SlideShare a Scribd company logo
DATA MINING
LECTURE 1
Introduction
What is data mining?
• After years of data mining there is still no unique
answer to this question.
• A tentative definition:
Data mining is the use of efficient techniques for
the analysis of very large collections of data and the
extraction of useful and possibly unexpected
patterns in data.
Why do we need data mining?
• Really, really huge amounts of raw data!!
• In the digital age, TB of data is generated by the second
• Mobile devices, digital photographs, web documents.
• Facebook updates, Tweets, Blogs, User-generated content
• Transactions, sensor data, surveillance data
• Queries, clicks, browsing
• Cheap storage has made possible to maintain this data
• Need to analyze the raw data to extract
knowledge
Why do we need data mining?
• “The data is the computer”
• Large amounts of data can be more powerful than complex
algorithms and models
• Google has solved many Natural Language Processing problems,
simply by looking at the data
• Example: misspellings, synonyms
• Data is power!
• Today, the collected data is one of the biggest assets of an online
company
• Query logs of Google
• The friendship and updates of Facebook
• Tweets and follows of Twitter
• Amazon transactions
• We need a way to harness the collective intelligence
The data is also very complex
• Multiple types of data: tables, time series,
images, graphs, etc
• Spatial and temporal aspects
• Interconnected data of different types:
• From the mobile phone we can collect, location of the
user, friendship information, check-ins to venues,
opinions through twitter, images though cameras,
queries to search engines
Example: transaction data
• Billions of real-life customers:
• WALMART: 20M transactions per day
• AT&T 300 M calls per day
• Credit card companies: billions of transactions per day.
• The point cards allow companies to collect
information about specific users
Example: document data
• Web as a document repository: estimated 50
billions of web pages
• Wikipedia: 4 million articles (and counting)
• Online news portals: steady stream of 100’s of
new articles every day
• Twitter: ~300 million tweets every day
Example: network data
• Web: 50 billion pages linked via hyperlinks
• Facebook: 500 million users
• Twitter: 300 million users
• Instant messenger: ~1billion users
• Blogs: 250 million blogs worldwide, presidential
candidates run blogs
Example: genomic sequences
• http://www.1000genomes.org/page.php
• Full sequence of 1000 individuals
• 3*109
nucleotides per person  3*1012
nucleotides
• Lots more data in fact: medical history of the
persons, gene expression data
Example: environmental data
• Climate data (just an example)
http://www.ncdc.gov/oa/climate/ghcn-monthly/index.php
• “a database of temperature, precipitation and
pressure records managed by the National Climatic
Data Center, Arizona State University and the
Carbon Dioxide Information Analysis Center”
• “6000 temperature stations, 7500 precipitation
stations, 2000 pressure stations”
• Spatiotemporal data
Behavioral data
• Mobile phones today record a large amount of information about the user
behavior
• GPS records position
• Camera produces images
• Communication via phone and SMS
• Text via facebook updates
• Association with entities via check-ins
• Amazon collects all the items that you browsed, placed into your basket,
read reviews about, purchased.
• Google and Bing record all your browsing activity via toolbar plugins. They
also record the queries you asked, the pages you saw and the clicks you
did.
• Data collected for millions of users on a daily basis
So, what is Data?
• Collection of data objects and
their attributes
• An attribute is a property or
characteristic of an object
• Examples: eye color of a person,
temperature, etc.
• Attribute is also known as
variable, field, characteristic, or
feature
• A collection of attributes
describe an object
• Object is also known as record,
point, case, sample, entity, or
instance
Tid Refund Marital
Status
Taxable
Income Cheat
1 Yes Single 125K No
2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10
Attributes
Objects
Size: Number of objects
Dimensionality: Number of attributes
Sparsity: Number of populated
object-attribute pairs
Types of Attributes
• There are different types of attributes
• Categorical
• Examples: eye color, zip codes, words, rankings (e.g, good,
fair, bad), height in {tall, medium, short}
• Nominal (no order or comparison) vs Ordinal (order but not
comparable)
• Numeric
• Examples: dates, temperature, time, length, value, count.
• Discrete (counts) vs Continuous (temperature)
• Special case: Binary attributes (yes/no, exists/not exists)
Numeric Record Data
• If data objects have the same fixed set of numeric
attributes, then the data objects can be thought of as
points in a multi-dimensional space, where each
dimension represents a distinct attribute
• Such data set can be represented by an n-by-d data
matrix, where there are n rows, one for each object, and d
columns, one for each attribute
1.1
2.2
16.22
6.25
12.65
1.2
2.7
15.22
5.27
10.23
Thickness
Load
Distance
Projection
of y load
Projection
of x Load
1.1
2.2
16.22
6.25
12.65
1.2
2.7
15.22
5.27
10.23
Thickness
Load
Distance
Projection
of y load
Projection
of x Load
Categorical Data
• Data that consists of a collection of records, each
of which consists of a fixed set of categorical
attributes
Tid Refund Marital
Status
Taxable
Income Cheat
1 Yes Single High No
2 No Married Medium No
3 No Single Low No
4 Yes Married High No
5 No Divorced Medium Yes
6 No Married Low No
7 Yes Divorced High No
8 No Single Medium Yes
9 No Married Medium No
10 No Single Medium Yes
10
Document Data
• Each document becomes a `term' vector,
• each term is a component (attribute) of the vector,
• the value of each component is the number of times the
corresponding term occurs in the document.
• Bag-of-words representation – no ordering
Document 1
season
timeout
lost
wi
n
game
score
ball
pla
y
coach
team
Document 2
Document 3
3 0 5 0 2 6 0 2 0 2
0
0
7 0 2 1 0 0 3 0 0
1 0 0 1 2 2 0 3 0
Transaction Data
• Each record (transaction) is a set of items.
• A set of items can also be represented as a binary
vector, where each attribute is an item.
• A document can also be represented as a set of words
(no counts)
TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk
Sparsity: average number of products bought by a customer
Ordered Data
• Genomic sequence data
• Data is a long ordered string
GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG
Ordered Data
• Time series
• Sequence of ordered (over “time”) numeric values.
Graph Data
• Examples: Web graph and HTML Links
5
2
1
2
5
<a href="papers/papers.html#bbbb">
Data Mining </a>
<li>
<a href="papers/papers.html#aaaa">
Graph Partitioning </a>
<li>
<a href="papers/papers.html#aaaa">
Parallel Solution of Sparse Linear System of Equations </a>
<li>
<a href="papers/papers.html#ffff">
N-Body Computation and Dense Linear System Solvers
Types of data
• Numeric data: Each object is a point in a
multidimensional space
• Categorical data: Each object is a vector of
categorical values
• Set data: Each object is a set of values (with or
without counts)
• Sets can also be represented as binary vectors, or
vectors of counts
• Ordered sequences: Each object is an ordered
sequence of values.
