.; Flomenberg, N.; Frank, P. G.; Casimiro, M. C.;
Wang, C.; Fortina, P.; Addya, S.; Pestell, R. G.; Martinez-Outschoorn, U. E.; Sotgia, F.;
Lisanti, M. P., Loss of stromal caveolin-1 leads to oxidative stress, mimics hypoxia and
drives inflammation in the tumor microenvironment, conferring the "reverse Warburg
effect": a transcriptional informatics analysis with validation. Cell cycle 2010, 9 (11),
2201-19.
164. Oka, N.; Yamamoto, M.; Schwencke, C.; Kawabe, J.; Ebina, T.; Ohno, S.; Couet,
J.; Lisanti, M. P.; Ishikawa, Y., Caveolin interaction with protein kinase C. Isoenzyme-
dependent regulation of kinase activity by the caveolin scaffolding domain peptide. The
Journal of biological chemistry 1997, 272 (52), 33416-21.
165. Das Evcimen, N.; King, G. L., The role of protein kinase C activation and the
vascular complications of diabetes. Pharmacological research : the official journal of the
Italian Pharmacological Society 2007, 55 (6), 498-510.
166. Feng, S.; Wang, Y.; Wang, X.; Wang, Z.; Cui, Y.; Liu, J.; Zhao, C.; Jin, M.; Zou,
W., Caveolin-1 gene silencing promotes the activation of PI3K/AKT dependent on
Eralpha36 and the transformation of MCF10ACE. Science China. Life sciences 2010, 53
(5), 598-605.
167. Pi, J.; Bai, Y.; Reece, J. M.; Williams, J.; Liu, D.; Freeman, M. L.; Fahl, W. E.;
Shugar, D.; Liu, J.; Qu, W.; Collins, S.; Waalkes, M. P., Molecular mechanism of human
Nrf2 activation and degradation: role of sequential phosphorylation by protein kinase
CK2. Free radical biology & medicine 2007, 42 (12), 1797-806.
168. Naoum, J. J.; Zhang, S.; Woodside, K. J.; Song, W.; Guo, Q.; Belalcazar, L. M.;
Hunter, G. C., Aortic eNOS expression and phosphorylation in Apo-E knockout mice:
differing effects of rapamycin and simvastatin. Surgery 2004, 136 (2), 323-8.
169. Meda, C.; Plank, C.; Mykhaylyk, O.; Schmidt, K.; Mayer, B., Effects of statins on
nitric oxide/cGMP signaling in human umbilical vein endothelial cells. Pharmacological
reports : PR 2010, 62 (1), 100-12.
170. Weber, R.; Gaus, C.; Tysklind, M.; Johnston, P.; Forter, M.; Hollert, H.; Heinisch,
E.; Holoubek, I.; Lloyd-Smith, M.; Masunaga, S.; Moccarelli, P.; Santillo, D.; Seike, N.;
Symons, R.; Torres, J. P.; Verta, M.; Varbelow, G.; Vijgen, J.; Watson, A.; Costner, P.;
Woelz, J.; Wycisk, P.; Zennegg, M., Dioxin- and POP-contaminated sites--contemporary
and future relevance and challenges: overview on background, aims and scope of the
series. Environmental science and pollution research international 2008, 15 (5), 363-93.
171. Lind, P. M.; van Bavel, B.; Salihovic, S.; Lind, L., Circulating levels of persistent
organic pollutants (POPs) and carotid atherosclerosis in the elderly. Environmental
health perspectives 2012, 120 (1), 38-43.
172. Valvi, D.; Mendez, M. A.; Martinez, D.; Grimalt, J. O.; Torrent, M.; Sunyer, J.;
Vrijheid, M., Prenatal concentrations of polychlorinated biphenyls, DDE, and DDT and
overweight in children: a prospective birth cohort study. Environmental health
perspectives 2012, 120 (3), 451-7.

