Characterization of Multidrug
0 likes91 views
This document summarizes a study characterizing multidrug resistant carbapenemase-producing Escherichia coli and Klebsiella pneumoniae isolates from patients with urinary tract infections. Thirty-four isolates (20 E. coli and 14 K. pneumoniae) were tested for carbapenemase production phenotypically and genotypically. The blaOXA-48 gene was detected in 5 E. coli isolates and 3 K. pneumoniae isolates. Additionally, 5 K. pneumoniae isolates were positive for the blaIMP gene. The detection of carbapenemase genes in these clinical isolates provides important information for clinicians when selecting appropriate antimicrobial treatment for urinary tract infections.
Characterization of Multidrug
- 1. ISSN: 0974-2115 www.jchps.com Journal of Chemical and Pharmaceutical Sciences July - September 20161116JCPS Volume 9 Issue 3 Characterization of Multidrug Resistant Carbapenemases-Producing Escherichia coli and Klebsiella pneumoniae Isolates from Urinary Tract Infection Anwar Ali Abdulla1 , Hussein Oleiwi Muttaleb Al-Dahmoshi1 *, Thikra A. Abed1 , Wurood Hamzah Muttaleb2 1 Department of Biology-College of Sciences, Babylon University, Iraq. 2 Department of Biology-College of Sciences for Women, Babylon University, Iraq. *Corresponding author: E-Mail: dr.dahmoshi@yahoo.com, Mobile: 009647808530088 ABSTRACT ß-lactamases that hydrolyze ß-lactam antibiotics including carbapenems are called carbapenemases, which are either chromosomally or plasmid-encoded. The most prevalent enzymes in Enterobacteriaceae are KPC, VIM, IMP, NDM-1 and OXA-48. The present study was focused on isolation and characterization of Escherichia coli and Klebsiella pneumoniae from urinary tract infection and the detection of carbapenmase (KPC, MBL and OXA- 48) in the tested isolates. A total of 87 urine sample were obtained and cultured. Thirty four isolates of Gram negative bacilli including 20 E. coli and 14 K.pneumoniae isolates were recovered and tested for carbapenemases production. Phenotypic detection confirmed by Rosco discs while, genotypic detection was based on PCR using specific primers for bla-IMP and bla-OXA-48. The bla OXA-48 genes was detected in 5(25%), of the 20E. coli isolates, 20 E. coli isolates did not contain blaIMP gene. While 5(35.7%) and 3 (21.4%) of the K.pneumoniae isolates were positive for bla-IMP genes and blaOXA-48 genes respectively. Conclusion: The detection of carbapenemase genes in clinical isolates of K. pneumoniae and E. coli isolates with UTI should provide impetus to clinicians in consideration of appropriate antimicrobial treatment of UTI caused by E. coli and K. pneumoniae. KEY WORDS: carbapenems, Multidrug Resistant, UTI, Enterobacteriacea. 1. INTRODUCTION Urinary tract infection (UTI) is an important worldwide public health problem. Among the most important causes of UTIs are the Gram negative bacteria that belong to Enterobacteriacea family specially Escherichia coli, which account for as much as 80% of community acquired UTIs. The continuous emergence of resistance to antimicrobial agents among the prevalent pathogens is the most dangerous threat for the treatment of infectious disease. The production of ß-lactamases is the major mechanism of bacterial resistance to ß-lactam antibiotics which considered to be the most widely used class of antibiotics (Thomson, 2010). Carbapenemases belong to the molecular class A, B, and D β-lactamases. Class A and D enzymes have a serine-based hydrolytic mechanism for cleaving the β-lactam ring in antibiotics. Metallo β-lactamases (MBLs), on the other hand, are class B carbapenamases containing zinc at its active site (Ambler, 1980). Mechanisms of resistance to carbapenems include production of β-lactamases, efflux pumps, and mutations that alter the expression and/or function of porins and PBPs. Combinations of these mechanisms can cause high levels of resistance to carbapenems in bacteria such as K. pneumoniae, P. aeruginosa, and A. baumannii (Canton, 2012). The aim of the present study was to check for the prevalence of carbapenamases production in K. pneumonia and E.coli isolates from UTI patients. 2. MATERIALS AND METHODS Isolation of Bacteria: Urine samples from 87 patients with UTI were collected from Hilla Teaching hospital, Childhood and gynecology hospital during April 2015- October 2015. The cultured samples yielded thirty four isolates of Gram negative bacilli including 20 E.coli isolates and 14 Klebsiellapneumonia isolates. The isolation and identification of isolates were performed by standard bacteriological test (Forbes, 2007) and API-20 E assay. These isolates were tested for carbapenemases production. Phenotypic Detection of Carbapenemases: Detection of carbapenemases (KPC, MBL and OXA- 48): Tested isolates were sub-cultured in brain heart infusion broth and a suspension of 0.5 McFarland density was used to seed- inoculate Mueller Hinton agar plates (Himedia, India). After the incubated plates were left to dry for a short time, Rosco discs were applied and the plates were incubated at 35°C for 18-24 hours in ambient air incubator. After 24 hours of incubation, Zones of growth inhibition around Rosco discs zone sizes were recorded and differences in zone sizes were interpreted according to the manufacturer’s instructions (ROSCO Diagnostica, Denmark) as shown in table 1.
