SlideShare a Scribd company logo
Simultaneous, specific and real-time detection of biothreat and
frequently encountered food-borne pathogens
Abdela Salah Woubita, Teshome Yehualaesheta, Tsegaye Habtemariamb, and Temesgen
Samuela
aDepartment of Pathobiology, College of Veterinary Medicine, Nursing and Allied Health,
Tuskegee University, AL 36088
bCenter for Computational Epidemiology, Bioinformatics & Risk Analysis, College of Veterinary
Medicine, Nursing and Allied Health, Tuskegee University, AL 36088
Abstract
The bacterial genera Escherichia, Salmonella, Shigella, Vibrio, Yersinia and Francisella include
important food safety and biothreat agents causing food-related and other human illnesses
worldwide. We aimed to develop rapid methods with the capability to simultaneously and
differentially detect all six pathogens in one run. Our initial experiments to use previously reported
sets of primers revealed non-specificity of some of the sequences when tested against a broader
array of pathogens, or proved not optimal for simultaneous detection parameters. By extensive
mining of the whole genome and protein databases of diverse closely and distantly related
bacterial species and strains, we have identified unique genome regions, which we utilized to
develop a detection platform. Twelve of the specific genomic targets we have identified to design
the primers in F. tularensis ssp. tularensis, F. tularensis ssp. novicida, S. dysentriae, S.
typhimurium, V. cholera, Y. pestis, and Y. pseudotuberculosis contained either hypothetical or
putative proteins, the functions of which have not been clearly defined. Corresponding primer sets
were designed from the target regions for use in real-time PCR assays to detect specific biothreat
pathogens at species or strain levels. The primer sets were first tested by in-silico PCR against
whole genome sequences of different species, sub-species, or strains and then by in vitro PCR
against genomic DNA preparations from 23 strains representing six biothreat agents (E.coli
O157:H7 strain EDL 933, Shigella dysentriae, Salmonella typhi, Francisella tularensis ssp.
tularensis, Vibrio cholera, and Yersinia pestis) and six foodborne pathogens (Salmonella
typhimurium, Salmonella saintpaul, Shigella sonnei, Francisella novicida, Vibrio parahemolytica
and Yersinia pseudotuberculosis). Each pathogen was specifically identifiable at the genus and
species levels. Sensitivity assays performed using purified DNA showed the lowest detection limit
of 640 fg DNA/µl for F. tularensis. A preliminary test done to detect Shigella organisms in a milk
matrix showed that 6–60 colony forming units of the bacterium per milliliter of milk could be
detected in about an hour. Therefore, we have developed a platform to simultaneously detect
foodborne pathogen and biothreat agents specifically and in real-time. Such a platform could
enable rapid detection or confirmation of contamination by these agents.
Keywords
Biothreat agents; PCR; food-borne pathogens
1. Introduction
Food-borne pathogens cause millions of clinical illnesses every year and cost billions of
dollars to manage and control. Intentional contamination of food in the form of a biological
attack is an even more alarming prospect given that no standards or established routines
NIH Public Access
Author Manuscript
J Food Prot. Author manuscript; available in PMC 2013 April 01.
Published in final edited form as:
J Food Prot. 2012 April ; 75(4): 660–670. doi:10.4315/0362-028X.JFP-11-480.
$watermark-text$watermark-text$watermark-text
exist to test food for these threats (Kennedy, 2008). Intentional contamination could involve
among many food products, contamination of water, milk, and other beverages that are
distributed from bulk storage or processing sites, not necessarily at the source of the starting
product. This has the potential to result in disastrous and far-reaching effects, including
direct morbidity and/or mortality, disruption of food distribution, loss of consumer
confidence in government and the food supply, business failures, trade restrictions, and
ripple effects on the economy (Busta and Shaun, 2011). Therefore, from both food safety
and biothreat points of view, it is imperative that food and drink contaminations are detected
well before they reach the consumer level.
In the past decades the Polymerase Chain Reaction (PCR) has been transformed into a
powerful tool to detect pathogens with extremely high sensitivity and specificity. While the
main drawback of PCR still remains to be the inability to distinguish between live and dead
organisms, the potential for non-specific detection could also be high if the target sequences
are not specific or of contamination of the reactions or rooms occur (He et al., 1994; Lantz et
al., 2000; Wright and Wynford-Thomas, 1990). Moreover, biological sample preparation
strategies are needed to remove non-specific inhibitors. Multiplexing the PCR for the
detection of multiple pathogens or targets is currently employed to enable the testing of
samples for multiple pathogens in a single run. Several multiplex or simultaneous PCR
systems for the detection of food-borne and other infectious pathogens are also being
developed (Fukushima et al., 2010; Jothikumar and Griffiths, 2002; Skottman et al., 2007;
Wilson et al., 2005). Despite the advantages, when multiplexing PCR, optimal reaction
conditions for the multiple sets of primers have to be identified for all the potential targets to
be detected (Markoulatos et al., 2002; McKillip and Drake, 2004).
Pathogenic bacteria of the genera Escherichia, Shigella, Francisella, Salmonella, Vibrio and
Yersinia contain species or strains that are considered biothreat agents that, if intentionally
introduced into the food supply system, could result in high morbidities, mortalities and
severe economic losses. These bacteria therefore constitute organisms of interest in food
defense strategies against potential bioterrorism. Molecular diagnostic techniques for the
detection of the individual genera or a combination of some of these agents have been
developed by various research groups (Pohanka and Skladal, 2009; Song et al., 2005;
Versage et al., 2003). However, the progress towards a rapid, fully multiplexed, sensitive
and specific real-time PCR platform for the detection of all the six agents is not yet
satisfactory.
In an attempt to establish a molecular detection platform amenable to real-time PCR, we
first tested several previously reported PCR-primers for their validity for the detection of a
wide range of pathogenic and non-pathogenic, as well as related or-unrelated species or
strains. While some of the primers or gene targets reported in the literature were further used
for our real-time assays, in silico validation of many of the primers against a wide array of
bacterial genomes revealed cross reactivity or amplicon sizes not compatible with
simultaneous real-time PCR detection of multiple pathogens. Therefore, we utilized whole-
genome data mining, text-mining, in silico target and amplicon analysis, and in vitro
validation using DNA sequences from representative bacteria. We have identified very
specific molecular targets for reliable identification of the six food biothreat agents, and
developed a platform with simultaneous detection capability. Interestingly, many of targets
we identified have putative functions or code for hypothetical proteins, digressing from the
traditional use of previously known gene targets or known pathogenicity-associated
molecular detection tools.
Woubit et al. Page 2
J Food Prot. Author manuscript; available in PMC 2013 April 01.
$watermark-text$watermark-text$watermark-text
2. Materials and Methods
2.1. Bacterial species and DNA preparation for PCR
The bacterial strains used in this study are listed in Table 1. Laboratory level 2 organisms
consisted of Shigella dysentriae, Shigella sonnei, and Salmonella enterica ssp. enterica
serovar Saintpaul were grown aerobically at 37°C on tryptic soy agar supplemented with 5
% horse blood and tryptic soy broth, the exceptions to this is Vibrio vulnificus, which was
grown at 30°C. One ml of culture was collected by centrifugation at 10,000-× g, and pellet
re-suspended in sterile 1XPBS solution. DNA was extracted according to the manufacturer’s
protocol recommended for bacterial DNA extraction (Wizard genomic DNA purification kit,
Promega). Genomic DNAs of strains, F. tularensis subspecies novicida KM145 and Y.
pestis ZE 94–2122 were obtained from Biodefense and Emerging Infections Research
Resources Repository (BEI Resources). Genomic DNAs of all organisms listed on Table 1,
except for F. tularensis subspecies novicida strain U112 and F. tularensis subspecies
tularensis strain Schu S4, were purchased from ATCC collection (Manassas, VA). The
genomic DNA of the two Francisella subspecies, F. tularensis subspecies novicida U112 and
F. tularensis subspecies tularensis Schu S4 were kindly provided by Dr. Karl Klose,
University of Texas at San Antonio (UTSA) STCEID.
2.2. Genomic and expressed gene data mining
Completed genome sequence data of all of the select agents, including incomplete genome
sequence for S. enterica subsp. enterica serovar Saintpaul strain SARA 23 were retrieved
from the NCBI (http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi) microbial genome-
sequencing database. Most recently published references of comparative genomics of every
select agent were used in target region selection. A BLAST search was used in the selection
of specific amino acid sequences of all the organisms used in this study. Specific primers
were designed from genes and coding regions specific to the agent of interest. These primers
were then analyzed in silico for specific binding across the genome sequence of similar
species. For more stringency assessment we used V-NTI Advanced-11 (Invitrogen, USA)
for the design and modification of primers having a 3` end similarity with the closely related
species. All available whole genome sequence and partial sequences from prokaryote
genome database of the NCBI were used for the in silico validation of the specific primers.
2.3. Comparative genomic analysis