144

173. Cave, M.; Appana, S.; Patel, M.; Falkner, K. C.; McClain, C. J.; Brock, G.,
Polychlorinated biphenyls, lead, and mercury are associated with liver disease in
American adults: NHANES 2003-2004. Environmental health perspectives 2010, 118
(12), 1735-42.
174. Hennig, B.; Toborek, M.; Bachas, L. G.; Suk, W. A., Emerging issues: nutritional
awareness in environmental toxicology. J Nutr Biochem 2004, 15 (4), 194-5.
175. Wahlang, B.; Falkner, K. C.; Gregory, B.; Ansert, D.; Young, D.; Conklin, D. J.;
Bhatnagar, A.; McClain, C. J.; Cave, M., Polychlorinated biphenyl 153 is a diet-
dependent obesogen that worsens nonalcoholic fatty liver disease in male C57BL6/J
mice. The Journal of nutritional biochemistry 2013, 24 (9), 1587-95.
176. De, S.; Ghosh, S.; Chatterjee, R.; Chen, Y. Q.; Moses, L.; Kesari, A.; Hoffman, E.
P.; Dutta, S. K., PCB congener specific oxidative stress response by microarray analysis
using human liver cell line. Environment international 2010, 36 (8), 907-17.
177. Lai, I.; Chai, Y.; Simmons, D.; Luthe, G.; Coleman, M. C.; Spitz, D.; Haschek, W.
M.; Ludewig, G.; Robertson, L. W., Acute toxicity of 3,3',4,4',5-pentachlorobiphenyl (PCB
126) in male Sprague-Dawley rats: effects on hepatic oxidative stress, glutathione and
metals status. Environment international 2010, 36 (8), 918-23.
178. Petriello, M. C.; Newsome, B.; Hennig, B., Influence of nutrition in PCB-induced
vascular inflammation. Environ Sci Pollut Res Int 2013.
179. (a) Myers, C. R., The effects of chromium(VI) on the thioredoxin system:
implications for redox regulation. Free radical biology & medicine 2012, 52 (10), 2091-
107; (b) Mann, G. E.; Niehueser-Saran, J.; Watson, A.; Gao, L.; Ishii, T.; de Winter, P.;
Siow, R. C., Nrf2/ARE regulated antioxidant gene expression in endothelial and smooth
muscle cells in oxidative stress: implications for atherosclerosis and preeclampsia.
Sheng li xue bao : [Acta physiologica Sinica] 2007, 59 (2), 117-27.
180. Nordberg, J.; Arner, E. S., Reactive oxygen species, antioxidants, and the
mammalian thioredoxin system. Free radical biology & medicine 2001, 31 (11), 1287-
312.
181. Savouret, J. F.; Berdeaux, A.; Casper, R. F., The aryl hydrocarbon receptor and
its xenobiotic ligands: a fundamental trigger for cardiovascular diseases. Nutrition,
metabolism, and cardiovascular diseases : NMCD 2003, 13 (2), 104-13.
182. Kopf, P. G.; Walker, M. K., 2,3,7,8-tetrachlorodibenzo-p-dioxin increases reactive
oxygen species production in human endothelial cells via induction of cytochrome
P4501A1. Toxicology and applied pharmacology 2010, 245 (1), 91-9.
183. Lee, J. M.; Chan, K.; Kan, Y. W.; Johnson, J. A., Targeted disruption of Nrf2
causes regenerative immune-mediated hemolytic anemia. Proceedings of the National
Academy of Sciences of the United States of America 2004, 101 (26), 9751-6.
184. Rangasamy, T.; Cho, C. Y.; Thimmulappa, R. K.; Zhen, L.; Srisuma, S. S.;
Kensler, T. W.; Yamamoto, M.; Petrache, I.; Tuder, R. M.; Biswal, S., Genetic ablation of
Nrf2 enhances susceptibility to cigarette smoke-induced emphysema in mice. J Clin
Invest 2004, 114 (9), 1248-59.
185. Zhen, M. C.; Wang, Q.; Huang, X. H.; Cao, L. Q.; Chen, X. L.; Sun, K.; Liu, Y. J.;
Li, W.; Zhang, L. J., Green tea polyphenol epigallocatechin-3-gallate inhibits oxidative
damage and preventive effects on carbon tetrachloride-induced hepatic fibrosis. The
186. Bruno, R. S.; Dugan, C. E.; Smyth, J. A.; DiNatale, D. A.; Koo, S. I., Green tea
extract protects leptin-deficient, spontaneously obese mice from hepatic steatosis and
injury(1,2). Journal of Nutrition 2008, 138 (2), 323-331.
187. Montuschi, P.; Barnes, P.; Roberts, L. J., Insights into oxidative stress: The
isoprostanes. Current Medicinal Chemistry 2007, 14 (6), 703-717.