- 2. ISSN: 0974-2115 www.jchps.com Journal of Chemical and Pharmaceutical Sciences July - September 20161117JCPS Volume 9 Issue 3 Table.1. Rosco KPC/ metallo- beta- lactmase and OXA- 48 confirm kit interpretation as recommended by manufacturer based on increase in zone of inhibition compared to meropenem 10µg diffusion disc. MRPDP MRPCX MRPBO TEMO Result ≤ 3 ≥ 5 ≥ 4 AMPC ≥ 5 ≤ 3 ≤ 4 MBL ≤ 3 ≤ 3 ≥ 4 KPC ≤ 3 ≤ 3 ≥ 4 Ø OXA-48 ≤ 3 ≤ 3 ≤ 3 ESBL MRPDP: meropenem+dipidinic acid; MRPCX: meropenem+cloxacillin; MRPBO: meropenem+phenylboronic; TEMO: temocillin. Detection of blaGenes by Polymerase Chain Reaction: DNA Extraction: Genomic DNA of bacteria isolates were isolated according to Gentrapuregene Bact. /kit (Qiagen/USA). Concentrations of DNA were measured by using Nano Drop-spectrophotometer. Primer Preparation: The primers were synthesized at Accu Oligo / Bioneer /Korea. These primers were provided in a lyophilized form, which were re-dissolved with TE buffer (pH 8) or sterile distilled water to a final concentration of 100 picomoles, and stored at -20°C. Primer Sequence: The primer sequence for bla genes is showed in table 2. Table.2.The sequence and product size of forward and reverse primers used for amplification bla genes Primer Name 5' – Sequence - 3' Product size Reference bla-OXA-48(F) GCGTGGTTAAGGATGAACAC 438 bp Poirelet, 2011 bla-OXA-48(R) CATCAAGTTCAACCCAACCG bla-IMP(F) GAAGGCGTTTATGTTCATAC 587 bp Pitoutet, 2005bla-IMP(R) GTACGTTTCAAGAGTGATGC PCR Conditions: The PCR reaction was performed in a total volum 30 μl containg 10 p mole/μl of each primer, 2x Taq PCR pre-mix (Sol Gent 2x Taq PCR Pre Mix, Sol Gent Co., Ltd.), and 200ng genomic DNA. The reaction mixture was amplified in a GTC thermal cycler (Cleaver Scientific, UK) .To detect blagenes (bla-OXA-48 and bla- IMP) a PCR program was followed as summarized in table 3. Table.3.PCR conditions Monoplex gene C)/ Time0 Temperature ( # of cycle Initial denaturation Cycling condition Final extensiondenaturation annealing extension bla-OXA-48 95/ 5 min 95/45 sec 60/45 sec 72/1 min 72/ 8 min 35 bla-IMP 95/ 5 min 95/45 sec 60/45 sec 72/1 min 72/ 8 min 35 Gel Electrophoresis: The amplified PCR products were checked for the expected size on 2% (w/v) agarose gel and visualized after staining with ethidium bromide under ultraviolet exposure. A DNA molecular weight marker (Gene aid/ Korea) was used to estimate the weight of the fragments (Sambrook, 2001). 3. RESULTS AND DISCUSSION Thirty four isolates collected from midstream urine samples of 87 uncomplicated UTIs patients were identified by using cultural, morphological, and biochemical tests. The isolates included 20 E.coli and 14 Klebsiella pneumoniae. These isolates were tested for the production of carbapenemase using Rosco discs Fig.1. Figure.1.A represent positive results while B represent negative results In PCR experiments using specific primers for bla IMP and bla-OXA-48,the bla OXA-48 genes was detected in 5(25%) of the E. coli isolates Figure 2. While 3 (21.4%) and 5 (35.7%) of the K. pneumonia isolates were positive for bla OXA-48 andbla-IMP genes respectively Figure 3 and Figure 4.