In search for a specific region, a BLAST analysis was performed for all the species
containing a coding sequence of > 500 aa. Further COBALT alignment analysis was used to
localize more specific regions for species under question. Once the specific amino acid
sequence was localized, we used the nucleotide sequence of this sequence for specific
primer design.
2.4. Primer design and preliminary analysis
The primers underwent rigorous testing before the experimental validation. This included
oligo-dimer, hair-loop formation and successful standardization of all primers to similar
melting temperatures, which is one of the requirements for the simultaneous use of these
primers. Primers fulfilling the required criteria were further analyzed for possible binding to
a different location within the same whole genome sequence using V-NTI motif search
analysis.
2.5. In silico PCR
In silico PCR validations were performed using both http://insilico.ehu.es/PCR/ and V-NTI.
Only primers giving specific amplifications were selected for further validation using
Woubit et al. Page 3
J Food Prot. Author manuscript; available in PMC 2013 April 01.
$watermark-text$watermark-text$watermark-text
conventional and real time PCR assay. Primers that showed the most specificity to the target
molecule were ordered from Integrated DNA technologies (IDT, IA).
2.6. In vitro PCR and analysis
All PCR reactions were set up in an isolated PCR station (AirClean Systems, NC) that was
UV-sanitized daily and after each use. Initial conventional PCR was performed to validate
the specificity of the primers for respective organisms. DNA from 23 strains representing
major biothreat agents and closely related foodborne pathogens were used for the validation
(Table 1). Single target PCR was performed in a 25 µl final volume containing 0.2 µM of
forward and reverse primers, 12.5 µl of Pwo Master mix containing 1.25 U of Pwo enzyme,
2 mM MgCl2 and 0.2 mM dNTPs (Roche Diagnostics, Mannheim Germany). The PCR
amplification profile for this initial assay consists of 10 min at 95 °C, followed by 30 cycles
of 15 seconds at 95 °C, 15 seconds at 60 °C, and 15 seconds at 72 °C using Master cycler
pro (Eppendorf, Humburg, Germany). Presences of single band were analyzed using gel
electrophoresis.
2.7. Real-time PCR
Real time PCR assay was performed using Brilliant III Ultra-Fast SYBR Green QPCR
Master Mix (Agilent Technologies) for final validation & verification. A specific
amplification was obtained with all the primers used to amplify the respective organisms. A
reaction volume of 20 µl containing 500 nM of forward and reverse primers, 10 µl of 2X
Brilliant III Ultra-Fast SYBER Green master mix, 0.3 µl ROX reference dye, 1 µl of DNA
template, nuclease free H2O added to the final volume was used for the real-time PCR.
Cycling conditions consisted of one cycle of segment 1, 2 min at 95 °C; followed by 27
cycles of segment 2, 10 seconds at 95 °C, 30 seconds at 60 °C; completed by one melting
curve cycle of 1 min at 95 °C, 30 seconds at 65 °C, and 30 seconds at 95°C.
2.8. Sensitivity assay
Sensitivity of the real-time PCR assay was determined by five-fold serial dilution of the
DNA samples (initial DNA concentrations were 2.5 ng/µl for E. coli O157:H7 strain
EDL933, 2 ng/µl for Francisella tularensis, 2.6 ng/µl for Shigella dysentriae, 3.7 ng/µl for
Salmonella typhi, 3 ng/µl Vibrio cholerae and 3.8 ng/µl for Yersina pestis) in nuclease free
double distilled H2O from each of the bacterial species. One microliter of each of the DNA
dilutions were used in real time PCR assay mixture. The assay was performed as described
above.
2.9. Sensitivity assay in food Matrix
Milk (450 µl) was inoculated with 7.5 × 108 CFU of Shigella dysentriae (attenuated strain)
culture suspension and diluted serially up to 10−8. After the dilution, bacteria in each aliquot
were immediately concentrated by centrifugation at 12,000 RPM (13,400 × g) for 2 min.
Whole genomic DNA was extracted from all of the serially diluted tubes according to the
PrepMan Ultra Sample Preparation protocol (Applied Biosystems, CA). The DNA was
detected using ShD1 primers by real-time PCR. In parallel, bacterial cultures were initiated
to determine the CFU of bacteria in those dilutions.
3. Results
3.1. Bacterial Species, Design of primers and in silico validation
The list of strains of bacterial species included in this study to establish the PCR detections
is given in Table 1. DNA from these organisms were either purchased or donated through
specific agreements. Initially, we aimed at developing a simultaneous foodborne pathogen
Woubit et al. Page 4
J Food Prot. Author manuscript; available in PMC 2013 April 01.
$watermark-text$watermark-text$watermark-text
detection platform using published primer sequences. Some of the sequences were found to
be not highly specific when tested against a wide array of organisms in silico. Others were
not suitable for simultaneous or multiplex detection of the pathogens in the current study.
Therefore, we designed an entirely new set of primers or modified the existing sequences to
develop our detection system. To this end, we used text mining, genomic data mining,
sequence analysis and comparison tools. Specific primers Typhi-vipR-ST2-F and R were
adapted from the work done by Jin et al. (2008) modified by removing G from the 3'end of
the forward primer and CT from the 5'end. The list of primers designed or used in this study
is shown in Table 2. During the process of selection, the primers were initially validated for
unique site recognition and strength of complementarities by using the genomic DNA of
each organism as a template.
After the primers were designed, we tested the specificity of the primers by performing
virtual (in silico) PCR using the publicly accessible tool at http://insilico.ehu.es/PCR/.
Examples of pre-validation in silico PCR are shown in Fig. 1. Additionally, we further tested
the strength of complementarities and the uniqueness of the binding sites for each primer
using the Vector NTI software package (Invitrogen, Carlsbad, CA). Reference genomic
DNA sequences of each of the organisms to be detected were uploaded to the program and
the designed primers were run along the entire genomic sequence. Validated primers with
100% complementary binding at a unique site were selected for each organism. These
primers were in turn tested for cross reactivity with other genomic DNA sequences,
especially against those phylogenetically closely related bacteria.
3.2. Conventional PCR and gel electrophoresis analysis for the specificity of the primers
Following in silico analysis and validation, we tested the primers using DNA isolated from
strains of species of the foodborne pathogens. Each PCR experiment was designed so that
the primers are tested against their template DNA and DNA from the maximum number of
closely related species. In parallel, genus inclusive primers were designed and PCR was
performed to verify that the target species as well as other members of the genus could be
detected. Genus inclusive primers gave an additional quality control to minimize cross
reactivity with other genera or species within the genus. PCR products were resolved on 1.5
% agarose gels; the gels were stained with GelRed (Biotium, Hayward, CA) and
photographed using AlphaImager (Cell Biosciences, Santa Clara, CA). As shown in Fig. 2,
our species-specific primers gave very specific detection that discriminated each of the
target species, whereas the genus-inclusive primers distinctively identified other members of
the genus simultaneously with the target. Therefore, these conventional PCR data provided
strong evidence that the primers were very specific, and yielded products of the expected
size under the experimental conditions employed. Only a minor cross reactivity of the
Escherichia genus specific primers with Vibrio cholera was noticed in this assay. However,
the size of the product was larger than expected and also the intensity of the band was weak.
3.3. Validation of the detection of foodborne bacterial pathogens DNA by real-time PCR
The conventional PCR method was employed as described above to visualize the PCR
products and determine the specificity of our detection. However, as conventional PCR is
time consuming and labor intensive, it is not practical to use it for the detection of pathogens
in a high throughput platform. Therefore, we wanted to determine the suitability of our
primers and the PCR system in a real-time setup. PCR conditions were selected so that a
species-specific primer was used to detect DNA from target and other bacteria arrayed on
96-well plates. The average amount of DNA concentration used per well was 2 ng/µl. On the
array, one well was designated for DNA from one bacterial species or strain. While DNA
was added to the designated wells, a primer solution was aliquoted to all the 23 wells on the
array corresponding the different species listed on Table 1. A positive curve was expected to
Woubit et al. Page 5
J Food Prot. Author manuscript; available in PMC 2013 April 01.
$watermark-text$watermark-text$watermark-text
be generated only from the wells containing primers and the target DNA in the same well. In
a parallel array of 23 wells, genus-inclusive primers were also aliquoted to all the wells
containing DNA from the target species as well as other bacteria, including members of the
genus. Positive curves were anticipated only from wells designated to the members of the
same genus. As shown in Fig. 3, single curves were generated with all of the primers we
tested. Since we did not multiplex the PCR, the multiple curves shown in Fig. 3 were
generated by merging data from the corresponding single curves originating from parallel
simultaneous detection of different strains of the same species.
3.4. Evaluation of the sensitivity of real-time PCR for the detection of DNA from foodborne
pathogens
To evaluate the sensitivity of our real-time assay, we serially diluted 1:5 the DNA from each
of the major pathogen and performed real-time PCR detection on each of the dilutions. One
microliters of each of the dilution was used in a 20 µl total PCR reaction volume and the