145

188. Dorjgochoo, T.; Gao, Y. T.; Chow, W. H.; Shu, X. O.; Yang, G.; Cai, Q.;
Rothman, N.; Cai, H.; Li, H.; Deng, X.; Franke, A.; Roberts, L. J.; Milne, G.; Zheng, W.;
Dai, Q., Major metabolite of F2-isoprostane in urine may be a more sensitive biomarker
of oxidative stress than isoprostane itself. Am J Clin Nutr 2012, 96 (2), 405-14.
189. Hennig, B.; Ettinger, A. S.; Jandacek, R. J.; Koo, S.; McClain, C.; Seifried, H.;
Silverstone, A.; Watkins, B.; Suk, W. A., Using nutrition for intervention and prevention
against environmental chemical toxicity and associated diseases. Environmental health
perspectives 2007, 115 (4), 493-5.
190. Cave, M.; Deaciuc, I.; Mendez, C.; Song, Z.; Joshi-Barve, S.; Barve, S.; McClain,
C., Nonalcoholic fatty liver disease: predisposing factors and the role of nutrition. The
191. (a) Chung, M. Y.; Park, H. J.; Manautou, J. E.; Koo, S. I.; Bruno, R. S., Green tea
extract protects against nonalcoholic steatohepatitis in ob/ob mice by decreasing
oxidative and nitrative stress responses induced by proinflammatory enzymes. The
Journal of nutritional biochemistry 2012, 23 (4), 361-7; (b) Park, H. J.; DiNatale, D. A.;
Chung, M. Y.; Park, Y. K.; Lee, J. Y.; Koo, S. I.; O'Connor, M.; Manautou, J. E.; Bruno,
R. S., Green tea extract attenuates hepatic steatosis by decreasing adipose lipogenesis
and enhancing hepatic antioxidant defenses in ob/ob mice. J Nutr Biochem 2011, 22 (4),
393-400.
192. (a) Sipos, E.; Chen, L.; Andras, I. E.; Wrobel, J.; Zhang, B.; Pu, H.; Park, M.;
Eum, S. Y.; Toborek, M., Proinflammatory adhesion molecules facilitate polychlorinated
biphenyl-mediated enhancement of brain metastasis formation. Toxicological sciences :
an official journal of the Society of Toxicology 2012, 126 (2), 362-71; (b) Seelbach, M.;
Chen, L.; Powell, A.; Choi, Y. J.; Zhang, B.; Hennig, B.; Toborek, M., Polychlorinated
biphenyls disrupt blood-brain barrier integrity and promote brain metastasis formation.
Environ Health Perspect 2010, 118 (4), 479-84.
193. Cabrera, C.; Artacho, R.; Gimenez, R., Beneficial effects of green tea--a review.
Journal of the American College of Nutrition 2006, 25 (2), 79-99.
194. (a) Schlezinger, J. J.; Stegeman, J. J., Induction and suppression of cytochrome
P450 1A by 3,3',4,4',5-pentachlorobiphenyl and its relationship to oxidative stress in the
marine fish scup (Stenotomus chrysops). Aquatic toxicology 2001, 52 (2), 101-15; (b)
Twaroski, T. P.; O'Brien, M. L.; Robertson, L. W., Effects of selected polychlorinated
biphenyl (PCB) congeners on hepatic glutathione, glutathione-related enzymes, and
selenium status: implications for oxidative stress. Biochemical pharmacology 2001, 62
(3), 273-81; (c) Katynski, A. L.; Vijayan, M. M.; Kennedy, S. W.; Moon, T. W., 3,3',4,4',5-
Pentachlorobiphenyl (PCB 126) impacts hepatic lipid peroxidation, membrane fluidity
and beta-adrenoceptor kinetics in chick embryos. Comparative biochemistry and
physiology. Toxicology & pharmacology : CBP 2004, 137 (1), 81-93; (d) Hassoun, E. A.;
Li, F.; Abushaban, A.; Stohs, S. J., The relative abilities of TCDD and its congeners to
induce oxidative stress in the hepatic and brain tissues of rats after subchronic
exposure. Toxicology 2000, 145 (2-3), 103-13.
195. Suzuki, T.; Hara, H., Role of flavonoids in intestinal tight junction regulation. The
196. Frei, B.; Higdon, J. V., Antioxidant activity of tea polyphenols in vivo: evidence
from animal studies. J Nutr 2003, 133 (10), 3275S-84S.
197. (a) Na, H. K.; Surh, Y. J., Modulation of Nrf2-mediated antioxidant and
detoxifying enzyme induction by the green tea polyphenol EGCG. Food Chem Toxicol
2008, 46 (4), 1271-8; (b) Scapagnini, G.; Vasto, S.; Abraham, N. G.; Caruso, C.; Zella,
D.; Fabio, G., Modulation of Nrf2/ARE pathway by food polyphenols: a nutritional
neuroprotective strategy for cognitive and neurodegenerative disorders. Molecular
neurobiology 2011, 44 (2), 192-201.