• Graph data
What can you do with the data?
• Suppose that you are the owner of a supermarket
and you have collected billions of market basket
data. What information would you extract from it
and how would you use it?
• What if this was an online store?
TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk
Product placement
Catalog creation
Recommendations
What can you do with the data?
• Suppose you are a search engine and you have
a toolbar log consisting of
• pages browsed,
• queries,
• pages clicked,
• ads clicked
each with a user id and a timestamp. What
information would you like to get our of the data?
Ad click prediction
Query reformulations
What can you do with the data?
• Suppose you are biologist who has microarray
expression data: thousands of genes, and their
expression values over thousands of different settings
(e.g. tissues). What information would you like to get out
of your data?
Groups of genes and tissues
What can you do with the data?
• Suppose you are a stock broker and you observe
the fluctuations of multiple stocks over time. What
information would you like to get our of your
data?
Clustering of stocks
Correlation of stocks
Stock Value prediction
What can you do with the data?
• You are the owner of a social network, and you
have full access to the social graph, what kind of
information do you want to get out of your graph?
• Who is the most important node in the graph?
• What is the shortest path between two nodes?
• How many friends two nodes have in common?
• How does information spread on the network?
Why data mining?
• Commercial point of view
• Data has become the key competitive advantage of companies
• Examples: Facebook, Google, Amazon
• Being able to extract useful information out of the data is key for exploiting
them commercially.
• Scientific point of view
• Scientists are at an unprecedented position where they can collect TB of
information
• Examples: Sensor data, astronomy data, social network data, gene data
• We need the tools to analyze such data to get a better understanding of the
world and advance science
• Scale (in data size and feature dimension)
• Why not use traditional analytic methods?
• Enormity of data, curse of dimensionality
• The amount and the complexity of data does not allow for manual processing
of the data. We need automated techniques.
What is Data Mining again?
• “Data mining is the analysis of (often large)
observational data sets to find unsuspected relationships
and to summarize the data in novel ways that are both
understandable and useful to the data analyst” (Hand,
Mannila, Smyth)
• “Data mining is the discovery of models for data”
(Rajaraman, Ullman)
• We can have the following types of models
• Models that explain the data (e.g., a single function)
• Models that predict the future data instances.
• Models that summarize the data
• Models the extract the most prominent features of the data.
What can we do with data mining?
• Some examples:
• Frequent itemsets and Association Rules extraction
• Coverage
• Clustering
• Classification
• Ranking
• Exploratory analysis
Frequent Itemsets and Association Rules
• Given a set of records each of which contain some
number of items from a given collection;
• Identify sets of items (itemsets) occurring frequently
together
• Produce dependency rules which will predict occurrence
of an item based on occurrences of other items.
TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk
Rules Discovered:
{Milk} --> {Coke}
{Diaper, Milk} --> {Beer}
Itemsets Discovered:
{Milk,Coke}
{Diaper, Milk}
Tan, M. Steinbach and V. Kumar, Introduction to Data Mining
Frequent Itemsets: Applications
• Text mining: finding associated phrases in text
• There are lots of documents that contain the phrases
“association rules”, “data mining” and “efficient
algorithm”
• Recommendations:
• Users who buy this item often buy this item as well
• Users who watched James Bond movies, also watched
Jason Bourne movies.
• Recommendations make use of item and user similarity
Association Rule Discovery: Application
• Supermarket shelf management.
• Goal: To identify items that are bought together by
sufficiently many customers.
• Approach: Process the point-of-sale data collected
with barcode scanners to find dependencies among
items.
• A classic rule --
• If a customer buys diaper and milk, then he is very likely to
buy beer.
• So, don’t be surprised if you find six-packs stacked next to
diapers!
Tan, M. Steinbach and V. Kumar, Introduction to Data Mining
Clustering Definition
• Given a set of data points, each having a set of
attributes, and a similarity measure among them,
find clusters such that
• Data points in one cluster are more similar to one
another.
• Data points in separate clusters are less similar to
one another.
• Similarity Measures?
• Euclidean Distance if attributes are continuous.
• Other Problem-specific Measures.
Tan, M. Steinbach and V. Kumar, Introduction to Data Mining
Illustrating Clustering
Euclidean Distance Based Clustering in 3-D space.
Intracluster distances
are minimized
Intercluster distances
are maximized
Tan, M. Steinbach and V. Kumar, Introduction to Data Mining
Clustering: Application 1
• Bioinformatics applications:
• Goal: Group genes and tissues together such that genes are
coexpressed on the same tissues
Clustering: Application 2
• Document Clustering:
• Goal: To find groups of documents that are similar to
each other based on the important terms appearing in
them.
• Approach: To identify frequently occurring terms in
each document. Form a similarity measure based on
the frequencies of different terms. Use it to cluster.
• Gain: Information Retrieval can utilize the clusters to
relate a new document or search term to clustered
documents.
Tan, M. Steinbach and V. Kumar, Introduction to Data Mining
Clustering of S&P 500 Stock Data
Discovered Clusters Industry Group
1
Applied-Matl-DOWN,Bay-Network-Down,3-COM-DOWN,
Cabletron-Sys-DOWN,CISCO-DOWN,HP-DOWN,
DSC-Comm-DOWN,INTEL-DOWN,LSI-Logic-DOWN,
Micron-Tech-DOWN,Texas-Inst-Down,Tellabs-Inc-Down,
Natl-Semiconduct-DOWN,Oracl-DOWN,SGI-DOWN,
Sun-DOWN
Technology1-DOWN
2
Apple-Comp-DOWN,Autodesk-DOWN,DEC-DOWN,
ADV-Micro-Device-DOWN,Andrew-Corp-DOWN,
Computer-Assoc-DOWN,Circuit-City-DOWN,
Compaq-DOWN, EMC-Corp-DOWN, Gen-Inst-DOWN,
Motorola-DOWN,Microsoft-DOWN,Scientific-Atl-DOWN
Technology2-DOWN
3
Fannie-Mae-DOWN,Fed-Home-Loan-DOWN,
MBNA-Corp-DOWN,Morgan-Stanley-DOWN Financial-DOWN
4
Baker-Hughes-UP,Dresser-Inds-UP,Halliburton-HLD-UP,
Louisiana-Land-UP,Phillips-Petro-UP,Unocal-UP,
Schlumberger-UP
Oil-UP
• Observe Stock Movements every day.
