![“... knowledge of sequences could contribute much to our
understanding of living matter.” [Frederick Sanger]](https://image.slidesharecdn.com/sequencingiontorrentandsolid-190319091842/85/Ion-torrent-and-SOLiD-Sequencing-Techniques-45-320.jpg)
Ion torrent and SOLiD Sequencing Techniques
- 1. Ion Torrent (Proton/PGM) Sequencing and SOLiD Sequencing Dr. Fikre Zeru (DVM, MSc, Assistant Professor at Mekelle university PhD fellow at AAU, IOB, SIDA project, Uppsala University) Addis Ababa, March, 2019
- 2. Introduction to Sequencing • Genome sequencing is figuring out the order of DNA nucleotides – to read the genetic information found in the DNA • In 1977, Frederick Sanger developed DNA sequencing technology known as Sanger sequencing – It was laborious and radioactive materials were required. • The automatic sequencing instruments (namely AB370) – which made the sequencing faster and more accurate. – became the main tools for the completion of human genome project in 2001. • The human genome project greatly stimulated the development of powerful novel sequencing instrument to increase speed and accuracy, while simultaneously reducing cost and manpower……………….NGS
- 4. NGS • NGS, also known as high-throughput sequencing, including: – The first NGS technology released in 2005 was the pyrosequencing method by 454 Life Sciences (now Roche). – One year later, the Solexa/Illumina sequencing platform was commercialized (Illumina acquired Solexa) . – The third technology to be released was Sequencing by Oligo Ligation Detection (SOLiD) by Applied Biosystems (now Life Technologies) in 2007. – In 2010, Ion Torrent (now Life Technologies) released the Personal Genome Machine (PGM). • The NGS technologies are different from the Sanger method in aspects of massively parallel analysis, high throughput, and reduced cost.
- 5. CONT’D • NGS has significantly decreased the time and cost required for producing large quantities of sequence data. • These technologies have increased the feasibility of – analyzing genomes and transcriptomes, – identifying new genes and genetic markers, and – investigating genome homology, – differential gene expression, and epistasis.
- 6. Ion torrent: Proton / PGM sequencing • Ion Semiconductor Sequencing is a method of NGS based on the detection of H+ ions that are released during the polymerization of DNA. – It is sequencing by synthesis, during which a complementary strand is built based on the sequence of a template strand. • Differs from other sequencing technologies in that – not rely on the optical detection of incorporated nucleotides using fluorescence and camera scanning. This resulted in higher speed, lower cost, and smaller instrument size. • Ion Torrent semiconductor sequencing is performed on either the PGM or Proton instrument depending on desired read length and application.
- 7. Ion PGM & Ion proton • Ion Torrent is the company/brand name. • Ion Torrent's sequencers are the PGM and the Proton. • Functionally they are very similar in that they use the same chemistry and principles. • The Ion Torrent PGM, was developed by Jonathan Rothberg 2010, is a small-scale, bench top instrument capable of processing samples for – targeted DNA and RNA sequencing, small RNA sequencing, gene expression profiling, microbial genome sequencing, and bacterial and viral typing applications. • The Ion Torrent Proton sequencer is a larger-scale instrument designed for high-throughput sequencing of exomes, transcriptomes and genomes.
- 9. Fig. Semiconductor sequencing chips. The table summarizes statistics for various sequencing runs and their assessments for each chip type: 314, 316, 318 Ion Torrent PGM, and Ion Proton (IP1/IP2/IP3). All runs were based on 200 bp chemistry and OneTouch™ template preparation with Torrent Suite server version 2.2. Q20 refers to 99 % accuracy of a base call. 1Data were obtained from laboratory at the University of Florida. 2Analysis includes assembly and initial annotation of a given sequencing run using a High Performance Computer Cluster (64 Intel(R) Xeon(R) X7550 2.00GHz CPUs, 512GB of RAM, and 6TB of storage). *All Proton data were provided by Ion Torrent, Life Technologies Andrea B. Kohn, et al. 2013, Methods Mol Biol. ;1048:247-284.
- 10. Principle • Ion torrent and Ion proton sequencing exploit the fact that addition of a dNTP to a DNA polymer releases an H+ ion. As each H+ ion released will decrease the pH. The changes in pH allow us to determine if that base, and how many thereof, was added to the sequence read.
- 12. Procedure • Long DNA or RNA molecules are first fragmented into a suitable size (~50–500 nt) • Adaptors are added and one molecule is placed onto a bead. • Fragments, with adaptors, are PCR amplified within a water drop in oil (emulsion PCR). – An oil–water emulsion is created to partition small reaction vesicles that each ideally contains one sphere, one library molecule and all the reagents needed for amplification. Two primers that are complementary to the sequence library adapters are present, but one is only present in solution while the other is bound to the sphere.
- 16. • Each bead is placed into a single well of a slide. • The slide is flooded with a single species of dNTP, along with buffers and polymerase, one NTP at a time and the process is repeated cycling through the different dNTP species. • The pH is detected in each of the wells. • The dNTPs are added in a predefined flow order. At the first release of the system, this order was a repetitive T–A–C–G sequence.
- 17. Work flow
- 18. • The Ion torrent chip consists of a flow compartment and solid state pH sensor micro-arrayed wells
- 22. Application of Ion Torrent • At present, supported applications for Ion Torrent semiconductor sequencing include: – targeted DNA and RNA sequencing; – exome sequencing; – transcriptome sequencing; – small RNA Sequencing; – gene expression profiling; – microbial or other small genome sequencing; – bacterial and viral typing.