146

198. Lorenz, M.; Urban, J.; Engelhardt, U.; Baumann, G.; Stangl, K.; Stangl, V., Green
and black tea are equally potent stimuli of NO production and vasodilation: new insights
into tea ingredients involved. Basic research in cardiology 2009, 104 (1), 100-10.
199. (a) Skrzydlewska, E.; Ostrowska, J.; Farbiszewski, R.; Michalak, K., Protective
effect of green tea against lipid peroxidation in the rat liver, blood serum and the brain.
Phytomedicine : international journal of phytotherapy and phytopharmacology 2002, 9
(3), 232-8; (b) Guleria, R. S.; Jain, A.; Tiwari, V.; Misra, M. K., Protective effect of green
tea extract against the erythrocytic oxidative stress injury during mycobacterium
tuberculosis infection in mice. Molecular and cellular biochemistry 2002, 236 (1-2), 173-
81.
200. Williams, S. N.; Shih, H.; Guenette, D. K.; Brackney, W.; Denison, M. S.;
Pickwell, G. V.; Quattrochi, L. C., Comparative studies on the effects of green tea
extracts and individual tea catechins on human CYP1A gene expression. Chemico-
biological interactions 2000, 128 (3), 211-29.
201. (a) Pae, M.; Ren, Z.; Meydani, M.; Shang, F.; Smith, D.; Meydani, S. N.; Wu, D.,
Dietary supplementation with high dose of epigallocatechin-3-gallate promotes
inflammatory response in mice. The Journal of nutritional biochemistry 2012, 23 (6), 526-
31; (b) Chan, P. C.; Ramot, Y.; Malarkey, D. E.; Blackshear, P.; Kissling, G. E.; Travlos,
G.; Nyska, A., Fourteen-week toxicity study of green tea extract in rats and mice.
Toxicologic pathology 2010, 38 (7), 1070-84.
202. Birringer, M., Hormetics: dietary triggers of an adaptive stress response.
Pharmaceutical research 2011, 28 (11), 2680-94.
203. Lazic, M.; Inzaugarat, M. E.; Povero, D.; Zhao, I. C.; Chen, M.; Nalbandian, M.;
Miller, Y. I.; Chernavsky, A. C.; Feldstein, A. E.; Sears, D. D., Reduced dietary omega-6
to omega-3 fatty acid ratio and 12/15-lipoxygenase deficiency are protective against
chronic high fat diet-induced steatohepatitis. PloS one 2014, 9 (9), e107658.
204. Moran, J. H.; Mitchell, L. A.; Bradbury, J. A.; Qu, W.; Zeldin, D. C.; Schnellmann,
R. G.; Grant, D. F., Analysis of the cytotoxic properties of linoleic acid metabolites
produced by renal and hepatic P450s. Toxicology and applied pharmacology 2000, 168
(3), 268-79.
205. Slim, R.; Hammock, B. D.; Toborek, M.; Robertson, L. W.; Newman, J. W.;
Morisseau, C. H.; Watkins, B. A.; Saraswathi, V.; Hennig, B., The role of methyl-linoleic
acid epoxide and diol metabolites in the amplified toxicity of linoleic acid and
polychlorinated biphenyls to vascular endothelial cells. Toxicology and applied
pharmacology 2001, 171 (3), 184-93.
206. Shin, E.; Yeo, E.; Lim, J.; Chang, Y. H.; Park, H.; Shim, E.; Chung, H.; Hwang, H.
J.; Chun, J.; Hwang, J., Nitrooleate mediates nitric oxide synthase activation in
endothelial cells. Lipids 2014, 49 (5), 457-66.
207. Hennig, B.; Toborek, M.; McClain, C. J.; Diana, J. N., Nutritional implications in
vascular endothelial cell metabolism. Journal of the American College of Nutrition 1996,
15 (4), 345-58.
208. (a) Reddy, A. T.; Lakshmi, S. P.; Reddy, R. C., The Nitrated Fatty Acid 10-Nitro-
oleate Diminishes Severity of LPS-Induced Acute Lung Injury in Mice. PPAR research
2012, 2012, 617063; (b) Zhang, J.; Villacorta, L.; Chang, L.; Fan, Z.; Hamblin, M.; Zhu,
T.; Chen, C. S.; Cole, M. P.; Schopfer, F. J.; Deng, C. X.; Garcia-Barrio, M. T.; Feng, Y.
H.; Freeman, B. A.; Chen, Y. E., Nitro-oleic acid inhibits angiotensin II-induced
hypertension. Circulation research 2010, 107 (4), 540-8; (c) Wang, H.; Liu, H.; Jia, Z.;
Olsen, C.; Litwin, S.; Guan, G.; Yang, T., Nitro-oleic acid protects against endotoxin-
induced endotoxemia and multiorgan injury in mice. American journal of physiology.
Renal physiology 2010, 298 (3), F754-62.