PCR was run for 27 amplification cycles. At the end of the run, 4 µl aliquots from each of
the wells were resolved on a 2 % agarose gel and visualized by GelRed staining (Biotium®).
As shown in Fig. 4, the sensitivity of the assay was variable between the organisms used;
e.g., starting with 3.8 µg/µl DNA, a 230 fg/µl dilution was detectable for Y. pestis DNA
while 640 fg/µl of diluted F. tularensis DNA was reliably detected for both species at
threshold cycles below 27. The overall detection range varied between 234 fg/µl (Y. pestis)
and 1.18 pg/µl (S. typhimurium). The gel electrophoregrams also showed generation of
bands of the correct size as well as visible limits of the serial dilution under conditions of the
experiment. Therefore, under these conditions, we were able to achieve a high sensitivity of
detection combined with the high specificity described above.
3.5. Evaluation of the application of the real-time PCR detection for bacteria in food matrix
Finally, to preliminarily evaluate if our real-time detection approach would be compatible
with DNA isolated from bacteria in a food matrix, we spiked commercially available
skimmed milk with 7.5×108 attenuated S. dysentriae bacteria (ATCC) and serially diluted
1:10 the suspension in a total of 500 µl volumes. Immediately after the serial dilution, tubes
were centrifuged to concentrate the bacteria and total DNA was isolated as described in
materials and methods. Parallel cultures were also initiated from each dilution to count
colony-forming units. As shown in Fig. 5, we were able to detect DNA isolated from milk
spiked with Shigella organisms with an approximate detection limit of 6–60 colony forming
units per ml of milk in less than one hour of experiment time.
4. Discussion
We have developed a PCR-based real-time detection platform for simultaneous, rapid,
sensitive and differential molecular detection of six primary biothreat agents, namely,
Escherichia, Salmonella, Shigella, Vibrio, Yersinia and Francisella. Through extensive
genomic data mining, text mining and multiple layer validation, we have identified 26 new
target sequences (Table 2), which enabled us to design the platform with improved
specificity. Some of these targets have a well-known functions such as stx2A (shiga toxin
subunit A from E. coli O157:H7), fusA (Elongation factor A from F. tularensis ssp.
tularensis), ipaH (invasive plasmid antigen from Shigella species), invC (invasion protein
from Salmonella species), rpoB (DNA-directed RNA polymerase subunit beta, from Vibrio
species). However, others have hitherto unknown functions such as in RloF gene from S.
enterica ssp. enterica s. Saintpaul with putative functions, or hypothetical proteins such as
pdpD (pathogenicity determinant protein D from F. tularensis ssp. tularensis). Moreover, we
preliminarily evaluated the utility of the platform using milk as a food matrix into which
Shigella organisms were spiked.
Woubit et al. Page 6
J Food Prot. Author manuscript; available in PMC 2013 April 01.
$watermark-text$watermark-text$watermark-text
One of the known challenges in multiplexed or simultaneous PCR-based molecular
detections is the need for optimization of the reaction conditions such as annealing
temperatures optimal for all primer sets, avoiding primer dimers, generation of compatible
amplicon sizes, and adjustment for different amplification efficiencies (Edwards and Gibbs,
1994). In this study, we have identified PCR conditions that are suitable for the
amplification of 105 bp to 371 bp fragments from all the six pathogens under the same
reaction conditions. Moreover, the specificities of the primers were tested and validated
against a broad array of potential biothreat agents and related species or strains, which do
not pose threat. For example, the Francisella tularensis ssp tularensis detection primers used
in this study, designed from a hypothetical protein gene pdpD2, were tested against four
other strains, Francisella subspecies (holartica, novicida, and mediasiatica) and the closely
related F. philomiragia ssp philomiragia, and showed reactivity only to the F. tularensis ssp
tularensis. On the other hand, F. tularensis ssp novicida primers based on another gene for
hypothetical protein pdpD were specific to the subspecies, without detecting any of the other
F. tularensis subspecies. Despite the degree of specificity we achieved with these primers,
our E. coli O157:H7 primers EC1 and EC2 still in-silico cross detected the non-O157 E. coli
such as O111 and O103, strains that evolved parallel to the O157 strain (Ogura et al., 2009).
However, since such non-O157 strains also possess pathogenic potential (Reid et al., 2000),
the ability of our primers to detect non-O157 strains may be a desirable feature in the
investigation of E. coli outbreaks.
Because of their close evolutionary relationship, differentiation of Escherichia from Shigella
species poses a big challenge (Jin et al., 2002; Pupo et al., 2000). In our study, even
challenging was the distinction among Shigella species, especially Shigella sonnei from
other members of the genus. After extensive comparative genome analysis, we identified the
gene for rhsA protein in rhs element as target for the specific identification of S. sonnei.
Similarly, Salmonella enterica ssp enterica s. typhimurium was identifiable by targets in the
genes for putative inner membrane protein and putative DNA repair ATPase. On the other
hand, while Vibrio parahemolyticus was identifiable using the hemolysin gene VP1729,
Vibrio cholerae was identifiable using the gene for phosphotyrosine protein phosphatase
VC0916 as a target.
Our primers based on the genes for putative phage-related membrane protein (YPO2127)
and the hypothetical protein YpAngola A2197 were able to detect all Y. pestis strains except
the biovar Microtus strain 91001. Lack of identification of this organism using our present
assay would not be a major problem since there has been so far no evidence that human
plaque can arise from Microtus strains (Zhou et al., 2004). Furthermore subcutaneous
inoculation of strains from serovar Microtus has demonstrated no virulence (Song et al.,
2004). The genes for YPTS_2284 and YPTB2194 hypothetical proteins were also specific
targets for the identification of Y. pseudotuberculosis isolates. These two regions were
selected from a set of 67 refined species-specific genes (Mark Eppinger et al., 2007). While
the targeting of hypothetical proteins for detection of the bacteria may not directly correlate
with the hitherto known pathogenicity or virulence of the organisms, genetic studies may
reveal the significance of these gene products in bacterial biology or host interaction, or
even pathogenicity. The identification of these genomic regions as specific to the particular
species or even sub species is an important step in advancing pathogen detection techniques
by providing additional targets.
We were able to verify our in silico results by in vitro differential identifications under
identical PCR conditions. In previous studies other groups had also developed multiplexed
PCR assays to simultaneously detect multiple food borne pathogens (Fukushima et al., 2010;
Jothikumar and Griffiths, 2002; Skottman et al., 2007; Wilson et al., 2005). While our
approach is similar in some aspects, for the first time we have combined into one assay the
Woubit et al. Page 7
J Food Prot. Author manuscript; available in PMC 2013 April 01.
$watermark-text$watermark-text$watermark-text
detection of primary biothreat agents of bioterrorism potential, and identified highly specific
targets capable of discriminating a broad range of pathogens or related bacteria. In this
study, we did not multiplex the primers or DNA in a single tube. With added future
improvements for even more rapid differential detection and multiplexing capabilities, our
assay platform provides a strong foundation to strengthen national and international food
defense strategies as a promising component of primary detection or confirmatory platforms.
Through this study, we also have designed highly specific primers that yielded PCR assays
with high sensitivity and low detection limits. For example to the detection limit for F.
tularensis in this study are comparable to or better than some other reports (Sellek et al.,
2008; Svensson et al., 2009), although different sources of DNA and procedures of detection
may influence the detection limits.
Food matrices provide a critical challenge in amplification-based pathogen detection
approaches. Improved pre-analytical sample processing techniques are needed to reduce the
time needed to arrive at diagnosis and decision-making (Benoit and Donahue, 2003;
Dwivedi and Jaykus, 2011). Previous studies have shown immunomagnetic separation
method to provide better concentration of bacteria from food matrices such as chicken meat
(Taha et al., 2010). In milk, a combination of the two techniques, i.e. immunomagnetic
separation and polymerase chain reaction, provided a detection of 1–10 CFU of salmonellae/
ml, after a selective pre-enrichment incubation of 12–16 hrs. However, a decreased
sensitivity of 10–100 CFU/ml was observed after 8–10 h of pre-enrichment period
(Mercanoglu Taban et al., 2009). In this study we have performed a preliminary test to
evaluate the use of real-time PCR for detection of S. dysentriae spiked in milk. Using
centrifugation to concentrate the bacteria serially diluted in milk, we were able to detect
about 6–60 CFU/ml of milk matrix, without an enrichment step. According to CDC, 10–100
organisms of S. dysentriae are considered the minimum infectious dose with possible
secondary transmission (Sobel et al., 2002).
Caution is needed in correlating the CFU findings with PCR detection limits, because in
general, PCR does not discriminate between live and dead organisms. Therefore, any
correlation between our DNA detection limit and the observed CFU per dilution may not be
direct. For example, if there is a time lapse between sample collection and PCR analysis, the
CFU could underestimate the degree of contamination of the food matrix. Alternatively,
sterilized products containing non-viable bacteria or their DNA may still yield positive data.