• Cluster stocks if they change similarly over time.
Tan, M. Steinbach and V. Kumar, Introduction to Data Mining
Coverage
• Given a set of customers and items and the
transaction relationship between the two, select a
small set of items that “covers” all users.
• For each user there is at least one item in the set that
the user has bought.
• Application:
• Create a catalog to send out that has at least one item
of interest for every customer.
Classification: Definition
• Given a collection of records (training set )
• Each record contains a set of attributes, one of the
attributes is the class.
• Find a model for class attribute as a function of
the values of other attributes.
• Goal: previously unseen records should be
assigned a class as accurately as possible.
• A test set is used to determine the accuracy of the
model. Usually, the given data set is divided into
training and test sets, with training set used to build the
model and test set used to validate it.
Classification Example
Tid Refund Marital
Status
Taxable
Income Cheat
1 Yes Single 125K No
2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10
categorical
categorical
continuous
class
Refund Marital
Status
Taxable
Income Cheat
No Single 75K ?
Yes Married 50K ?
No Married 150K ?
Yes Divorced 90K ?
No Single 40K ?
No Married 80K ?
10
Test
Set
Training
Set
Model
Learn
Classifier
Tan, M. Steinbach and V. Kumar, Introduction to Data Mining
Classification: Application 1
• Ad Click Prediction
• Goal: Predict if a user that visits a web page will click
on a displayed ad. Use it to target users with high
click probability.
• Approach:
• Collect data for users over a period of time and record who
clicks and who does not. The {click, no click} information
forms the class attribute.
• Use the history of the user (web pages browsed, queries
issued) as the features.
• Learn a classifier model and test on new users.
Classification: Application 2
• Fraud Detection
• Goal: Predict fraudulent cases in credit card
transactions.
• Approach:
• Use credit card transactions and the information on its
account-holder as attributes.
• When does a customer buy, what does he buy, how often he pays on
time, etc
• Label past transactions as fraud or fair transactions. This
forms the class attribute.
• Learn a model for the class of the transactions.
• Use this model to detect fraud by observing credit card
transactions on an account.
Tan, M. Steinbach and V. Kumar, Introduction to Data Mining
Link Analysis Ranking
• Given a collection of web pages that are linked to
each other, rank the pages according to
importance (authoritativeness) in the graph
• Intuition: A page gains authority if it is linked to by
another page.
• Application: When retrieving pages, the
authoritativeness is factored in the ranking.
Exploratory Analysis
• Trying to understand the data as a physical
phenomenon, and describe them with simple metrics
• What does the web graph look like?
• How often do people repeat the same query?
• Are friends in facebook also friends in twitter?
• The important thing is to find the right metrics and
ask the right questions
• It helps our understanding of the world, and can lead
to models of the phenomena we observe.
Exploratory Analysis: The Web
• What is the structure and the properties of the
web?
Exploratory Analysis: The Web
• What is the distribution of the incoming links?
• Draws ideas from machine learning/AI, pattern
recognition, statistics, and database systems
• Traditional Techniques
may be unsuitable due to
• Enormity of data
• High dimensionality
of data
• Heterogeneous,
distributed nature
of data
• Emphasis on the use of data
Connections of Data Mining with other areas
Machine Learning/
Pattern
Recognition
Statistics/
AI
Data Mining
Database
systems
Tan, M. Steinbach and V. Kumar, Introduction to Data Mining
48
Cultures
• Databases: concentrate on large-scale (non-
main-memory) data.
• AI (machine-learning): concentrate on complex
methods, small data.
• In today’s world data is more important than algorithms
• Statistics: concentrate on models.
CS345A Data Mining on the Web: Anand Rajaraman, Jeff Ullman
49
Models vs. Analytic Processing
• To a database person, data-mining is an
extreme form of analytic processing – queries
that examine large amounts of data.
• Result is the query answer.
• To a statistician, data-mining is the inference
of models.
• Result is the parameters of the model.
CS345A Data Mining on the Web: Anand Rajaraman, Jeff Ullman
50
(Way too Simple) Example
• Given a billion numbers, a DB person would
compute their average and standard deviation.
• A statistician might fit the billion points to the best
Gaussian distribution and report the mean and
standard deviation of that distribution.
CS345A Data Mining on the Web: Anand Rajaraman, Jeff Ullman
Data Mining: Confluence of Multiple Disciplines
Data Mining
Database
Technology Statistics
Machine
Learning
Pattern
Recognition
Algorithm
Other
Disciplines
Visualization
Data Mining: Confluence of Multiple Disciplines
Data Mining
Database
Technology Statistics
Machine
Learning
Pattern
Recognition
Algorithm
Other
Disciplines
Visualization
Data Mining: Confluence of Multiple Disciplines
Data Mining
Database
Technology Statistics
Machine
Learning
Pattern
Recognition
Algorithm
Distributed
Computing
Visualization
Single-node architecture
Memory
Disk
CPU
Machine Learning, Statistics
“Classical” Data Mining
Commodity Clusters
• Web data sets can be very large
• Tens to hundreds of terabytes
• Cannot mine on a single server
• Standard architecture emerging:
• Cluster of commodity Linux nodes, Gigabit ethernet interconnect
• Google GFS; Hadoop HDFS; Kosmix KFS
• Typical usage pattern
• Huge files (100s of GB to TB)
• Data is rarely updated in place
• Reads and appends are common
• How to organize computations on this architecture?
• Map-Reduce paradigm
Cluster Architecture
Mem
Disk
CPU
Mem
Disk
CPU
…
Switch
Each rack contains 16-64 nodes
Mem
Disk
CPU
Mem
Disk
CPU
…
Switch
Switch
1 Gbps between
any pair of nodes
in a rack
2-10 Gbps backbone between racks
Map-Reduce paradigm
• Map the data into key-value pairs
• E.g., map a document to word-count pairs
• Group by key
• Group all pairs of the same word, with lists of counts
• Reduce by aggregating
• E.g. sum all the counts to produce the total count.
The data analysis pipeline
• Mining is not the only step in the analysis process
• Preprocessing: real data is noisy, incomplete and inconsistent. Data
cleaning is required to make sense of the data
• Techniques: Sampling, Dimensionality Reduction, Feature selection.
• A dirty work, but it is often the most important step for the analysis.
• Post-Processing: Make the data actionable and useful to the user
• Statistical analysis of importance
• Visualization.