- 23. Merit and demerit of Ion torrent • Pros. – Semi-conductor technology, no requirement for optical scanning and fluorescent nucleotides. – Fast run times; a typical run takes only a few hours. – Broad range of applications. • Cons. – This technology suffers from the same issue as 454 with high error rates in homopolymers.
- 24. SOLiD Sequencing • Sequencing by Oligonucleotide Ligation and Detection • SOLiD is developed by Applied Biosystems (Life Technologies) and commercialize since 2007. • The sequencer adopts the technology of two-base sequencing based on ligation sequencing. – Ligase based sequencing
- 25. • Uses an adapter-ligated fragment library. • Instead of dNTPs we add (8bp) oligo nucleotides. • Uses an emulsion PCR approach with small magnetic beads to amplify the fragments for sequencing. • Read lengths for SOLiD are user defined between 25–35 bp, and each sequencing run yields between 2–4 Gb of DNA sequence data.
- 26. • It is based on polony sequencing (polymerase + colony) • The fluorescent signal recorded during the probes complementary to the template strand and vanished by the cleavage of probes’ last 3 bases. • And the sequence of the fragment can be deduced after 5 round of sequencing using ladder primer sets.
- 27. Overview of SOLiD sequencing process • Basically the procedure involves are: – 1. Sample preparation – 2. Amplification by em-PCR – 3. Ligation reaction and imaging – 4. Data analysis
- 28. Procedure • Sample preparation – DNA is fragmented – Adaptors ligated to fragments • Amplification – Hybridization of sequence fragment to beads – Polonies production (polymerase +colony) and gathering (by centrifuge) • Attaches to glass slide • Ligation and reaction & imaging
- 30. • On a SOLiD flow cell, the libraries can be sequenced by 8 base-probe ligation which contains – ligation site (the first base), – cleavage site (the fifth base), and – 4 different fluorescent dyes (linked to the last base).
- 31. • A sequencing primer is hybridized to adapter • A mixture of octamer oligonucleotides compete for ligation to primer • The bases in 4th and 5th position on the oligonucleotides are encoded by one of four color labels. • Ligated oligo is cleaved after position 5 which removes label and the cycle is repeated. • Whole process is repeated by off-set primer n-1 • Nucleotide read length is 30-35
- 33. • Fig. Applied Biosystems SOLiD sequencing by ligation. Top: SOLiD color-space coding. Each interrogation probe is an octamer, which consists of (3 Ј -to-5 Ј direction) 2 probe- specific bases followed by 6 degenerate bases (nnnzzz) with one of 4 fluorescent labels linked to the 5 Ј end. The 2 probe-specific bases consist of one of 16 possible 2-base combinations. Bottom: (A), The P1 adapter and template with annealed primer (n) is interrogated by probes representing the 16 possible 2-base combinations. In this example, the 2 specific bases complementary to the template are AT. (B), After annealing and ligation of the probe, fluorescence is recorded before cleavage of the last 3 degenerate probe bases. The 5 Ј end of the cleaved probe is phosphorylated (not shown) before the second sequencing step. (C), Annealing and ligation of the next probe. (D), Complete extension of primer (n) through the first round consisting of 7 cycles of ligation. (E), The product extended from primer (n) is denatured from the adapter/template, and the second round of sequencing is performed with primer (n Ϫ 1). With the use of progressively offset primers, in this example (n Ϫ 1), adapter bases are sequenced, and this known sequence is used in conjunction with the color-space coding for determining the template sequence by deconvolution. In this technology, template bases are interrogated twice.
- 34. SOLiD Sequencing 5’ amplification handle sequencing primersite insert (sequence template) 1 bead loaded up with thousands of identical molecules ~ one shown for illustration 5’P Anneal sequencing primer
- 35. SOLiD Sequencing 5’ AANNNIII AG CCNNNIII GGNNNIII TTNNNIII ACNNNIII CANNNIII TGNNNIII GTNNNIII AGNNNIII GANNNIII TCNNNIII ATNNNIII TANNNIII CGNNNIII GCNNNIII CTNNNIII Sixteen probes, but only four colors TCNNNIII
- 38. SOLiD Sequencing 5’ AGTGCTAGATCCGAGGACTCATCGCCGATACG CANNNTCNNNGCNNNTGNNNAGNNNCTNNN “Reset”: Melt off previous extension products and repeat five cycles with offset of one base
- 39. SOLiD Sequencing 5’ AGTGCTAGATCCGAGGACTCATCGCCGATACG TCNNNATNNNGGNNNGTNNNTANNNGCNNN CANNNTCNNNGCNNNTGNNNAGNNNCTNNN ACNNNCTNNNCTNNNGANNNGCNNNTANNN CGNNNTANNNTCNNNAGNNNCGNNNATNNN GANNNAGNNNCCNNNGTNNNGGNNNTGNNN ...GACCCGTACGCCGTAGTGCTAGATCCGAGGACTCATCGCCGATACGAT translate genome into color space ... |||||||||||||||||||||||||||||| Align in color space!
- 40. Translating color space back to base space 2nd Base1stBase A C G T A C G T
- 42. Pros and cons of SOLiD sequencing • Pros. – Second (after Illumina) highest throughput system on the market. – The SOLiD system is widely claimed to have lower error rates,99.94% accuracy, than most other systems owing to the fact that each base is read twice. • Cons. – Problem with palindrome sequence
- 44. (Buermans and Dunnen, 2014)
- 45. “... knowledge of sequences could contribute much to our understanding of living matter.” [Frederick Sanger]