- 3. ISSN: 0974-2115 www.jchps.com Journal of Chemical and Pharmaceutical Sciences July - September 20161118JCPS Volume 9 Issue 3 Figure.2. Electrophoresis of E. coli for detection of blaOXA-48 gene (438 bp) using 1% agarose for 1 hour at 70 volt. Figure.3. Electrophoresis of Klebsiella pneumonia for detection of bla OXA-48 gene (438 bp) using 1% agarose 1 hour at 70 volt Figure.4. Electrophoresis ofKlebsiella pneumonia for detection ofbla-IMP gene(587 bp) using 1% agarose1 hour at 70 volt In the present study, 34 isolates from patients with UTI, including 20 E. coli and 14 K. pneumonae were screened for carbapenemase production by Rosco discs and PCR assay. The results revealed that out of the thirty four clinical isolets, 20 E. coli isolates did not contain blaIMP gene, neither did 2 K. pneumonia isolates have blaIMP gene. However, blaOXA-48 like genes, were detected in 5 E. coli isolates and 3 K. pneumonia isolates. A single K. pneumonia isolate (E9) was positive for both of blaIMP, blaOXA-48 like and screen tests as shown in table 4. Carbapenems belong to the β-lactam group of antibacterial agents that consists of (imipenem, meropenem, doripenem, ertapenem, panipenem and biapenem). Emergence of carbapenemases in Enterobacteriaceae and nonfermentative bacteria poses a serious therapeutic problem in hospitals because carbapenems are often the antibiotics of last resort for the treatment of serious infections caused by multidrug-resistant Gram-negative bacteria. These bacteria have the potential to spread rapidly within the hospital environment and also across the continents (Nagaraj 2012). β-lactam antibiotics, particularly the third generation cephalosporins, are the most important drug class used to treat serious community-acquired or nosocomial infections caused by E. coli (Pitout, 2012). It is argued that the main reservoirs of OXA-48-harbouring K. pneumonia and E. coli are in the countries of North African and Turkey (Nordmann and Poirel, 2014). The successful spread linked to a single self-conjugative of blaOXA-48 is 62 kb IncL/ M plasmid which was so far only identified in Enterobacteriaceae (Poirel, 2012). More recently, a chromosomal location of bla OXA-48 was reported from isolates in the UK, France, Egypt, Lebanon and Switzerland (Beyrouthy, 2014), it was noticed in fowl not only among humans (Al Bayssari, 2015). Philippon (1994), reported the comparison between ESBL producing strains and non ESBL producers reporting showed that ESBL- producers were significantly more resistant to cephalosporins, quinolones, aminosides, trimethoprim/sulfamethoxazole and amoxicillin/clavulanic acid than non-ESBL methods. The genes encoding ESBLs are normally located in transferable plasmids that may also show other resistance determinants, such as those prevent to chloramphenicol, trimethoprim, sulphamides, aminoglycosides, tetracyclines, and quinolones.
- 4. ISSN: 0974-2115 www.jchps.com Journal of Chemical and Pharmaceutical Sciences July - September 20161119JCPS Volume 9 Issue 3 Table.4.Screened for Carbapenemase production by Rosco discs and PCR assay Isolates blaIMP blaOXA-48 like Isolates blaIMP blaOXA-48 like Screen test PCR Screen test PCR Screen test PCR Screen test PCR E1 Negative Negative Positive Positive E18 Negative Negative Negative Negative E2 Negative Negative Positive Positive E19 Negative Negative Negative Negative E3 Negative Negative Positive Positive E20 Negative Negative Negative Negative E4 Negative Negative Negative Negative K1 Negative Negative Negative Negative E5 Negative Negative Negative Negative K2 Positive Negative Negative Negative E6 Negative Negative Positive Positive K3 Positive Positive Negative Negative E7 Negative Negative Negative Negative K4 Negative Negative Negative Negative E8 Negative Negative Positive Positive K5 Negative Negative Negative Negative E9 Positive Negative Negative Negative K6 Negative Negative Positive Positive E10 Negative Negative Negative Negative K7 Negative Negative Negative Negative E11 Negative Negative Negative Negative K8 Negative Negative Positive Positive E12 Negative Negative Negative