Bioinformatics workshop Sept 2014
- 1. Wet-lab Considerations for Illumina data analysis Based on a presentation by Henriette O’Geen Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center
- 2. Genome Resequencing RNA-seq Gene Expression Metageno mics Exome Sequencing ChIP-SEQ Small RNA SNPs, Indels Genotyping De novo genome Sequencing DNA Methylation Splice Isoform Abundance 3D Organization CNVs Rearrangements
- 3. Illumina Workflow Library Preparation Cluster Formation Sequencing Computer Analysis
- 4. DNA (0.1-1.0 ug) Illumina Sequencing Single molecule array Library preparation Cluster generation 3’ 5’ 5’ G T A C A C G T C A G T T G C T A C G A T A C C C G A T C G A T Sequencing Technology Sequencing By Synthesis (SBS) Technology
- 5. TruSeq Chemistry: Flow Cell Simplified workflow • Clusters in a contained environme nt (no need for clean rooms) • Sequencin g performed in the flow cell on the clusters Surface of flow cell coated with a lawn of oligo pairs 8 channels
- 6. Sequencing 1.6 Billion Clusters Per Flow Cell 20 Microns 100 Microns 6
- 7. Sequencing workflow Library Construction Cluster Formation Illumina Sequencing Data Analysis
- 8. Examples of DNA input requirements Illumina library prep kit Starting material TruSeq DNA > 100 ng KAPA DNA > 10 ng NEB Ultra Low > 5 ng TruSeq ChIP/MeDIP 10-50 ng Rubicon ThruPLEX 50 pg – 50 ng Nextera Kit * 50 ng Nextera Kit * for Single Cell 0.125 - 0.375 ng * Unique protocol using “tagmentation”: DNA is simultaneously fragmented and tagged with sequencing adapters
- 9. DNA library construction 5 ’ 5 ’ 5 ’ 5 ’ 5 ’ 5 ’ P HO OH P 5 ’ 5 ’ A P A P T T Fragmented DNA End Repair Blunt End Fragments “A” Tailing Single Overhang Fragments Adapter Ligation DNA Fragments with Adapter Ends
- 10. “If you can put adapters on it, we can sequence it!”
- 11. Know your sample
- 12. DNA fragmentation Mechanical shearing: • NGS BioRuptor • Covaris Enzymatic: • Fragmentase, Transposase Chemical All methods are sensitive to • Purity of DNA • DNA concentration
- 13. Size selection and clean-up using SPRI Beads SPRI = Solid Phase Reversible Immobilization Ratio of SPRI beads/PEG solution to sample determines size cut off
- 14. Optional: PCR-free libraries PCR-free library: – Library can be sequenced if concentration allows – Reduction of PCR bias against e.g. GC rich orAT rich regions, especially for metagenomic samples OR Library enrichment by PCR: – Ideal combination: high input and low cycle number
- 15. Enrichment of library fragments 5’ 5’ PCR Amplification
- 16. THE EVOLUTION OF ILLUMINA ADAPTERS ISABELLE HENRY
- 17. T A Fragmented DNA A + Adaptors “Regular” adaptors Advantages: Simple Obtain 1-2 reads (F and R) Problems: No multiplexing TA AT Forward read Reverse read TA AT
- 18. T A Fragmented DNA A + Adaptors “in-line barcodes” adaptors Advantages: Can multiplex Simple Obtain 1-2 reads (F and R) Problems: Cluster detection on the High Seq Lose sequence data in the barcodes AT AT TA TA Forward read T Reverse read T
- 19. T A Fragmented DNA A + Adaptors “Truseq –style” indexed adaptors Advantages: Index independent of read -> more data -> no more clustering problems Problems: Need more reagents Index only on one side TA AT TA AT Forward read Index read Reverse read
- 20. Adaptors “Dual indexed” T A Fragmented DNA A + adaptors Advantages: Cheaper Indexing information on both sides Problems: TBA… Forward read Index read 1 Index read 2 Reverse read For 96 reactions Simple index: 96 B adaptors 1 A adaptor Dual index: 12 A adaptors 8 B adaptors TA AT TA AT
- 21. Quantitation & QC methods Intercalating dye methods (PicoGreen, Qubit, etc.): Specific to dsDNA, accurate at low levels of DNA Great for pooling of indexed libraries to be sequenced in one lane Requires standard curve generation, many accurate pipetting steps Bioanalyzer: Quantitation is good for rough estimate Invaluable for library QC High-sensitivity DNA chip allows quantitation of low DNA levels qPCR Most accurate quantitation method More labor-intensive Must be compared to a control
- 22. Library QC by Bioanalyzer Predominant species of appropriate MW Minimal primer dimer or adapter dimers Minimal higher MW material