Although our studies using food matrix are still preliminary, we were able to detect
organisms in a milk matrix with reasonable sensitivity. Further work is needed to improve
recovery of pathogen DNA from such matrices and improve the sensitivity. Ultimately the
findings of this study will contribute to an effective means of identifying high impact
pathogenic agents in human food supply systems before the agents reach the consumer.
Acknowledgments
This work was supported by the U.S. Department of Homeland Security through NCFPD grant to WA (Award
Number 2007-ST-061-000003). We thank Dr Karl Klose, who provided us the Francisella DNA, and BEI
Resources for Francisella and Yersinia DNA. Research in TS lab is supported by NIH grant SC2138178. In part this
research was supported by the Center for Biomedical Research Grant # 5G12RR003059-22 from the National
Center for Research Resources (NCRR), a part of the NIH, and the CVMNA endowment fund NIH Grant # 2 S21
MD 000102. The views and conclusions contained in this document are those of the authors and should not be
interpreted as necessarily representing the official policies, either expressed or implied, of the U.S. Department of
Homeland Security.
Woubit et al. Page 8
J Food Prot. Author manuscript; available in PMC 2013 April 01.
$watermark-text$watermark-text$watermark-text
References
Benoit PW, Donahue DW. Methods for rapid separation and concentration of bacteria in food that
bypass time-consuming cultural enrichment. J Food Prot. 2003; 66:1935–1948. [PubMed:
14572237]
Busta, FF.; Shaun, PK. Defending the safety of the global food system from intentional contamination
in a changing market. In: Hefnawy, M., editor. Advances in Food Protection [Focus on Food Safety
and Food Defense. (Security and Safety against Terrorist Threats and Natural Disasters) NATO/SPS
Advanced Research Workshop Proceedings] NATO Science for Peace and Security Series A:
Chemistry and Biology. New York: Springer Publishing; 2011. p. 119-135.
Dwivedi HP, Jaykus LA. Detection of pathogens in foods: the current state-of-the-art and future
directions. Crit Rev Microbiol. 2011; 37:40–63. [PubMed: 20925593]
Edwards MC, Gibbs RA. Multiplex PCR: advantages, development, and applications. PCR Methods
Appl. 1994; 3:S65–S75. [PubMed: 8173510]
Fukushima H, Kawase J, Etoh Y, Sugama K, Yashiro S, Iida N, Yamaguchi K. Simultaneous
Screening of 24 Target Genes of Foodborne Pathogens in 35 Foodborne Outbreaks Using Multiplex
Real-Time SYBR Green PCR Analysis. Int J Microbiol. 2010; 2010
He Q, Marjamaki M, Soini H, Mertsola J, Viljanen MK. Primers are decisive for sensitivity of PCR.
Biotechniques. 1994; 17:82–84. 86–87. [PubMed: 7946322]
Jin Q, Yuan Z, Xu J, Wang Y, Shen Y, Lu W, Wang J, Liu H, Yang J, Yang F, Zhang X, Zhang J,
Yang G, Wu H, Qu D, Dong J, Sun L, Xue Y, Zhao A, Gao Y, Zhu J, Kan B, Ding K, Chen S,
Cheng H, Yao Z, He B, Chen R, Ma D, Qiang B, Wen Y, Hou Y, Yu J. Genome sequence of
Shigella flexneri 2a: insights into pathogenicity through comparison with genomes of Escherichia
coli K12 and O157. Nucleic Acids Res. 2002; 30:4432–4441. [PubMed: 12384590]
Jothikumar N, Griffiths MW. Rapid detection of Escherichia coli O157:H7 with multiplex real-time
PCR assays. Appl Environ Microbiol. 2002; 68:3169–3171. [PubMed: 12039787]
Kennedy S. Epidemiology. Why can't we test our way to absolute food safety? Science. 2008;
322:1641–1643. [PubMed: 19074334]
Lantz PG, Abu al-Soud W, Knutsson R, Hahn-Hagerdal B, Radstrom P. Biotechnical use of
polymerase chain reaction for microbiological analysis of biological samples. Biotechnol Annu
Rev. 2000; 5:87–130. [PubMed: 10874998]
Mark Eppinger MJ, Rosovitz, Fricke WF, Rasko DA, Kokorina G, Fayolle C, Lindler LE, Carniel E,
Ravel J. The Complete Genome Sequence of Yersinia pseudotuberculosis IP31758, the causative
agent of Far East Scarlet-Like Fever. PLoS Genetics. 2007; 3:1508–1523.
Markoulatos P, Siafakas N, Moncany M. Multiplex polymerase chain reaction: a practical approach. J
Clin Lab Anal. 2002; 16:47–51. [PubMed: 11835531]
McKillip JL, Drake M. Real-time nucleic acid-based detection methods for pathogenic bacteria in
food. J Food Prot. 2004; 67:823–832. [PubMed: 15083739]
Mercanoglu Taban B, Ben U, Aytac SA. Rapid detection of Salmonella in milk by combined
immunomagnetic separation-polymerase chain reaction assay. J Dairy Sci. 2009; 92:2382–2388.
[PubMed: 19447970]
Ogura Y, Ooka T, Iguchi A, Toh H, Asadulghani M, Oshima K, Kodama T, Abe H, Nakayama K,
Kurokawa K, Tobe T, Hattori M, Hayashi T. Comparative genomics reveal the mechanism of the
parallel evolution of O157 and non-O157 enterohemorrhagic Escherichia coli. Proc Natl Acad Sci
U S A. 2009; 106:17939–17944. [PubMed: 19815525]
Pohanka M, Skladal P. Bacillus anthracis, Francisella tularensis and Yersinia pestis. The most
important bacterial warfare agents - review. Folia Microbiol (Praha). 2009; 54:263–272. [PubMed:
19826916]
Pupo GM, Lan R, Reeves PR. Multiple independent origins of Shigella clones of Escherichia coli and
convergent evolution of many of their characteristics. Proc Natl Acad Sci U S A. 2000; 97:10567–
10572. [PubMed: 10954745]
Reid SD, Herbelin CJ, Bumbaugh AC, Selander RK, Whittam TS. Parallel evolution of virulence in
pathogenic Escherichia coli. Nature. 2000; 406:64–67. [PubMed: 10894541]
Woubit et al. Page 9
J Food Prot. Author manuscript; available in PMC 2013 April 01.
$watermark-text$watermark-text$watermark-text
Sellek R, Jimenez O, Aizpurua C, Fernandez-Frutos B, De Leon P, Camacho M, Fernandez-Moreira
D, Ybarra C, Carlos Cabria J. Recovery of Francisella tularensis from soil samples by filtration
and detection by real-time PCR and cELISA. J Environ Monit. 2008; 10:362–369. [PubMed:
18392279]
Skottman T, Piiparinen H, Hyytiainen H, Myllys V, Skurnik M, Nikkari S. Simultaneous real-time
PCR detection of Bacillus anthracis, Francisella tularensis and Yersinia pestis. Eur J Clin
Microbiol Infect Dis. 2007; 26:207–211. [PubMed: 17294160]
Sobel J, Khan AS, Swerdlow DL. Threat of a biological terrorist attack on the US food supply: the
CDC perspective. Lancet. 2002; 359:874–880. [PubMed: 11897303]
Song L, Ahn S, Walt DR. Detecting biological warfare agents. Emerg Infect Dis. 2005; 11:1629–1632.
[PubMed: 16318712]
Song Y, Tong Z, Wang J, Wang L, Guo Z, Han Y, Zhang J, Pei D, Zhou D, Qin H, Pang X, Zhai J, Li
M, Cui B, Qi Z, Jin L, Dai R, Chen F, Li S, Ye C, Du Z, Lin W, Yu J, Yang H, Huang P, Yang R.
Complete genome sequence of Yersinia pestis strain 91001, an isolate avirulent to humans. DNA
Res. 2004; 11:179–197. [PubMed: 15368893]
Svensson K, Back E, Eliasson H, Berglund L, Granberg M, Karlsson L, Larsson P, Forsman M,
Johansson A. Landscape epidemiology of tularemia outbreaks in Sweden. Emerg Infect Dis. 2009;
15:1937–1947. [PubMed: 19961673]
Taha EG, Mohammed A, Srivastava KK, Reddy PG. Rapid Detection of Salmonella in chicken meat
using Immunomagnetic separation, CHROMagar, ELISA and Real time polymerase chain reaction
(RT-PCR). International Journal of Poultry Science. 2010; 9:831–835.
Versage JL, Severin DD, Chu MC, Petersen JM. Development of a multitarget real-time TaqMan PCR
assay for enhanced detection of Francisella tularensis in complex specimens. J Clin Microbiol.
2003; 41:5492–5499. [PubMed: 14662930]
Wilson WJ, Erler AM, Nasarabadi SL, Skowronski EW, Imbro PM. A multiplexed PCR-coupled
liquid bead array for the simultaneous detection of four biothreat agents. Mol Cell Probes. 2005;
19:137–144. [PubMed: 15680215]
Wright PA, Wynford-Thomas D. The polymerase chain reaction: miracle or mirage? A critical review
of its uses and limitations in diagnosis and research. J Pathol. 1990; 162:99–117. [PubMed:
2250198]
Zhou D, Tong Z, Song Y, Han Y, Pei D, Pang X, Zhai J, Li M, Cui B, Qi Z, Jin L, Dai R, Du Z, Wang
J, Guo Z, Huang P, Yang R. Genetics of metabolic variations between Yersinia pestis biovars and
the proposal of a new biovar, microtus. J Bacteriol. 2004; 186:5147–5152. [PubMed: 15262951]
Woubit et al. Page 10
J Food Prot. Author manuscript; available in PMC 2013 April 01.
$watermark-text$watermark-text$watermark-text
Fig. 1.
Specific in silico validation performed using our primers 1a. Pre-validation of ST1-F-m-2/
R-m-2 primers for S. enterica ssp. enterica s. Typhi 1. S. enterica subsp. enterica s.
Typhimurium LT2, 2. S. enterica ssp. enterica s. Typhi, 3. S. enterica subsp. enterica s.
Typhi Ty2, 4. S. enterica subsp. enterica s. Paratyphi A str. ATCC 9150, 5. S. enterica
subsp. enterica s. Choleraesuis str. SC-B67, 6. S. enterica subsp. enterica s. Paratyphi B str.
SPB7, 7. S. enterica subsp. arizonae s. 62:z4, z23:--8. S. enterica subsp. enterica s. Newport
str. SL254, 9. S. enterica subsp. enterica s. Heidelberg str. SL476, 10. S. enterica subsp.
enterica s. Schwarzengrund str. CVM19633, 11. S. enterica subsp. enterica s. Agona str.
SL483, 12. S. enterica subsp. enterica s. Paratyphi A str. AKU_12601, 13. S. enterica subsp.
enterica s. Dublin str. CT_02021853, 14. S. enterica subsp. enterica s. Gallinarum str.
287/91, 15. S. enterica subsp. enterica s. Enteritidis str. P125109, 16. S. enterica subsp.
enterica s. Paratyphi C strain RKS4594; 1b. Pre-validation of FT1-F/R, primers for F.
tularensis ssp. tularensis, 1- Francisella tularensis subsp. tularensis Schu4, 2 - Francisella
tularensis subsp. holarctica, 3 - Francisella tularensis subsp. tularensis FSC 198, 4 -
Francisella tularensis subsp. holarctica OSU18, 5 - Francisella tularensis subsp. novicida
U112, 6 - Francisella tularensis subsp. tularensis WY96-3418, 7 - Francisella tularensis
subsp. holarctica FTNF002-00, 8 - Francisella philomiragia subsp. philomiragia ATCC
25017, 9 - Francisella tularensis subsp. mediasiatica FSC147
Woubit et al. Page 11
J Food Prot. Author manuscript; available in PMC 2013 April 01.
$watermark-text$watermark-text$watermark-text
Fig. 2.
(A and B). Validation of the specificity of the primers by conventional PCR and gel
electrophoresis to detect biothreat agents (A) and major foodborne pathogens (B): A. a.
detection of E. coli O157:H7 using the EC2 primers and a genus inclusive primer (right
panel) b. detection Francisella using F. tularensis ssp tularensis (FT2, left panel) and genus