• Pre- and Post-processing are often data mining tasks as well
Data
Preprocessing
Data Mining
Result
Post-processing
Data Quality
• Examples of data quality problems:
• Noise and outliers
• missing values
• duplicate data
Sampling
• Sampling is the main technique employed for data
selection.
• It is often used for both the preliminary investigation of the data
and the final data analysis.
• Statisticians sample because obtaining the entire set of
data of interest is too expensive or time consuming.
• Sampling is used in data mining because processing
the entire set of data of interest is too expensive or
time consuming.
Sampling …
• The key principle for effective sampling is the
following:
• using a sample will work almost as well as using the
entire data sets, if the sample is representative
• A sample is representative if it has approximately the
same property (of interest) as the original set of data
Types of Sampling
• Simple Random Sampling
• There is an equal probability of selecting any particular item
• Sampling without replacement
• As each item is selected, it is removed from the population
• Sampling with replacement
• Objects are not removed from the population as they are selected for the
sample.
• In sampling with replacement, the same object can be picked up more than
once
• Stratified sampling
• Split the data into several partitions; then draw random samples from
each partition
Sample Size
8000 points 2000 Points 500 Points
Sample Size
• What sample size is necessary to get at least one
object from each of 10 groups.
A data mining challenge
• You are reading a stream of integers, and you want to
sample one integer uniformly at random but you do not
know the size (N) of the stream in advance. You can
only keep a constant amount of integers in memory
• How do you sample?
• Hint: the last integer in the stream should have probability 1/N
to be selected.
• Reservoir Sampling:
• Standard interview question
66
Meaningfulness of Answers
• A big data-mining risk is that you will “discover”
patterns that are meaningless.
• Statisticians call it Bonferroni’s principle:
(roughly) if you look in more places for
interesting patterns than your amount of data
will support, you are bound to find crap.
• The Rhine Paradox: a great example of how
not to conduct scientific research.
67
Rhine Paradox – (1)
• Joseph Rhine was a parapsychologist in the
1950’s who hypothesized that some people had
Extra-Sensory Perception.
• He devised (something like) an experiment where
subjects were asked to guess 10 hidden cards –
red or blue.
• He discovered that almost 1 in 1000 had ESP –
they were able to get all 10 right!
68
Rhine Paradox – (2)
• He told these people they had ESP and called
them in for another test of the same type.
• Alas, he discovered that almost all of them had
lost their ESP.
• What did he conclude?
• Answer on next slide.
69
Rhine Paradox – (3)
• He concluded that you shouldn’t tell people they
have ESP; it causes them to lose it.

More Related Content

PDF
Meet 1 - Introduction Data Mining - Dedi Darwis.pdf
PPTX
Data Mining Lecture_1.pptx
PPTX
Advance Data Mining - Machine Learning -
PPTX
Data analytics introduction
PPTX
Data Analytics All 5 Units_all topics.pptx
PDF
ADV Slides: Graph Databases on the Edge
PPTX
BIG DATA INTRO , bigdata_intro , Hadoop PPT
PPTX
Unit-I- Introduction- Traits of Big Data-Final.pptx
Meet 1 - Introduction Data Mining - Dedi Darwis.pdf
Data Mining Lecture_1.pptx
Advance Data Mining - Machine Learning -
Data analytics introduction
Data Analytics All 5 Units_all topics.pptx
ADV Slides: Graph Databases on the Edge
BIG DATA INTRO , bigdata_intro , Hadoop PPT
Unit-I- Introduction- Traits of Big Data-Final.pptx

Similar to Introduction about Applications of data mining (20)

PDF
01-Introduction.pdf
PDF
Module 2 Data Collection and Management.pdf
PPTX
Chapter 1 Introduction to Data Science (Computing)
PPTX
Big Data Analytics
PPTX
DataONE Education Module 07: Metadata
PDF
Séminaire Big Data Alter Way - Elasticsearch - octobre 2014
PDF
00-01 DSnDA.pdf
PPT
Data mining concept and methods for basic
PPTX
bigdata introduction for students pg msc
PPTX
Big data
PPT
Dma unit 1
PPTX
Dw 07032018-dr pl pradhan
PDF
Fundamentals of data science: digital data
PPTX
Data sciences and marketing analytics
PPTX
Aggahsbsbsbsbsbsbsbsbsbwbshhwhwhwgwhwhwh
PPTX
L07 metadata
PPTX
Big Data, NoSQL, NewSQL & The Future of Data Management
PDF
CS3352-Foundations of Data Science Notes.pdf
PPTX
Introduction to Big Data Analytics
PPTX
Introduction to Big Data
01-Introduction.pdf
Module 2 Data Collection and Management.pdf
Chapter 1 Introduction to Data Science (Computing)
Big Data Analytics
DataONE Education Module 07: Metadata
Séminaire Big Data Alter Way - Elasticsearch - octobre 2014
00-01 DSnDA.pdf
Data mining concept and methods for basic
bigdata introduction for students pg msc
Big data
Dma unit 1
Dw 07032018-dr pl pradhan
Fundamentals of data science: digital data
Data sciences and marketing analytics
Aggahsbsbsbsbsbsbsbsbsbwbshhwhwhwgwhwhwh
L07 metadata
Big Data, NoSQL, NewSQL & The Future of Data Management
CS3352-Foundations of Data Science Notes.pdf
Introduction to Big Data Analytics
Introduction to Big Data
Ad

More from RamaKrishnaErroju (18)

PPSX
Stack-data-structure.ppsxErwewwwrrterewewew
PPT
Fourier-Series SAMPLE PRESENTATION FOR LEARNING
PPT
311introductiontomachinelearning.ppt12345
PPTX
Day17.pptx department of computer science and eng
PPTX
Day15.pptx school of computer science and ai
PPTX
Day3 datamining recent trends and advancements
PPTX
Day2 Applications of datamining using differe
PPTX
Googlecolab1 tutorial for data science practise
PPTX
Data Preprocessing techniques for applications
DOCX
TEXMAKER Overview research plagrism check
DOCX
BioIn_Pap1dramaprevenbtionsakcnnshejjsja
PPTX
PLSQL_cur.pptx presentation uploadtttees
PPT
5261506.ppt
PPTX
CONVERSATION.pptx
PPT
sap-overview.ppt
PPT
PPTX
CONVERSATION.pptx
PPTX
Stack-data-structure.ppsxErwewwwrrterewewew
Fourier-Series SAMPLE PRESENTATION FOR LEARNING
311introductiontomachinelearning.ppt12345
Day17.pptx department of computer science and eng
Day15.pptx school of computer science and ai
Day3 datamining recent trends and advancements
Day2 Applications of datamining using differe
Googlecolab1 tutorial for data science practise
Data Preprocessing techniques for applications
TEXMAKER Overview research plagrism check
BioIn_Pap1dramaprevenbtionsakcnnshejjsja
PLSQL_cur.pptx presentation uploadtttees
5261506.ppt
CONVERSATION.pptx
sap-overview.ppt
CONVERSATION.pptx
Ad

Recently uploaded (20)

PDF
01-Introduction-to-Information-Management.pdf
PDF
RMMM.pdf make it easy to upload and study
PDF
TR - Agricultural Crops Production NC III.pdf
PDF
102 student loan defaulters named and shamed – Is someone you know on the list?