- 23. Bioanalyzer ChIP options DNA1000 High Sensitivity 0.1-5ng/uL
- 24. Library QC by Bioanalyzer Beautiful 100% Adapters Beautiful ~ 125 bp
- 25. Library QC Examples for successful libraries Adapter ~125 bp contamination at ~125 bp
- 26. Library quantitation by qPCR This step is usually performed by sequencing service center Use amplifying primers corresponding to ends of adapters Use standards of known concentration to generate standard curve of threshold Ct vs. concentration Use conversion factor to deduce concentration of unknown libraries Take library size into consideration! Commercial kits are available Primer 1 Primer 2
- 27. Examples of RNA input requirements Library prep kit Starting material mRNA (TruSeq) 100 ng - 4 μg total RNA Directional mRNA (TruSeq) 1-5 μg total RNA or 50 ng mRNA NEB ultra directional RNA 10 -100 ng mRNA or ribo depleted RNA Small RNA (TruSeq) 1 μg total RNA Ribo depletion (Epicentre) 1-5 μg total RNA SMARTer™ Ultra Low RNA (Clontech) 100 pg – 10 ng total RNA Single cell SMART-seq2 Single cell
- 28. Standard RNA-Seq library protocol QC of total RNA to assess integrity Removal of rRNA (most common) mRNA isolation rRNA depletion Fragmentation of RNA Reverse transcription and second-strand cDNA synthesis Ligation of adapters PCR Amplify Purify, QC and Quantify
- 29. Is strand-specific information important? Standard library (non-directional) antisense sense Neu1
- 30. Strand-specific RNA-seq Standard library (non-directional) Antisense non-coding RNA Sense transcripts Informative for non-coding RNAs and antisense transcripts Essential when NOT using polyA selection (mRNA) No disadvantage to preserving strand specificity
- 31. Your Sequence Data • Filtered vs. Unfiltered Illumina chastity filter (fluorescence ratio under threshold twice in first 25 bases) Passing Filter @HWI-M02034:55:000000000-A85G4:1:1101:21460:1468 1:N:0:_AACGCTTA CGTTTGATAAGCTGAAAATCGCCCTGACTCAAGCTCCAATTGTGAGAGGACCAG + A-ABC7-C9-<CE89,,,CC,CCCC8,CFF8,,;CCF8,CE,E9,,,,,,CD@< NOT Passing Filter @HWI-M02034:55:000000000-A85G4:1:1101:21460:1468 1:Y:0:_AACGCTTA
- 33. Your Sequence Data • PhiX (phi X 174) Illumina internal standard for QC • now in all MiSeq and HiSeq lanes Not aligned to PhiX @HWI-M02034:55:000000000-A85G4:1:1101:21460:1468 1:N:0: CGTTTGATAAGCTGAAAATCGCCCTGACTCAAGCTCCAATTGTGAGAGGACCAG + A-ABC7-C9-<CE89,,,CC,CCCC8,CFF8,,;CCF8,CE,E9,,,,,,CD@< Aligned to PhiX @HWI-M02034:55:000000000-A85G4:1:1101:21460:1468 1:N:18:
- 34. Targeted sequencing - exomes - cancer gene panels - RNA-seq - any non-repeat ROI - 2 HiSeq lanes / genome - 20 exomes / lane
- 35. Amplicon sequencing • Sequencing of amplified regions of interest • Common application: 16S/18S small subunit ribosomal RNA (SSU rRNA) genes as phylogenetic markers Primer 1 Primer 2 Standard library preparation OR
- 37. Reduced Representation Seq - RAD-seq, GBS restriction associated sites - High variation samples
- 38. http://pacificbiosciences.com THIRD GENERATION DNA SEQUENCING Single Molecule Real Time (SMRT™) sequencing Sequencing of single DNA molecule by single polymerase Very long reads: average reads over 8 kb, up to 30 kb High error rate (~13%). Complementary to short accurate reads of Illumina
- 39. 70 nm aperture “Zero Mode Waveguide”
- 40. Damien Peltier
- 41. First Sequencing of CGG-repeat Alleles in Human Fragile X Syndrome using PacBio RS Sequencer Paul Hagerman, Biochemistry and Molecular Medicine, SOM. • Single-molecule sequencing of pure CGG array, - first for disease-relevant allele. Loomis et al. (2012) Genome Research. - applicable to many other tandem repeat disorders. • Direct genomic DNA sequencing of methyl groups, - direct epigenetic sequencing (paper under review). • Discovered 100% bias toward methylation of 20 CGG-repeat allele in female, – first direct methylated DNA sequencing in human CGG36 CGG95 disease. • DoD STTR award with PacBio. Basis of R01 applications. A C G T Nucleotide position
- 43. MinION: disposable DNA sequencer GridION www.nanoporetech.com The best is yet to come ….. e.g.
- 45. Nick Loman
- 46. Thank you!