inclusive primers (F. tularensis and F. novicida shown in the right panel); c. detection of
Shigella using S. dysentriae primers (ShD1, left panel) and genus inclusive (S. dysentriae
and S. sonnei shown in the right panel) primers d. detection of Salmonella using the ST2
primers for Salmonella typhimurium (left panel) and genus-inclusive primers (S. typhi, S.
typhimurium, S. saintpaul, and S. braenderup shown in the right panel); e. detection of V.
cholerae using VC1 primers (left panel) and Vibrio genus inclusive primers (V. cholerae, V.
parahemolyticus, and V. vulnificus (right panel); f. detection of Yersinia using YP1 primers
for Y. pestis (left panel) or genus inclusive primers (three different Y. pestis strains, two Y.
pseudotuberculosis strains, and Y. enterocolitica (right panel)). B. Validation of specificity
of primers to major foodborne pathogens: a. detection of Shigella sonnei using rhs-y-
Sonnei-F/R, b. detection of Salmonella enterica ssp. enterica serovar Typhimurium using
STM-F-M/R-M, c. detection of Vibrio parahemolyticus using VpH1-F/R, d. Salmonella
enterica ssp. enterica serovar Saintpaul using SS2-F-n/R-n; e. Francisella tularensis ssp
novicida using FN2-F-m/R-m; and f. Yersinia pseudotuberculosis using YPs1-F-M/R.
Woubit et al. Page 12
J Food Prot. Author manuscript; available in PMC 2013 April 01.
$watermark-text$watermark-text$watermark-text
Fig. 3.
Validation of the specificity of the primers against DNA from 23 foodborne pathogens and
related bacterial species (listed in table 2) by real-time PCR: Detected were a. E. coli (left
panel 0157:H7, right panel 0157:H7, HB101, and ATCC 1175 strains with genus-inclusive
primers) b. Shigella (left panel S. dysentriae, middle panel S. sonnei, right panel S.
dysentriae and S. sonnei with genus inclusive primers) c. Francisella (right panel F.
tularensis ssp tularensis, middle panel two strains of F. tularensis ssp. novicida, and right
panel all Francisella with genus inclusive primers) d. Salmonella (panels from left to right:
1st S. typhi, 2nd S. enterica ssp enterica s. Saintpaul, 3rd S. enterica ssp enterica s.
Typhimurium, 4th all Salmonella with genus inclusive primers, e. Vibrio (left panel V.
cholerae, middle panel V. parahemolyticus, right panel all Vibrios with genus inclusive
Woubit et al. Page 13
J Food Prot. Author manuscript; available in PMC 2013 April 01.
$watermark-text$watermark-text$watermark-text
primers f. Yersinia (left panel Y. pseudotuberculosis, middle panel Y. pestis, and right panel
all Yersinia with genus inclusive primers). PCRs using genus inclusive primers and those on
multiple strains of the same species e.g. Y. pestis (f) were run separately, and the
amplification plots were merged. The highest number of cycles used for all the plots is 27.
Woubit et al. Page 14
J Food Prot. Author manuscript; available in PMC 2013 April 01.
$watermark-text$watermark-text$watermark-text
Fig. 4.
Sensitivity of the real-time PCR assay to detect six major foodborne pathogens: Aliquots of
DNA from E. coli O157:H7 (a), S. dysentriae (b), F. tularensis ssp. tularensis (c), S. enterica
ssp enterica s. Typhi (d), V. cholerae (e), and Y. pestis (f), were serially five-fold diluted and
analyzed by real-time PCR to determine the lowest detection limit of the assay. At the end of
the 27 cycles of PCR, aliquots of the reactions were also resolved by agarose gel
electrophoresis to examine the PCR products and intensity from each dilution (lower inset
panels).
Woubit et al. Page 15
J Food Prot. Author manuscript; available in PMC 2013 April 01.
$watermark-text$watermark-text$watermark-text
Fig. 5.
Sensitive detection of Shigella dysentriae in milk using real-time PCR assay: Attenuated S.
dysentriae bacteria (7.5 × 108 CFU) were serially 10-fold diluted in milk as described in
materials and methods. Bacteria suspended in each of the 500µl serial dilution volumes were
concentrated, and genomic DNA was isolated. The DNA was detected using ShD1 primers
by real-time PCR. In parallel, bacterial cultures were initiated to determine the CFU of
bacteria in those dilutions. The real time PCR assay was able to detect DNA isolated from at
least 3–30 CFU/500µl (6–60 CFU/ml) of S. dysentriae in milk.
Woubit et al. Page 16
J Food Prot. Author manuscript; available in PMC 2013 April 01.
$watermark-text$watermark-text$watermark-text
$watermark-text$watermark-text$watermark-text
Woubit et al. Page 17
Table 1
List of organisms used in the validation of specific PCR
Species/ Strain
CDC
category Origin
Genus Escherichia
Escherichia coli O157:H7 EDL933 B ATCC
Escherichia coli 1175 ATCC
Genus Francisella
Francisella tularensis ssp. tularensis Schu S4 A Dr. Karl Klose (UTSA, STCEID
Francisella tularensis ssp. novicida U112 Dr. Karl Klose (UTSA, STCEID
Francisella tularensis ssp. novicida KM145
Francisella tularensis ssp. philomiragia ATCC
Genus Salmonella
Salmonella enterica subsp. enterica serovar Braenderup ATCC (®BAA-664™) ATCC
Salmonella enterica serovar typhimurium LT2 ATCC® (700720D-5™) B ATCC
Salmonella enterica serovar typhi Ty2 ATCC (®700931™) B ATCC
Salmonella enterica subspecies enterica serovar Saintpaul 127 ATCC (®9712™) B ATCC
Genus Shigella
Shigella dysentriae ATCC (®11456a™) B ATCC
Shigella sonnei ATCC (®11060™) B ATCC
Genus Vibrio
Vibrio cholerae ATCC (®39315™) B ATCC
Vibrio parahaemolyticus EB 101 ATCC (®17802™) ATCC
Vibrio vulnificus Type strain Bio-group 1 ATCC (®27562™) ATCC
Genus Yersinia
Yersinia pestis A1122 BEI (NR-15) A
Yersinia pestis KIM10+ BEI (NR-642) A BEI
Yersinia pestis ZE 94–2111 A ATCC
Yersinia pseudotuberculosis P62 ATCC (29910) B BEI (NR-804)
Yersinia pseudotuberculosis NCTC 10275 ATCC (29833) B ATCC
Yersinia enterocolitica Billups-1803-68 ATCC (23715) BEI (NR-204)
Yersinia enterocolitica WA ATCC (27729) ATCC
J Food Prot. Author manuscript; available in PMC 2013 April 01.
$watermark-text$watermark-text$watermark-text
Woubit et al. Page 18
Table2
PrimersusedtoestablishPCRtodetectfoodthreatandmajorfoodbornebacterialpathogens.Theprimerswereusedforbothconventionalandreal-time
PCRmethodsestablishedinthisstudy.Alltheprimersexceptthoseindicatedinthefootnotebelowthetable,werenewlydesigned.
PrimerNameSequence5`–3`BacterialspeciesTargetgene
Gene
AccessionNo.
Amplicon
Size
EC2-SLT-R-m
EC2-SLT-F-m
CAGACGAAGATGGTCAAAACGCG
AGTTTACGATAGACTTTTCGACCC
EscherichiacoliO157:H7EDL933Stx2NP_286976201bp
EC1-Rm
EC1-Fm
TCTGGTTGACTCTCTTCATTCACGG
TACAGAGAGAATTTCGTCAGGCACTG
EscherichiacoliO157:H7strEC4115Stx2AYP_002271797256bp
lacY-ecoli-F
lacY-ecoli-R
GCACTTCAAACTGGCTGGTAATA
TGCACCTACGATGTTTTTGACC
EscherichiacoliCFT073lacYNP_752393331bp
FT1-F
FT1-R
GAAGGTCTTCTAGAAAATTCTGCTC
TTGCTGGTAATTCGTAGATAATATC
Francisellatularensissubsp.tularensisSchu4PdpD2YP_170620345bp
FT2-mR
FT2-mF
GGAAGCATAGCTATTAGCATATTCTGG
TTGTCTAAAGCAAATATTGAGTGGG
Francisellatularensissubsp.tularensisSchu4HPYP_169554234bp
FN2-F-m
FN2-R-m
ATGCAAAAGATAAGGCTAACTCTT
GAATCAATATTCGTTAGGTCTTCA
Francisellatularensissubsp.novicidaU112PdpDYP_898955214bp
AllF-R-m
AllF-F-m
GGAACACCGTARTTGTTAGCTTGG
ATTGGTATCTGTGCTCACGTTGATG
Francisellatularensissubsp.holarcticaOSU18fusAYP_762892371bp
ShD1-F
ShD1-R
ATGGTGTCGTCGATAATATCGGCC
AAGAGCGTATCTGGAGTATTTCACC
ShigelladysenteriaeSd197Z5694-likeproteinYP_405526270bp
ShD2-F-m
ShD2-R-m
GTGATGGTTTGTTAGATTCTACCAA
ATGCAATTGCCAATAGACAACCA
ShigelladysenteriaeSd197HPYP_402814231bp
rhsA-y-Sonnei-F
rhsA-y-Sonnei-R
TATTGCTGCGGTCATACACTGCC
CTGATCGAACTTCGATGCCAATCC
ShigellasonneiSs046rhsAYP_309648303bp
ipaH-F
ipaH-R
CACAGTGCCTCTGCGGAGCTTCG
GAGAGTTCTGACTTTATCCCG
ShigellasonneiSs046ipaHYP_310220234bp
Inv-F
Inv-R
TCAAGAATAGAGCGAATTTCATCC
TGCTTTTTATCGATTCCATGACCC
Salmonellaentericasubsp.entericaserovar
TyphimuriumLT2
invCNP_461815235bp
ST1-F-m-2
ST1-R-m2
ATGACCTTTGCAGCTATCGAGTAA
AACGAGAGGACGTAATCGCGAA
Salmonellaentericasubsp.entericaserovarTyphi
Ty2
cIphageimmunityrepressorproteinNP_808111319bp
†Typhi-vipR-ST2-F
†Typhi-vipR-ST2-R
GGTTTCATCATTTCTGGCCTCC
CTGCTCCGTCAAGATCTTTTCACC
Salmonellaentericasubsp.entericaserovarTyphi
Ty2
tviAVINP_807946335bp
STM1-F-M
STM1-R-M
CAGATTCATCCATCAAAAAAATGGG
GCTAATGCGGCTCTGAACCTGTG
Salmonellaentericasubsp.entericaserovar
TyphimuriumLT2
IMPNP_463357229bp
STM2-R-M
STM2-F-M
GACATTCTACGTAACCAGCTTGCT
TGAGCGTTCACCCATGGCTAACTGTT
Salmonellaentericasubsp.entericaserovar
TyphimuriumLT2
DNArepairATPaseNP_463355189bp
SS2-F-n
SS2-R-n
GGGAGTGGTTAAAGCAACCGTGTCA
TCACAGACTCTTCGGTCCATTCCTT
Salmonellaentericasubsp.entericaserovar
SaintpaulSARA23
RloFZP_03165416312bp
J Food Prot. Author manuscript; available in PMC 2013 April 01.
$watermark-text$watermark-text$watermark-text
Woubit et al. Page 19
PrimerNameSequence5`–3`BacterialspeciesTargetgene
Gene
AccessionNo.
Amplicon
Size
VC1-pho-F
VC1-pho-R
AAGGTTTATCAGTATTAGTCGTGTG
TTGCTGGACTGGGTTGACCATAGGG
VibriocholeraeM66-2chromosomeIphosphotyrosineproteinphosphataseYP_002809642212bp
VC2-B-tox-R
VC2-B-tox-F
CCTCAGGGTATCCTTCATCCTTTC
CTTCAGCATATGCACATGGAACACC
VibriocholeraeO1biovarElTorstr.N16961EnterotoxinsubunitBNP_231099239bp
VpH1-F
VpH1-R
GGCGTCGTCTTCTAAATACTGTTC
ATGAAACACCATGCACAAACTTCT
VibrioparahaemolyticusRIMD2210633thermostablehemolysindelta-VPHNP_798108249bp
VpH2-F
VpH2-R
CTTTTTAAGAGCGGCAGATATCA
ATGACTGCGACTAACTTATTCGTC
VibrioparahaemolyticusRIMD2210633thrANP_796873105bp
All-Vibrio-rpoBF
All-Vibrio-rpoBR
TGGACATTCCATACCTGCTATCG
ACCACGGATTTGACATTCTTTA
VibriovulnificusYJ016rpoBNP_935952203bp
YP1-F-m2
YP1-R-m2
CCAGCTATTATAGCAAATAGTAAGGG
CAGTGTTTGCATTTAATGGCTT
YersiniapestisstrainCO92Putativephage-relatedmembraneproteinYPO2127206bp
YP2-R-M3
YP2-F-M2
ATTGCCGTTCGGGTCTTTCC
GGCAATCAACAATACAGCCGTT
YersiniapestisstrainCO92HPYP_002347092241bp
YPs1-F-M
YPs1-R
AGCAATGTGTCTGAACTTTCTTCA
CATATTGCCGTCACCGACTACACC
YersiniapseudotuberculosisIP32953HPYP_070722348bp
YPs2-R
YPs2-F
CAGGCAACGCTGAGTATTAGGT
CTGCTGATGTTGCCATTAGTATGG
YersiniapseudotuberculosisIP32953HPYP_070711288bp
wzzR
wzzF
TCATCTAAAGCACCAACGAAYACC
TATTTGTTGCTCGCAAAGTTGCC
YersiniapseudotuberculosisIP32953rfeYP_068715211bp
†
TheseprimerswereslightlymodifiedbyremovingGfromthe3'endoftheforwardprimerandCTfromthe5'endfrompublishedsequences(Jinetal.2008)
RloF=putativeproteinofunknownfunction
IMP:Innermembraneprotein
HP:Hypotheticalprotein
J Food Prot. Author manuscript; available in PMC 2013 April 01.