PPTX
Pharma ospi slides which help in ospi learning
PPTX
human mycosis Human fungal infections are called human mycosis..pptx
PPTX
PPH.pptx obstetrics and gynecology in nursing
PPTX
GDM (1) (1).pptx small presentation for students
PDF
The Lost Whites of Pakistan by Jahanzaib Mughal.pdf
PDF
FourierSeries-QuestionsWithAnswers(Part-A).pdf
PDF
ANTIBIOTICS.pptx.pdf………………… xxxxxxxxxxxxx
PPTX
Institutional Correction lecture only . . .
PPTX
Lesson notes of climatology university.
PDF
Microbial disease of the cardiovascular and lymphatic systems
PPTX
Microbial diseases, their pathogenesis and prophylaxis
PDF
Supply Chain Operations Speaking Notes -ICLT Program
PDF
VCE English Exam - Section C Student Revision Booklet
PDF
Saundersa Comprehensive Review for the NCLEX-RN Examination.pdf
PPTX
IMMUNITY IMMUNITY refers to protection against infection, and the immune syst...
PPTX
Renaissance Architecture: A Journey from Faith to Humanism
01-Introduction-to-Information-Management.pdf
RMMM.pdf make it easy to upload and study
TR - Agricultural Crops Production NC III.pdf
102 student loan defaulters named and shamed – Is someone you know on the list?
Pharma ospi slides which help in ospi learning
human mycosis Human fungal infections are called human mycosis..pptx
PPH.pptx obstetrics and gynecology in nursing
GDM (1) (1).pptx small presentation for students
The Lost Whites of Pakistan by Jahanzaib Mughal.pdf
FourierSeries-QuestionsWithAnswers(Part-A).pdf
ANTIBIOTICS.pptx.pdf………………… xxxxxxxxxxxxx
Institutional Correction lecture only . . .
Lesson notes of climatology university.
Microbial disease of the cardiovascular and lymphatic systems
Microbial diseases, their pathogenesis and prophylaxis
Supply Chain Operations Speaking Notes -ICLT Program
VCE English Exam - Section C Student Revision Booklet
Saundersa Comprehensive Review for the NCLEX-RN Examination.pdf
IMMUNITY IMMUNITY refers to protection against infection, and the immune syst...
Renaissance Architecture: A Journey from Faith to Humanism

Introduction about Applications of data mining

  • 2. What is data mining? • After years of data mining there is still no unique answer to this question. • A tentative definition: Data mining is the use of efficient techniques for the analysis of very large collections of data and the extraction of useful and possibly unexpected patterns in data.
  • 3. Why do we need data mining? • Really, really huge amounts of raw data!! • In the digital age, TB of data is generated by the second • Mobile devices, digital photographs, web documents. • Facebook updates, Tweets, Blogs, User-generated content • Transactions, sensor data, surveillance data • Queries, clicks, browsing • Cheap storage has made possible to maintain this data • Need to analyze the raw data to extract knowledge
  • 4. Why do we need data mining? • “The data is the computer” • Large amounts of data can be more powerful than complex algorithms and models • Google has solved many Natural Language Processing problems, simply by looking at the data • Example: misspellings, synonyms • Data is power! • Today, the collected data is one of the biggest assets of an online company • Query logs of Google • The friendship and updates of Facebook • Tweets and follows of Twitter • Amazon transactions • We need a way to harness the collective intelligence
  • 5. The data is also very complex • Multiple types of data: tables, time series, images, graphs, etc • Spatial and temporal aspects • Interconnected data of different types: • From the mobile phone we can collect, location of the user, friendship information, check-ins to venues, opinions through twitter, images though cameras, queries to search engines
  • 6. Example: transaction data • Billions of real-life customers: • WALMART: 20M transactions per day • AT&T 300 M calls per day • Credit card companies: billions of transactions per day. • The point cards allow companies to collect information about specific users
  • 7. Example: document data • Web as a document repository: estimated 50 billions of web pages • Wikipedia: 4 million articles (and counting) • Online news portals: steady stream of 100’s of new articles every day • Twitter: ~300 million tweets every day
  • 8. Example: network data • Web: 50 billion pages linked via hyperlinks • Facebook: 500 million users • Twitter: 300 million users • Instant messenger: ~1billion users • Blogs: 250 million blogs worldwide, presidential candidates run blogs
  • 9. Example: genomic sequences • http://www.1000genomes.org/page.php • Full sequence of 1000 individuals • 3*109 nucleotides per person  3*1012 nucleotides • Lots more data in fact: medical history of the persons, gene expression data
  • 10. Example: environmental data • Climate data (just an example) http://www.ncdc.gov/oa/climate/ghcn-monthly/index.php • “a database of temperature, precipitation and pressure records managed by the National Climatic Data Center, Arizona State University and the Carbon Dioxide Information Analysis Center” • “6000 temperature stations, 7500 precipitation stations, 2000 pressure stations” • Spatiotemporal data
  • 11. Behavioral data • Mobile phones today record a large amount of information about the user behavior • GPS records position • Camera produces images • Communication via phone and SMS • Text via facebook updates • Association with entities via check-ins • Amazon collects all the items that you browsed, placed into your basket, read reviews about, purchased. • Google and Bing record all your browsing activity via toolbar plugins. They also record the queries you asked, the pages you saw and the clicks you did. • Data collected for millions of users on a daily basis
  • 12. So, what is Data? • Collection of data objects and their attributes • An attribute is a property or characteristic of an object • Examples: eye color of a person, temperature, etc. • Attribute is also known as variable, field, characteristic, or feature • A collection of attributes describe an object • Object is also known as record, point, case, sample, entity, or instance Tid Refund Marital Status Taxable Income Cheat 1 Yes Single 125K No 2 No Married 100K No 3 No Single 70K No 4 Yes Married 120K No 5 No Divorced 95K Yes 6 No Married 60K No 7 Yes Divorced 220K No 8 No Single 85K Yes 9 No Married 75K No 10 No Single 90K Yes 10 Attributes Objects Size: Number of objects Dimensionality: Number of attributes Sparsity: Number of populated object-attribute pairs