147

209. Nannelli, A.; Rossignolo, F.; Tolando, R.; Rossato, P.; Longo, V.; Gervasi, P. G.,
Effect of beta-naphthoflavone on AhR-regulated genes (CYP1A1, 1A2, 1B1, 2S1, Nrf2,
and GST) and antioxidant enzymes in various brain regions of pig. Toxicology 2009, 265
(3), 69-79.
210. Villard, P. H.; Barlesi, F.; Armand, M.; Dao, T. M.; Pascussi, J. M.; Fouchier, F.;
Champion, S.; Dufour, C.; Ginies, C.; Khalil, A.; Amiot, M. J.; Barra, Y.; Seree, E.,
CYP1A1 induction in the colon by serum: involvement of the PPARalpha pathway and
evidence for a new specific human PPREalpha site. PloS one 2011, 6 (1), e14629.
211. Viswanathan, S.; Hammock, B. D.; Newman, J. W.; Meerarani, P.; Toborek, M.;
Hennig, B., Involvement of CYP 2C9 in mediating the proinflammatory effects of linoleic
acid in vascular endothelial cells. Journal of the American College of Nutrition 2003, 22
(6), 502-10.
212. Spiteller, G., Linoleic acid peroxidation--the dominant lipid peroxidation process
in low density lipoprotein--and its relationship to chronic diseases. Chemistry and
physics of lipids 1998, 95 (2), 105-62.
213. Wang, L.; Lim, E. J.; Toborek, M.; Hennig, B., The role of fatty acids and
caveolin-1 in tumor necrosis factor alpha-induced endothelial cell activation. Metabolism:
clinical and experimental 2008, 57 (10), 1328-39.
214. Zheng, Y.; Lim, E. J.; Wang, L.; Smart, E. J.; Toborek, M.; Hennig, B., Role of
caveolin-1 in EGCG-mediated protection against linoleic-acid-induced endothelial cell
activation. The Journal of nutritional biochemistry 2009, 20 (3), 202-9.
215. Massaro, M.; Scoditti, E.; Carluccio, M. A.; De Caterina, R., Nutraceuticals and
prevention of atherosclerosis: focus on omega-3 polyunsaturated fatty acids and
Mediterranean diet polyphenols. Cardiovasc Ther 2010, 28 (4), e13-9.
216. Moertl, D.; Hammer, A.; Steiner, S.; Hutuleac, R.; Vonbank, K.; Berger, R., Dose-
dependent effects of omega-3-polyunsaturated fatty acids on systolic left ventricular
function, endothelial function, and markers of inflammation in chronic heart failure of
nonischemic origin: a double-blind, placebo-controlled, 3-arm study. Am Heart J 2011,
161 (5), 915 e1-9.
217. Manach, C.; Scalbert, A.; Morand, C.; Remesy, C.; Jimenez, L., Polyphenols:
food sources and bioavailability. Am J Clin Nutr 2004, 79 (5), 727-47.
218. Kris-Etherton, P. M.; Lefevre, M.; Beecher, G. R.; Gross, M. D.; Keen, C. L.;
Etherton, T. D., Bioactive compounds in nutrition and health-research methodologies for
establishing biological function: the antioxidant and anti-inflammatory effects of
flavonoids on atherosclerosis. Annu Rev Nutr 2004, 24, 511-38.
219. (a) D'Archivio, M.; Filesi, C.; Di Benedetto, R.; Gargiulo, R.; Giovannini, C.;
Masella, R., Polyphenols, dietary sources and bioavailability. Ann Ist Super Sanita 2007,
43 (4), 348-61; (b) Aron, P. M.; Kennedy, J. A., Flavan-3-ols: nature, occurrence and
biological activity. Molecular nutrition & food research 2008, 52 (1), 79-104; (c)
Gonzalez-Gallego, J.; Garcia-Mediavilla, M. V.; Sanchez-Campos, S.; Tunon, M. J., Fruit
polyphenols, immunity and inflammation. The British journal of nutrition 2010, 104 Suppl
3, S15-27.
220. (a) Casper, R. F.; Quesne, M.; Rogers, I. M.; Shirota, T.; Jolivet, A.; Milgrom, E.;
Savouret, J. F., Resveratrol has antagonist activity on the aryl hydrocarbon receptor:
implications for prevention of dioxin toxicity. Mol Pharmacol 1999, 56 (4), 784-90; (b)
Singhal, R.; Badger, T. M.; Ronis, M. J., Reduction in 7,12-dimethylbenz[a]anthracene-
induced hepatic cytochrome-P450 1A1 expression following soy consumption in female
rats is mediated by degradation of the aryl hydrocarbon receptor. J Nutr 2007, 137 (1),
19-24; (c) Palermo, C. M.; Westlake, C. A.; Gasiewicz, T. A., Epigallocatechin gallate
inhibits aryl hydrocarbon receptor gene transcription through an indirect mechanism
involving binding to a 90 kDa heat shock protein. Biochemistry 2005, 44 (13), 5041-52.