More Related Content

PDF
2015_Pava-Ripoll-Etal_JOVE
PDF
2013-Pierce-Accurate Detection and Quantification of the Fish Viral(2)
PDF
Genome Sequencing: FAO's relevant activities in Animal Health
 
PDF
Applications of Whole Genome Sequencing (WGS) to Food Safety – Perspective fr...
DOCX
Hartman CV 2015
PDF
Doctors Data Inc A Revolution in the Evaluation of Gastrointestinal Microflora
PDF
Modes of action and resistance mechanisms of commonly used antibioticsa
2015_Pava-Ripoll-Etal_JOVE
2013-Pierce-Accurate Detection and Quantification of the Fish Viral(2)
Genome Sequencing: FAO's relevant activities in Animal Health
 
Applications of Whole Genome Sequencing (WGS) to Food Safety – Perspective fr...
Hartman CV 2015
Doctors Data Inc A Revolution in the Evaluation of Gastrointestinal Microflora
Modes of action and resistance mechanisms of commonly used antibioticsa

What's hot (19)

PPTX
2014 SaBio info and activity
PDF
Capstone Senior Design - Rapid Detection of Foodborne Pathogens in Poultry
PDF
Causes of Mortality in Two Commercial Turkey Strains Raised Concurrently Unde...
PDF
Bacterial Orchitis and Epididymo-orchitis in Broiler Breeders
PDF
AASV2016_finalposter
PDF
Nhat_Ho._NSF_REU_Proposal_6-2010
PDF
Study of virulence genes in vancomycin resistant Enterococci (vre) from anima...
PDF
2011 populations genetics gypb
PPT
Seminario Biología Molecular
PDF
New developments in vaccines against African swine fever
PDF
ncomms10165
PDF
RT ppr
PDF
2012_PavaRipollEtal_PrevalenceRelativeRiskCronobacterSalmonellaListeriaAssoci...
PPTX
Microbial source tracking markers for detection of fecal contamination
PPTX
An overview of ranavirus diagnostics, treatment and management
PDF
Presentation 17 : Preliminary results on genetic resistance to AHPND andWSSV ...
PPTX
Microbial source tracking markers for detection of fecal contamination in env...
PPTX
Whole genome microbiology for Salmonella public health microbiology
PDF
Poster benito SIDiLV BVD/BDV
2014 SaBio info and activity
Capstone Senior Design - Rapid Detection of Foodborne Pathogens in Poultry
Causes of Mortality in Two Commercial Turkey Strains Raised Concurrently Unde...
Bacterial Orchitis and Epididymo-orchitis in Broiler Breeders
AASV2016_finalposter
Nhat_Ho._NSF_REU_Proposal_6-2010
Study of virulence genes in vancomycin resistant Enterococci (vre) from anima...
2011 populations genetics gypb
Seminario Biología Molecular
New developments in vaccines against African swine fever
ncomms10165
RT ppr
2012_PavaRipollEtal_PrevalenceRelativeRiskCronobacterSalmonellaListeriaAssoci...
Microbial source tracking markers for detection of fecal contamination
An overview of ranavirus diagnostics, treatment and management
Presentation 17 : Preliminary results on genetic resistance to AHPND andWSSV ...
Microbial source tracking markers for detection of fecal contamination in env...
Whole genome microbiology for Salmonella public health microbiology
Poster benito SIDiLV BVD/BDV
Ad

Viewers also liked (20)

PPTX
Veganism, cloning and GM food
PPTX
Genetically Modified Foods
PPTX
Genetically modified foods, Labelling
PDF
PDF
HK Labelling of GM Food_2016
ODP
GM food
PDF
PPTX
Food tests
PPTX
Rapid detection systems
PPTX
Applications of pcr in detection of food borne pathogens and gm foods
PPTX
Rapid methods for detection of Food-borne Pathogens.
PPTX
Molecular detection of food borne pathogens-presentation
PPTX
genetically modified food
PPTX
Genetically modified foods powerpoint
PPT
Gmo's ppt.......
PPTX
Genetically Modified Organisms (GMO)
PPTX
Genetically modified food powerpoint
PPTX
Genetically modified crops and food Security..scientific facts
PPTX
Microbiological examination of food
PPT
Veganism, cloning and GM food
Genetically Modified Foods
Genetically modified foods, Labelling
HK Labelling of GM Food_2016
GM food
Food tests
Rapid detection systems
Applications of pcr in detection of food borne pathogens and gm foods
Rapid methods for detection of Food-borne Pathogens.
Molecular detection of food borne pathogens-presentation
genetically modified food
Genetically modified foods powerpoint
Gmo's ppt.......
Genetically Modified Organisms (GMO)
Genetically modified food powerpoint
Genetically modified crops and food Security..scientific facts
Microbiological examination of food
Ad

Similar to Simultaneous, specific and real time detection of biothreat and frequently encountered food-borne pathogens (2012) (20)

PDF
BMC microbiol_10(1)_314
PDF
Wielinga_2010_IJFM_145_S137-S144
PPTX
Methods Guide for Microbial Whole-Genome Sequencing.pptx
PDF
Resume farkas t
PPT
4-3LabOverview_slides , laboratory diagnosis (1).ppt
PDF
Customizable pcr microplate array for differential identification of multiple...
PDF
Complete abstract book astmh atlanta 2012-usa
PDF
PIIS2210909915000661
PDF
Enterococcal infectionsresistance and antimicrobial in a tertiary care hospit...
PPTX
Rapid detection of food borne pathogens and its recent advancementa
PDF
Farm Animals Diseases Recent Omic Trends And New Strategies Of Treatment Rosa...
PDF
The Human Virome Methods and Protocols Andrés Moya
PDF
2016 Poster Sessions Show Guide
PDF
The Human Virome Methods and Protocols Andrés Moya
PPTX
A comparative study on uroculturome antimicrobial susceptibility in apparentl...
PDF
Study of virulence genes in vancomycin resistant Enterococci (vre) from anima...
DOC
My CV_final
PPTX
recent development in culture od Cestode
PDF
Immunization with sars coronavirus vaccines leads to pulmonary immunopathology
PDF
2015_PavaRipollEtal_IngestedSalmonellaCronobacterEColiListeriaTransmissionDyn...
BMC microbiol_10(1)_314
Wielinga_2010_IJFM_145_S137-S144
Methods Guide for Microbial Whole-Genome Sequencing.pptx
Resume farkas t
4-3LabOverview_slides , laboratory diagnosis (1).ppt
Customizable pcr microplate array for differential identification of multiple...
Complete abstract book astmh atlanta 2012-usa
PIIS2210909915000661
Enterococcal infectionsresistance and antimicrobial in a tertiary care hospit...
Rapid detection of food borne pathogens and its recent advancementa
Farm Animals Diseases Recent Omic Trends And New Strategies Of Treatment Rosa...
The Human Virome Methods and Protocols Andrés Moya
2016 Poster Sessions Show Guide
The Human Virome Methods and Protocols Andrés Moya
A comparative study on uroculturome antimicrobial susceptibility in apparentl...
Study of virulence genes in vancomycin resistant Enterococci (vre) from anima...
My CV_final
recent development in culture od Cestode
Immunization with sars coronavirus vaccines leads to pulmonary immunopathology
2015_PavaRipollEtal_IngestedSalmonellaCronobacterEColiListeriaTransmissionDyn...