  • 13. Types of Attributes • There are different types of attributes • Categorical • Examples: eye color, zip codes, words, rankings (e.g, good, fair, bad), height in {tall, medium, short} • Nominal (no order or comparison) vs Ordinal (order but not comparable) • Numeric • Examples: dates, temperature, time, length, value, count. • Discrete (counts) vs Continuous (temperature) • Special case: Binary attributes (yes/no, exists/not exists)
  • 14. Numeric Record Data • If data objects have the same fixed set of numeric attributes, then the data objects can be thought of as points in a multi-dimensional space, where each dimension represents a distinct attribute • Such data set can be represented by an n-by-d data matrix, where there are n rows, one for each object, and d columns, one for each attribute 1.1 2.2 16.22 6.25 12.65 1.2 2.7 15.22 5.27 10.23 Thickness Load Distance Projection of y load Projection of x Load 1.1 2.2 16.22 6.25 12.65 1.2 2.7 15.22 5.27 10.23 Thickness Load Distance Projection of y load Projection of x Load
  • 15. Categorical Data • Data that consists of a collection of records, each of which consists of a fixed set of categorical attributes Tid Refund Marital Status Taxable Income Cheat 1 Yes Single High No 2 No Married Medium No 3 No Single Low No 4 Yes Married High No 5 No Divorced Medium Yes 6 No Married Low No 7 Yes Divorced High No 8 No Single Medium Yes 9 No Married Medium No 10 No Single Medium Yes 10
  • 16. Document Data • Each document becomes a `term' vector, • each term is a component (attribute) of the vector, • the value of each component is the number of times the corresponding term occurs in the document. • Bag-of-words representation – no ordering Document 1 season timeout lost wi n game score ball pla y coach team Document 2 Document 3 3 0 5 0 2 6 0 2 0 2 0 0 7 0 2 1 0 0 3 0 0 1 0 0 1 2 2 0 3 0
  • 17. Transaction Data • Each record (transaction) is a set of items. • A set of items can also be represented as a binary vector, where each attribute is an item. • A document can also be represented as a set of words (no counts) TID Items 1 Bread, Coke, Milk 2 Beer, Bread 3 Beer, Coke, Diaper, Milk 4 Beer, Bread, Diaper, Milk 5 Coke, Diaper, Milk Sparsity: average number of products bought by a customer
  • 18. Ordered Data • Genomic sequence data • Data is a long ordered string GGTTCCGCCTTCAGCCCCGCGCC CGCAGGGCCCGCCCCGCGCCGTC GAGAAGGGCCCGCCTGGCGGGCG GGGGGAGGCGGGGCCGCCCGAGC CCAACCGAGTCCGACCAGGTGCC CCCTCTGCTCGGCCTAGACCTGA GCTCATTAGGCGGCAGCGGACAG GCCAAGTAGAACACGCGAAGCGC TGGGCTGCCTGCTGCGACCAGGG
  • 19. Ordered Data • Time series • Sequence of ordered (over “time”) numeric values.
  • 20. Graph Data • Examples: Web graph and HTML Links 5 2 1 2 5 <a href="papers/papers.html#bbbb"> Data Mining </a> <li> <a href="papers/papers.html#aaaa"> Graph Partitioning </a> <li> <a href="papers/papers.html#aaaa"> Parallel Solution of Sparse Linear System of Equations </a> <li> <a href="papers/papers.html#ffff"> N-Body Computation and Dense Linear System Solvers
  • 21. Types of data • Numeric data: Each object is a point in a multidimensional space • Categorical data: Each object is a vector of categorical values • Set data: Each object is a set of values (with or without counts) • Sets can also be represented as binary vectors, or vectors of counts • Ordered sequences: Each object is an ordered sequence of values. • Graph data
  • 22. What can you do with the data? • Suppose that you are the owner of a supermarket and you have collected billions of market basket data. What information would you extract from it and how would you use it? • What if this was an online store? TID Items 1 Bread, Coke, Milk 2 Beer, Bread 3 Beer, Coke, Diaper, Milk 4 Beer, Bread, Diaper, Milk 5 Coke, Diaper, Milk Product placement Catalog creation Recommendations
  • 23. What can you do with the data? • Suppose you are a search engine and you have a toolbar log consisting of • pages browsed, • queries, • pages clicked, • ads clicked each with a user id and a timestamp. What information would you like to get our of the data? Ad click prediction Query reformulations
  • 24. What can you do with the data? • Suppose you are biologist who has microarray expression data: thousands of genes, and their expression values over thousands of different settings (e.g. tissues). What information would you like to get out of your data? Groups of genes and tissues
  • 25. What can you do with the data? • Suppose you are a stock broker and you observe the fluctuations of multiple stocks over time. What information would you like to get our of your data? Clustering of stocks Correlation of stocks Stock Value prediction
  • 26. What can you do with the data? • You are the owner of a social network, and you have full access to the social graph, what kind of information do you want to get out of your graph? • Who is the most important node in the graph? • What is the shortest path between two nodes? • How many friends two nodes have in common? • How does information spread on the network?
  • 27. Why data mining? • Commercial point of view • Data has become the key competitive advantage of companies • Examples: Facebook, Google, Amazon • Being able to extract useful information out of the data is key for exploiting them commercially. • Scientific point of view • Scientists are at an unprecedented position where they can collect TB of information • Examples: Sensor data, astronomy data, social network data, gene data • We need the tools to analyze such data to get a better understanding of the world and advance science • Scale (in data size and feature dimension) • Why not use traditional analytic methods? • Enormity of data, curse of dimensionality • The amount and the complexity of data does not allow for manual processing of the data. We need automated techniques.
  • 28. What is Data Mining again? • “Data mining is the analysis of (often large) observational data sets to find unsuspected relationships and to summarize the data in novel ways that are both understandable and useful to the data analyst” (Hand, Mannila, Smyth) • “Data mining is the discovery of models for data” (Rajaraman, Ullman) • We can have the following types of models • Models that explain the data (e.g., a single function) • Models that predict the future data instances. • Models that summarize the data • Models the extract the most prominent features of the data.