148

221. Majkova, Z.; Layne, J.; Sunkara, M.; Morris, A. J.; Toborek, M.; Hennig, B.,
Omega-3 fatty acid oxidation products prevent vascular endothelial cell activation by
coplanar polychlorinated biphenyls. Toxicol Appl Pharmacol 251 (1), 41-9.
222. Hennig, B.; Ormsbee, L.; McClain, C. J.; Watkins, B. A.; Blumberg, B.; Bachas, L.
G.; Sanderson, W.; Thompson, C.; Suk, W. A., Nutrition Can Modulate the Toxicity of
Environmental Pollutants: Implications in Risk Assessment and Human Health. Environ
Health Perspect 2012.
223. Fu, Y.; Moore, X. L.; Lee, M. K.; Fernandez-Rojo, M. A.; Parat, M. O.; Parton, R.
G.; Meikle, P. J.; Sviridov, D.; Chin-Dusting, J. P., Caveolin-1 plays a critical role in the
differentiation of monocytes into macrophages. Arteriosclerosis, thrombosis, and
vascular biology 2012, 32 (9), e117-25.
224. Jensen, A., Background levels in humans In Halogenated biphenyls, terphenyls,
naphthalenes, dibenzodioxins and related products Kimbrough, R.; Jensen, A., Eds.
Elsevier: New York, 1989.
225. (a) Sandanger, T. M.; Brustad, M.; Odland, J. O.; Doudarev, A. A.; Miretsky, G. I.;
Chaschin, V.; Burkow, I. C.; Lund, E., Human plasma levels of POPs, and diet among
native people from Uelen, Chukotka. J Environ Monit 2003, 5 (4), 689-96; (b) Henriquez-
Hernandez, L. A.; Luzardo, O. P.; Almeida-Gonzalez, M.; Alvarez-Leon, E. E.; Serra-
Majem, L.; Zumbado, M.; Boada, L. D., Background levels of polychlorinated biphenyls
in the population of the Canary Islands (Spain). Environ Res 111 (1), 10-6.
226. Tsikas, D.; Zoerner, A.; Mitschke, A.; Homsi, Y.; Gutzki, F. M.; Jordan, J.,
Specific GC-MS/MS stable-isotope dilution methodology for free 9- and 10-nitro-oleic
acid in human plasma challenges previous LC-MS/MS reports. Journal of
chromatography. B, Analytical technologies in the biomedical and life sciences 2009,
877 (26), 2895-908.
227. Mineo, C.; Shaul, P. W., Regulation of eNOS in caveolae. Advances in
experimental medicine and biology 2012, 729, 51-62.
228. Murphy, M. O.; Petriello, M. C.; Han, S. G.; Sunkara, M.; Morris, A. J.; Esser, K.;
Hennig, B., Exercise protects against PCB-induced inflammation and associated
cardiovascular risk factors. Environmental science and pollution research international
2015.