More from Tiensae Teshome (8)

PDF
A cd36 synthetic peptide inhibits bleomycin induced pulmonary inflammation an...
PDF
Early growth response gene 1 mediated apoptosis is essential for transforming...
PDF
Real time pcr assay for rapid detection and quantification of campylobacter j...
PDF
The flavonoid quercetin transientyly inhibits the activity of taxol and nocod...
PDF
Ruta graveolens extract induces dna damage pathways and blocks akt activation...
PDF
Effects of orange juice p h on survival, urease activity and dna profiles of ...
PDF
Activation of rat alveolar macrophage derived latent transforming growth fact...
PDF
Dr. Teshome Yehualaeshet CV
A cd36 synthetic peptide inhibits bleomycin induced pulmonary inflammation an...
Early growth response gene 1 mediated apoptosis is essential for transforming...
Real time pcr assay for rapid detection and quantification of campylobacter j...
The flavonoid quercetin transientyly inhibits the activity of taxol and nocod...
Ruta graveolens extract induces dna damage pathways and blocks akt activation...
Effects of orange juice p h on survival, urease activity and dna profiles of ...
Activation of rat alveolar macrophage derived latent transforming growth fact...
Dr. Teshome Yehualaeshet CV

Recently uploaded (20)

PDF
CHAPTER 3 Cell Structures and Their Functions Lecture Outline.pdf
PPT
The World of Physical Science, • Labs: Safety Simulation, Measurement Practice
PPTX
2Systematics of Living Organisms t-.pptx
PPTX
ANEMIA WITH LEUKOPENIA MDS 07_25.pptx htggtftgt fredrctvg
PPTX
ECG_Course_Presentation د.محمد صقران ppt
PPT
POSITIONING IN OPERATION THEATRE ROOM.ppt
PPTX
Vitamins & Minerals: Complete Guide to Functions, Food Sources, Deficiency Si...
PDF
An interstellar mission to test astrophysical black holes
PDF
HPLC-PPT.docx high performance liquid chromatography
PPTX
The KM-GBF monitoring framework – status & key messages.pptx
PPTX
Microbiology with diagram medical studies .pptx
PDF
ELS_Q1_Module-11_Formation-of-Rock-Layers_v2.pdf
PDF
Cosmic Outliers: Low-spin Halos Explain the Abundance, Compactness, and Redsh...
PPTX
Introduction to Cardiovascular system_structure and functions-1
PPT
protein biochemistry.ppt for university classes
PDF
Assessment of environmental effects of quarrying in Kitengela subcountyof Kaj...
PDF
lecture 2026 of Sjogren's syndrome l .pdf
PPTX
INTRODUCTION TO EVS | Concept of sustainability
PPTX
Classification Systems_TAXONOMY_SCIENCE8.pptx
PDF
Looking into the jet cone of the neutrino-associated very high-energy blazar ...
CHAPTER 3 Cell Structures and Their Functions Lecture Outline.pdf
The World of Physical Science, • Labs: Safety Simulation, Measurement Practice
2Systematics of Living Organisms t-.pptx
ANEMIA WITH LEUKOPENIA MDS 07_25.pptx htggtftgt fredrctvg
ECG_Course_Presentation د.محمد صقران ppt
POSITIONING IN OPERATION THEATRE ROOM.ppt
Vitamins & Minerals: Complete Guide to Functions, Food Sources, Deficiency Si...
An interstellar mission to test astrophysical black holes
HPLC-PPT.docx high performance liquid chromatography
The KM-GBF monitoring framework – status & key messages.pptx
Microbiology with diagram medical studies .pptx
ELS_Q1_Module-11_Formation-of-Rock-Layers_v2.pdf
Cosmic Outliers: Low-spin Halos Explain the Abundance, Compactness, and Redsh...
Introduction to Cardiovascular system_structure and functions-1
protein biochemistry.ppt for university classes
Assessment of environmental effects of quarrying in Kitengela subcountyof Kaj...
lecture 2026 of Sjogren's syndrome l .pdf
INTRODUCTION TO EVS | Concept of sustainability
Classification Systems_TAXONOMY_SCIENCE8.pptx
Looking into the jet cone of the neutrino-associated very high-energy blazar ...

Simultaneous, specific and real time detection of biothreat and frequently encountered food-borne pathogens (2012)