  • 29. What can we do with data mining? • Some examples: • Frequent itemsets and Association Rules extraction • Coverage • Clustering • Classification • Ranking • Exploratory analysis
  • 30. Frequent Itemsets and Association Rules • Given a set of records each of which contain some number of items from a given collection; • Identify sets of items (itemsets) occurring frequently together • Produce dependency rules which will predict occurrence of an item based on occurrences of other items. TID Items 1 Bread, Coke, Milk 2 Beer, Bread 3 Beer, Coke, Diaper, Milk 4 Beer, Bread, Diaper, Milk 5 Coke, Diaper, Milk Rules Discovered: {Milk} --> {Coke} {Diaper, Milk} --> {Beer} Itemsets Discovered: {Milk,Coke} {Diaper, Milk} Tan, M. Steinbach and V. Kumar, Introduction to Data Mining
  • 31. Frequent Itemsets: Applications • Text mining: finding associated phrases in text • There are lots of documents that contain the phrases “association rules”, “data mining” and “efficient algorithm” • Recommendations: • Users who buy this item often buy this item as well • Users who watched James Bond movies, also watched Jason Bourne movies. • Recommendations make use of item and user similarity
  • 32. Association Rule Discovery: Application • Supermarket shelf management. • Goal: To identify items that are bought together by sufficiently many customers. • Approach: Process the point-of-sale data collected with barcode scanners to find dependencies among items. • A classic rule -- • If a customer buys diaper and milk, then he is very likely to buy beer. • So, don’t be surprised if you find six-packs stacked next to diapers! Tan, M. Steinbach and V. Kumar, Introduction to Data Mining
  • 33. Clustering Definition • Given a set of data points, each having a set of attributes, and a similarity measure among them, find clusters such that • Data points in one cluster are more similar to one another. • Data points in separate clusters are less similar to one another. • Similarity Measures? • Euclidean Distance if attributes are continuous. • Other Problem-specific Measures. Tan, M. Steinbach and V. Kumar, Introduction to Data Mining
  • 34. Illustrating Clustering Euclidean Distance Based Clustering in 3-D space. Intracluster distances are minimized Intercluster distances are maximized Tan, M. Steinbach and V. Kumar, Introduction to Data Mining
  • 35. Clustering: Application 1 • Bioinformatics applications: • Goal: Group genes and tissues together such that genes are coexpressed on the same tissues
  • 36. Clustering: Application 2 • Document Clustering: • Goal: To find groups of documents that are similar to each other based on the important terms appearing in them. • Approach: To identify frequently occurring terms in each document. Form a similarity measure based on the frequencies of different terms. Use it to cluster. • Gain: Information Retrieval can utilize the clusters to relate a new document or search term to clustered documents. Tan, M. Steinbach and V. Kumar, Introduction to Data Mining
  • 37. Clustering of S&P 500 Stock Data Discovered Clusters Industry Group 1 Applied-Matl-DOWN,Bay-Network-Down,3-COM-DOWN, Cabletron-Sys-DOWN,CISCO-DOWN,HP-DOWN, DSC-Comm-DOWN,INTEL-DOWN,LSI-Logic-DOWN, Micron-Tech-DOWN,Texas-Inst-Down,Tellabs-Inc-Down, Natl-Semiconduct-DOWN,Oracl-DOWN,SGI-DOWN, Sun-DOWN Technology1-DOWN 2 Apple-Comp-DOWN,Autodesk-DOWN,DEC-DOWN, ADV-Micro-Device-DOWN,Andrew-Corp-DOWN, Computer-Assoc-DOWN,Circuit-City-DOWN, Compaq-DOWN, EMC-Corp-DOWN, Gen-Inst-DOWN, Motorola-DOWN,Microsoft-DOWN,Scientific-Atl-DOWN Technology2-DOWN 3 Fannie-Mae-DOWN,Fed-Home-Loan-DOWN, MBNA-Corp-DOWN,Morgan-Stanley-DOWN Financial-DOWN 4 Baker-Hughes-UP,Dresser-Inds-UP,Halliburton-HLD-UP, Louisiana-Land-UP,Phillips-Petro-UP,Unocal-UP, Schlumberger-UP Oil-UP • Observe Stock Movements every day. • Cluster stocks if they change similarly over time. Tan, M. Steinbach and V. Kumar, Introduction to Data Mining
  • 38. Coverage • Given a set of customers and items and the transaction relationship between the two, select a small set of items that “covers” all users. • For each user there is at least one item in the set that the user has bought. • Application: • Create a catalog to send out that has at least one item of interest for every customer.
  • 39. Classification: Definition • Given a collection of records (training set ) • Each record contains a set of attributes, one of the attributes is the class. • Find a model for class attribute as a function of the values of other attributes. • Goal: previously unseen records should be assigned a class as accurately as possible. • A test set is used to determine the accuracy of the model. Usually, the given data set is divided into training and test sets, with training set used to build the model and test set used to validate it.
  • 40. Classification Example Tid Refund Marital Status Taxable Income Cheat 1 Yes Single 125K No 2 No Married 100K No 3 No Single 70K No 4 Yes Married 120K No 5 No Divorced 95K Yes 6 No Married 60K No 7 Yes Divorced 220K No 8 No Single 85K Yes 9 No Married 75K No 10 No Single 90K Yes 10 categorical categorical continuous class Refund Marital Status Taxable Income Cheat No Single 75K ? Yes Married 50K ? No Married 150K ? Yes Divorced 90K ? No Single 40K ? No Married 80K ? 10 Test Set Training Set Model Learn Classifier Tan, M. Steinbach and V. Kumar, Introduction to Data Mining
  • 41. Classification: Application 1 • Ad Click Prediction • Goal: Predict if a user that visits a web page will click on a displayed ad. Use it to target users with high click probability. • Approach: • Collect data for users over a period of time and record who clicks and who does not. The {click, no click} information forms the class attribute. • Use the history of the user (web pages browsed, queries issued) as the features. • Learn a classifier model and test on new users.
  • 42. Classification: Application 2 • Fraud Detection • Goal: Predict fraudulent cases in credit card transactions. • Approach: • Use credit card transactions and the information on its account-holder as attributes. • When does a customer buy, what does he buy, how often he pays on time, etc • Label past transactions as fraud or fair transactions. This forms the class attribute. • Learn a model for the class of the transactions. • Use this model to detect fraud by observing credit card transactions on an account. Tan, M. Steinbach and V. Kumar, Introduction to Data Mining
  • 43. Link Analysis Ranking • Given a collection of web pages that are linked to each other, rank the pages according to importance (authoritativeness) in the graph • Intuition: A page gains authority if it is linked to by another page. • Application: When retrieving pages, the authoritativeness is factored in the ranking.