Negative K9 Positive Positive Positive Positive E13 Negative Negative Negative Negative K10 Negative Positive Negative Negative E14 Negative Negative Negative Negative K11 Negative Positive Negative Negative E15 Negative Negative Positive Negative K12 Negative Positive Negative Negative E16 Negative Negative Negative Negative K13 Positive Negative Negative Negative E17 Negative Negative Positive Negative K14 Negative Negative Negative Negative 4. CONCLUSION Carbapenemase genes in clinical isolates of K. pneumoniae and E. coli from urine of UTI patients should provide impetus to clinicians in consideration of appropriate antimicrobial treatment of UTI caused by E. coli and K. pneumonia. REFERENCES Algubili AM, Alrobayi EM, and Alkaim AF, Photocatalytic degradation of remazol brilliant blue dye by ZnO/UV process, International Journal of Chemical Sciences, 13(2), 2015, 911-921. Al-Gubury HY, Fairooz NY, Aljeboree AM, Alqaraguly MB, and Alkaim AF, Photcatalytic Degradation n- Undecane using Coupled ZnO-Co2O3, Int. J. Chem. Sci., 13(2), 2015, 863-874. Al-Khafaji NSK, Shareef HK, and Al-Dahmoshi HOM, Analysis of β-lactamases among multi drug resistant Klebsiella pneumoniae in Hilla city-Iraq, Research Journal of Pharmaceutical, Biological and Chemical Sciences, 6(4), 2015, 903-907. Alqaragully MB, AL-Gubury HY, Aljeboree AM, Karam FF, and Alkaim A.F, Monoethanolamine: Production Plant, Research Journal of Pharmaceutical, Biological and Chemical Sciences, 6(5), 2015, 1287-1296. Ambler R.P, The structure of betalactamases, Philos Trans R Soc Lond BBiol Sci., 289(1036), 1980, 321-31. Bayssari C, Olaitan AO, Dabboussi F, Hamze M, Rolain JM, Emergence of OXA-48-producing Escherichia coli clone ST38 in fowl, Antimicrob Agents Chemother., 59, 2015, 745–6. Beyrouthy R, Robin F, Dabboussi F, Mallat H, Hamze M, Bonnet R, Carbapenemase and virulence factors of Enterobacteriaceae in North Lebanon between 2008 and 2012: evolution via endemic spread of OXA-48, J Antimicrob Chemother., 69, 2014, 2699–705. Canton R, Akova M, Carmeli Y, Giske CG, Glupczynski Y, Gniadowski M, Rapid evolution and spread of carbapenemases among Enterobacteriaceae in Europe, Clin Microbiol Infect., 18, 2012, 413–31. Forbes BA, Sahm DF, and Weissfeld A.S, Bailey and Scott's Diagnostic Microbiology, Internat 12th Edition, Mosby, U.S.A, 2007. Jafar NN, Al-Dahmoshi HOM, Jeburalmamoori AM, Al-Khafajii NSK, and Al-Masoudi N, Synthesis and biological activity of new derivatives of 6-chloro-5-((4-chlorophenyl)diazenyl)pyrimidine-2,4-diamine and 4-chloro-6- methoxy-N,N-dimethylpyrimidin-2-amine, Biomedical and Pharmacology Journal, 6(2), 2013, 453-465. Nagaraj S, Chandran SP, Shamanna P, Macaden R, Carbapenem resistance among Escherichia coli and Klebsiellapneumoniae in a tertiary care hospital in south India, Indian J Med Microbiol, 30, 2012, 93-5.
- 5. ISSN: 0974-2115 www.jchps.com Journal of Chemical and Pharmaceutical Sciences July - September 20161120JCPS Volume 9 Issue 3 Nordmann P, Poirel L, The difficult-to-control spread of carbapenemase producers among Enterobacteriaceae worldwide, Clin Microbiol Infect., 20, 2014, 821–30. Philippon A, Arlet G, Lagrange PH, Origin and impact of plasmid-mediated extended-spectrum beta-lactamases, Eur J Clin Microbiol Infect Dis., 13 (Suppl 1), 1994, S17–29. Pitout JD, Detection of Pseudomonas aeruginosa producing metallo-beta-lactamases in a large centralized laboratory, J. Clin. Microbiol. 43, 2005, 3129 –3135. Pitout J.D.D, Extra intestinal Pathogenic Escherichia coli: a Combination of Virulence with Antibiotic Resistance, Frontiers Microbiol, 3.9, 2012. Poirel L, Potron A, Nordmann P, OXA-48-like carbapenemases: the phantom menace, J Antimicrob Chemother, 67, 2012, 1597–606. Poirel L, Walsh T.R, Cuvillier V, and Nordmann P, Multiplex PCR for detection of acquired carbapenemase genes, Diagn. Microbiol. Infect. Dis., 70, 2011, 119 –123. Sambrook J, and Russell D, Molecular cloning: A laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2001. Thomson KS, Extended-spectrum-beta-lactamase, Amp C, and Carbapenemase issues, J ClinMicrobiol, 48, 2010, 1019-25.