149

Vita
Education
B.S. in Biology and Environmental Science from Muhlenberg College, Allentown, PA,
2010
Professional positions held
Research Assistant, Muhlenberg College, Allentown, PA, 2007-2010
Peer tutor, Muhlenberg College, Allentown, PA, 2007-2010
Scholastic and professional honors
1. CEECHE 2014 Meeting Travel Support Award, Romania, 05/2014
2. SOT Annual Meeting Travel Support Award, Phoenix, AZ, 12/2013
3. SETAC Travel Award, Nashville, TN, 11/2013
4. Superfund Annual Meeting Plenary Speaker Travel Award, Baton Rouge, LA,
10/2013
5. American Heart Association Great Rivers Affiliate Predoctoral Fellowship,
University of Kentucky, 07/2013-06/2015
6. NIEHS T32 Training Grant Recipient, University of Kentucky, 06/2011-06/2013
7. Dean’s Grant Scholarship, Muhlenberg College, Allentown, PA, 03/2009
8. Merck Scholar Summer Research Award, Muhlenberg College, Allentown, PA,
05/2008
9. Presidential Scholarship, Muhlenberg College, Allentown, PA, 08/2008

150

10. Eagle Scout, Troop 105, Schwenksville, PA, 08/2006
Professional publications
1. Murphy MO, Petriello MC, Han SG, Sunkara M, Morris AJ, Esser K, Hennig B:
Exercise protects against PCB-induced inflammation and associated
cardiovascular risk factors. Environmental science and pollution research. 2015
Jan 15. Epub ahead of print. PMID: 25586614
2. Petriello MC, Han SG, Newsome B, Hennig B: PCB 126 toxicity is modulated by
cross-talk between caveolae and Nrf2 signaling. 2014 Jun 1;277(2):192-9. doi:
10.1016/j.taap.2014.03.018. PMID: 24709675.
3. Petriello MC, Newsome B, Dziubla TD, Hilt JZ, D Bhattacharyya, Hennig B:
Modulation of persistent organic pollutant toxicity through nutritional intervention:
emerging opportunities in biomedicine and environmental remediation. Science
of the total environment. 2014. 21(10); 6410-6418. PMID: 24530186
4. Petriello MC, Newsome B, Han SG, Murphy M, Eske K, Sunkara M, Morris A,
Hennig B: Green tea diet decreases PCB 126-induced oxidative stress in mice
by upregulating antioxidant enzymes. Journal of Nutritional Biochemistry. 2014
Feb;25(2):126-35. doi: 10.1016/j.jnutbio.2013.10.003. Epub 2013 Nov 6. PMID:
24378064
5. Petriello MC, Newsome B, Hennig B: Influence of nutrition in PCB-induced
vascular inflammation. Environmental Science Pollution Research. 2014
May;21(10):6410-8.. 10.1007/s11356-013-1549-5. Epub 2013 Feb 17 PMID:
23417440
6. Kelsey JW, Slizovskiy IB, Petriello MC, Butler KL.: Influence of plant-earthworm
interactions on SOM chemistry and p,p’-DDE bioaccumulation. Chemosphere.
2011 May;83(7):897-902. doi: 10.1016/j.chemosphere.2011.02.056. Epub 2011
Mar 21. PMID: 21421253

ROLE OF CAVEOLIN-1 AND NRF2 IN NUTRITIONAL MODULATION OF PCB TOXI

More Related Content

Similar to ROLE OF CAVEOLIN-1 AND NRF2 IN NUTRITIONAL MODULATION OF PCB TOXI (20)

ROLE OF CAVEOLIN-1 AND NRF2 IN NUTRITIONAL MODULATION OF PCB TOXI