  • 44. Exploratory Analysis • Trying to understand the data as a physical phenomenon, and describe them with simple metrics • What does the web graph look like? • How often do people repeat the same query? • Are friends in facebook also friends in twitter? • The important thing is to find the right metrics and ask the right questions • It helps our understanding of the world, and can lead to models of the phenomena we observe.
  • 45. Exploratory Analysis: The Web • What is the structure and the properties of the web?
  • 46. Exploratory Analysis: The Web • What is the distribution of the incoming links?
  • 47. • Draws ideas from machine learning/AI, pattern recognition, statistics, and database systems • Traditional Techniques may be unsuitable due to • Enormity of data • High dimensionality of data • Heterogeneous, distributed nature of data • Emphasis on the use of data Connections of Data Mining with other areas Machine Learning/ Pattern Recognition Statistics/ AI Data Mining Database systems Tan, M. Steinbach and V. Kumar, Introduction to Data Mining
  • 48. 48 Cultures • Databases: concentrate on large-scale (non- main-memory) data. • AI (machine-learning): concentrate on complex methods, small data. • In today’s world data is more important than algorithms • Statistics: concentrate on models. CS345A Data Mining on the Web: Anand Rajaraman, Jeff Ullman
  • 49. 49 Models vs. Analytic Processing • To a database person, data-mining is an extreme form of analytic processing – queries that examine large amounts of data. • Result is the query answer. • To a statistician, data-mining is the inference of models. • Result is the parameters of the model. CS345A Data Mining on the Web: Anand Rajaraman, Jeff Ullman
  • 50. 50 (Way too Simple) Example • Given a billion numbers, a DB person would compute their average and standard deviation. • A statistician might fit the billion points to the best Gaussian distribution and report the mean and standard deviation of that distribution. CS345A Data Mining on the Web: Anand Rajaraman, Jeff Ullman
  • 51. Data Mining: Confluence of Multiple Disciplines Data Mining Database Technology Statistics Machine Learning Pattern Recognition Algorithm Other Disciplines Visualization
  • 52. Data Mining: Confluence of Multiple Disciplines Data Mining Database Technology Statistics Machine Learning Pattern Recognition Algorithm Other Disciplines Visualization
  • 53. Data Mining: Confluence of Multiple Disciplines Data Mining Database Technology Statistics Machine Learning Pattern Recognition Algorithm Distributed Computing Visualization
  • 54. Single-node architecture Memory Disk CPU Machine Learning, Statistics “Classical” Data Mining
  • 55. Commodity Clusters • Web data sets can be very large • Tens to hundreds of terabytes • Cannot mine on a single server • Standard architecture emerging: • Cluster of commodity Linux nodes, Gigabit ethernet interconnect • Google GFS; Hadoop HDFS; Kosmix KFS • Typical usage pattern • Huge files (100s of GB to TB) • Data is rarely updated in place • Reads and appends are common • How to organize computations on this architecture? • Map-Reduce paradigm
  • 56. Cluster Architecture Mem Disk CPU Mem Disk CPU … Switch Each rack contains 16-64 nodes Mem Disk CPU Mem Disk CPU … Switch Switch 1 Gbps between any pair of nodes in a rack 2-10 Gbps backbone between racks
  • 57. Map-Reduce paradigm • Map the data into key-value pairs • E.g., map a document to word-count pairs • Group by key • Group all pairs of the same word, with lists of counts • Reduce by aggregating • E.g. sum all the counts to produce the total count.
  • 58. The data analysis pipeline • Mining is not the only step in the analysis process • Preprocessing: real data is noisy, incomplete and inconsistent. Data cleaning is required to make sense of the data • Techniques: Sampling, Dimensionality Reduction, Feature selection. • A dirty work, but it is often the most important step for the analysis. • Post-Processing: Make the data actionable and useful to the user • Statistical analysis of importance • Visualization. • Pre- and Post-processing are often data mining tasks as well Data Preprocessing Data Mining Result Post-processing
  • 59. Data Quality • Examples of data quality problems: • Noise and outliers • missing values • duplicate data
  • 60. Sampling • Sampling is the main technique employed for data selection. • It is often used for both the preliminary investigation of the data and the final data analysis. • Statisticians sample because obtaining the entire set of data of interest is too expensive or time consuming. • Sampling is used in data mining because processing the entire set of data of interest is too expensive or time consuming.
  • 61. Sampling … • The key principle for effective sampling is the following: • using a sample will work almost as well as using the entire data sets, if the sample is representative • A sample is representative if it has approximately the same property (of interest) as the original set of data
  • 62. Types of Sampling • Simple Random Sampling • There is an equal probability of selecting any particular item • Sampling without replacement • As each item is selected, it is removed from the population • Sampling with replacement • Objects are not removed from the population as they are selected for the sample. • In sampling with replacement, the same object can be picked up more than once • Stratified sampling • Split the data into several partitions; then draw random samples from each partition
  • 63. Sample Size 8000 points 2000 Points 500 Points
  • 64. Sample Size • What sample size is necessary to get at least one object from each of 10 groups.
  • 65. A data mining challenge • You are reading a stream of integers, and you want to sample one integer uniformly at random but you do not know the size (N) of the stream in advance. You can only keep a constant amount of integers in memory • How do you sample? • Hint: the last integer in the stream should have probability 1/N to be selected. • Reservoir Sampling: • Standard interview question
  • 66. 66 Meaningfulness of Answers • A big data-mining risk is that you will “discover” patterns that are meaningless. • Statisticians call it Bonferroni’s principle: (roughly) if you look in more places for interesting patterns than your amount of data will support, you are bound to find crap. • The Rhine Paradox: a great example of how not to conduct scientific research.
  • 67. 67 Rhine Paradox – (1) • Joseph Rhine was a parapsychologist in the 1950’s who hypothesized that some people had Extra-Sensory Perception. • He devised (something like) an experiment where subjects were asked to guess 10 hidden cards – red or blue. • He discovered that almost 1 in 1000 had ESP – they were able to get all 10 right!
  • 68. 68 Rhine Paradox – (2) • He told these people they had ESP and called them in for another test of the same type. • Alas, he discovered that almost all of them had lost their ESP. • What did he conclude? • Answer on next slide.
  • 69. 69 Rhine Paradox – (3) • He concluded that you shouldn’t tell people they have ESP; it causes them to lose it.