  • 1. Simultaneous, specific and real-time detection of biothreat and frequently encountered food-borne pathogens Abdela Salah Woubita, Teshome Yehualaesheta, Tsegaye Habtemariamb, and Temesgen Samuela aDepartment of Pathobiology, College of Veterinary Medicine, Nursing and Allied Health, Tuskegee University, AL 36088 bCenter for Computational Epidemiology, Bioinformatics & Risk Analysis, College of Veterinary Medicine, Nursing and Allied Health, Tuskegee University, AL 36088 Abstract The bacterial genera Escherichia, Salmonella, Shigella, Vibrio, Yersinia and Francisella include important food safety and biothreat agents causing food-related and other human illnesses worldwide. We aimed to develop rapid methods with the capability to simultaneously and differentially detect all six pathogens in one run. Our initial experiments to use previously reported sets of primers revealed non-specificity of some of the sequences when tested against a broader array of pathogens, or proved not optimal for simultaneous detection parameters. By extensive mining of the whole genome and protein databases of diverse closely and distantly related bacterial species and strains, we have identified unique genome regions, which we utilized to develop a detection platform. Twelve of the specific genomic targets we have identified to design the primers in F. tularensis ssp. tularensis, F. tularensis ssp. novicida, S. dysentriae, S. typhimurium, V. cholera, Y. pestis, and Y. pseudotuberculosis contained either hypothetical or putative proteins, the functions of which have not been clearly defined. Corresponding primer sets were designed from the target regions for use in real-time PCR assays to detect specific biothreat pathogens at species or strain levels. The primer sets were first tested by in-silico PCR against whole genome sequences of different species, sub-species, or strains and then by in vitro PCR against genomic DNA preparations from 23 strains representing six biothreat agents (E.coli O157:H7 strain EDL 933, Shigella dysentriae, Salmonella typhi, Francisella tularensis ssp. tularensis, Vibrio cholera, and Yersinia pestis) and six foodborne pathogens (Salmonella typhimurium, Salmonella saintpaul, Shigella sonnei, Francisella novicida, Vibrio parahemolytica and Yersinia pseudotuberculosis). Each pathogen was specifically identifiable at the genus and species levels. Sensitivity assays performed using purified DNA showed the lowest detection limit of 640 fg DNA/µl for F. tularensis. A preliminary test done to detect Shigella organisms in a milk matrix showed that 6–60 colony forming units of the bacterium per milliliter of milk could be detected in about an hour. Therefore, we have developed a platform to simultaneously detect foodborne pathogen and biothreat agents specifically and in real-time. Such a platform could enable rapid detection or confirmation of contamination by these agents. Keywords Biothreat agents; PCR; food-borne pathogens 1. Introduction Food-borne pathogens cause millions of clinical illnesses every year and cost billions of dollars to manage and control. Intentional contamination of food in the form of a biological attack is an even more alarming prospect given that no standards or established routines NIH Public Access Author Manuscript J Food Prot. Author manuscript; available in PMC 2013 April 01. Published in final edited form as: J Food Prot. 2012 April ; 75(4): 660–670. doi:10.4315/0362-028X.JFP-11-480. $watermark-text$watermark-text$watermark-text
  • 2. exist to test food for these threats (Kennedy, 2008). Intentional contamination could involve among many food products, contamination of water, milk, and other beverages that are distributed from bulk storage or processing sites, not necessarily at the source of the starting product. This has the potential to result in disastrous and far-reaching effects, including direct morbidity and/or mortality, disruption of food distribution, loss of consumer confidence in government and the food supply, business failures, trade restrictions, and ripple effects on the economy (Busta and Shaun, 2011). Therefore, from both food safety and biothreat points of view, it is imperative that food and drink contaminations are detected well before they reach the consumer level. In the past decades the Polymerase Chain Reaction (PCR) has been transformed into a powerful tool to detect pathogens with extremely high sensitivity and specificity. While the main drawback of PCR still remains to be the inability to distinguish between live and dead organisms, the potential for non-specific detection could also be high if the target sequences are not specific or of contamination of the reactions or rooms occur (He et al., 1994; Lantz et al., 2000; Wright and Wynford-Thomas, 1990). Moreover, biological sample preparation strategies are needed to remove non-specific inhibitors. Multiplexing the PCR for the detection of multiple pathogens or targets is currently employed to enable the testing of samples for multiple pathogens in a single run. Several multiplex or simultaneous PCR systems for the detection of food-borne and other infectious pathogens are also being developed (Fukushima et al., 2010; Jothikumar and Griffiths, 2002; Skottman et al., 2007; Wilson et al., 2005). Despite the advantages, when multiplexing PCR, optimal reaction conditions for the multiple sets of primers have to be identified for all the potential targets to be detected (Markoulatos et al., 2002; McKillip and Drake, 2004). Pathogenic bacteria of the genera Escherichia, Shigella, Francisella, Salmonella, Vibrio and Yersinia contain species or strains that are considered biothreat agents that, if intentionally introduced into the food supply system, could result in high morbidities, mortalities and severe economic losses. These bacteria therefore constitute organisms of interest in food defense strategies against potential bioterrorism. Molecular diagnostic techniques for the detection of the individual genera or a combination of some of these agents have been developed by various research groups (Pohanka and Skladal, 2009; Song et al., 2005; Versage et al., 2003). However, the progress towards a rapid, fully multiplexed, sensitive and specific real-time PCR platform for the detection of all the six agents is not yet satisfactory. In an attempt to establish a molecular detection platform amenable to real-time PCR, we first tested several previously reported PCR-primers for their validity for the detection of a wide range of pathogenic and non-pathogenic, as well as related or-unrelated species or strains. While some of the primers or gene targets reported in the literature were further used for our real-time assays, in silico validation of many of the primers against a wide array of bacterial genomes revealed cross reactivity or amplicon sizes not compatible with simultaneous real-time PCR detection of multiple pathogens. Therefore, we utilized whole- genome data mining, text-mining, in silico target and amplicon analysis, and in vitro validation using DNA sequences from representative bacteria. We have identified very specific molecular targets for reliable identification of the six food biothreat agents, and developed a platform with simultaneous detection capability. Interestingly, many of targets we identified have putative functions or code for hypothetical proteins, digressing from the traditional use of previously known gene targets or known pathogenicity-associated molecular detection tools. Woubit et al. Page 2 J Food Prot. Author manuscript; available in PMC 2013 April 01. $watermark-text$watermark-text$watermark-text
  • 3. 2. Materials and Methods 2.1. Bacterial species and DNA preparation for PCR The bacterial strains used in this study are listed in Table 1. Laboratory level 2 organisms consisted of Shigella dysentriae, Shigella sonnei, and Salmonella enterica ssp. enterica serovar Saintpaul were grown aerobically at 37°C on tryptic soy agar supplemented with 5 % horse blood and tryptic soy broth, the exceptions to this is Vibrio vulnificus, which was grown at 30°C. One ml of culture was collected by centrifugation at 10,000-× g, and pellet re-suspended in sterile 1XPBS solution. DNA was extracted according to the manufacturer’s protocol recommended for bacterial DNA extraction (Wizard genomic DNA purification kit, Promega). Genomic DNAs of strains, F. tularensis subspecies novicida KM145 and Y. pestis ZE 94–2122 were obtained from Biodefense and Emerging Infections Research Resources Repository (BEI Resources). Genomic DNAs of all organisms listed on Table 1, except for F. tularensis subspecies novicida strain U112 and F. tularensis subspecies tularensis strain Schu S4, were purchased from ATCC collection (Manassas, VA). The genomic DNA of the two Francisella subspecies, F. tularensis subspecies novicida U112 and F. tularensis subspecies tularensis Schu S4 were kindly provided by Dr. Karl Klose, University of Texas at San Antonio (UTSA) STCEID. 2.2. Genomic and expressed gene data mining Completed genome sequence data of all of the select agents, including incomplete genome sequence for S. enterica subsp. enterica serovar Saintpaul strain SARA 23 were retrieved from the NCBI (http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi) microbial genome- sequencing database. Most recently published references of comparative genomics of every select agent were used in target region selection. A BLAST search was used in the selection of specific amino acid sequences of all the organisms used in this study. Specific primers were designed from genes and coding regions specific to the agent of interest. These primers were then analyzed in silico for specific binding across the genome sequence of similar species. For more stringency assessment we used V-NTI Advanced-11 (Invitrogen, USA) for the design and modification of primers having a 3` end similarity with the closely related species. All available whole genome sequence and partial sequences from prokaryote genome database of the NCBI were used for the in silico validation of the specific primers. 2.3. Comparative genomic analysis In search for a specific region, a BLAST analysis was performed for all the species containing a coding sequence of > 500 aa. Further COBALT alignment analysis was used to localize more specific regions for species under question. Once the specific amino acid sequence was localized, we used the nucleotide sequence of this sequence for specific primer design. 2.4. Primer design and preliminary analysis The primers underwent rigorous testing before the experimental validation. This included oligo-dimer, hair-loop formation and successful standardization of all primers to similar melting temperatures, which is one of the requirements for the simultaneous use of these primers. Primers fulfilling the required criteria were further analyzed for possible binding to a different location within the same whole genome sequence using V-NTI motif search analysis. 2.5. In silico PCR In silico PCR validations were performed using both http://insilico.ehu.es/PCR/ and V-NTI. Only primers giving specific amplifications were selected for further validation using Woubit et al. Page 3 J Food Prot. Author manuscript; available in PMC 2013 April 01. $watermark-text$watermark-text$watermark-text
  • 4. conventional and real time PCR assay. Primers that showed the most specificity to the target molecule were ordered from Integrated DNA technologies (IDT, IA). 2.6. In vitro PCR and analysis All PCR reactions were set up in an isolated PCR station (AirClean Systems, NC) that was UV-sanitized daily and after each use. Initial conventional PCR was performed to validate the specificity of the primers for respective organisms. DNA from 23 strains representing major biothreat agents and closely related foodborne pathogens were used for the validation (Table 1). Single target PCR was performed in a 25 µl final volume containing 0.2 µM of forward and reverse primers, 12.5 µl of Pwo Master mix containing 1.25 U of Pwo enzyme, 2 mM MgCl2 and 0.2 mM dNTPs (Roche Diagnostics, Mannheim Germany). The PCR amplification profile for this initial assay consists of 10 min at 95 °C, followed by 30 cycles of 15 seconds at 95 °C, 15 seconds at 60 °C, and 15 seconds at 72 °C using Master cycler pro (Eppendorf, Humburg, Germany). Presences of single band were analyzed using gel electrophoresis. 2.7. Real-time PCR Real time PCR assay was performed using Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies) for final validation & verification. A specific amplification was obtained with all the primers used to amplify the respective organisms. A reaction volume of 20 µl containing 500 nM of forward and reverse primers, 10 µl of 2X Brilliant III Ultra-Fast SYBER Green master mix, 0.3 µl ROX reference dye, 1 µl of DNA template, nuclease free H2O added to the final volume was used for the real-time PCR. Cycling conditions consisted of one cycle of segment 1, 2 min at 95 °C; followed by 27 cycles of segment 2, 10 seconds at 95 °C, 30 seconds at 60 °C; completed by one melting curve cycle of 1 min at 95 °C, 30 seconds at 65 °C, and 30 seconds at 95°C. 2.8. Sensitivity assay Sensitivity of the real-time PCR assay was determined by five-fold serial dilution of the DNA samples (initial DNA concentrations were 2.5 ng/µl for E. coli O157:H7 strain EDL933, 2 ng/µl for Francisella tularensis, 2.6 ng/µl for Shigella dysentriae, 3.7 ng/µl for Salmonella typhi, 3 ng/µl Vibrio cholerae and 3.8 ng/µl for Yersina pestis) in nuclease free double distilled H2O from each of the bacterial species. One microliter of each of the DNA dilutions were used in real time PCR assay mixture. The assay was performed as described above. 2.9. Sensitivity assay in food Matrix Milk (450 µl) was inoculated with 7.5 × 108 CFU of Shigella dysentriae (attenuated strain) culture suspension and diluted serially up to 10−8. After the dilution, bacteria in each aliquot were immediately concentrated by centrifugation at 12,000 RPM (13,400 × g) for 2 min. Whole genomic DNA was extracted from all of the serially diluted tubes according to the PrepMan Ultra Sample Preparation protocol (Applied Biosystems, CA). The DNA was detected using ShD1 primers by real-time PCR. In parallel, bacterial cultures were initiated to determine the CFU of bacteria in those dilutions. 3. Results 3.1. Bacterial Species, Design of primers and in silico validation The list of strains of bacterial species included in this study to establish the PCR detections is given in Table 1. DNA from these organisms were either purchased or donated through specific agreements. Initially, we aimed at developing a simultaneous foodborne pathogen Woubit et al. Page 4 J Food Prot. Author manuscript; available in PMC 2013 April 01. $watermark-text$watermark-text$watermark-text
  • 5. detection platform using published primer sequences. Some of the sequences were found to be not highly specific when tested against a wide array of organisms in silico. Others were not suitable for simultaneous or multiplex detection of the pathogens in the current study. Therefore, we designed an entirely new set of primers or modified the existing sequences to develop our detection system. To this end, we used text mining, genomic data mining, sequence analysis and comparison tools. Specific primers Typhi-vipR-ST2-F and R were adapted from the work done by Jin et al. (2008) modified by removing G from the 3'end of the forward primer and CT from the 5'end. The list of primers designed or used in this study is shown in Table 2. During the process of selection, the primers were initially validated for unique site recognition and strength of complementarities by using the genomic DNA of each organism as a template. After the primers were designed, we tested the specificity of the primers by performing virtual (in silico) PCR using the publicly accessible tool at http://insilico.ehu.es/PCR/. Examples of pre-validation in silico PCR are shown in Fig. 1. Additionally, we further tested the strength of complementarities and the uniqueness of the binding sites for each primer using the Vector NTI software package (Invitrogen, Carlsbad, CA). Reference genomic DNA sequences of each of the organisms to be detected were uploaded to the program and the designed primers were run along the entire genomic sequence. Validated primers with 100% complementary binding at a unique site were selected for each organism. These primers were in turn tested for cross reactivity with other genomic DNA sequences, especially against those phylogenetically closely related bacteria. 3.2. Conventional PCR and gel electrophoresis analysis for the specificity of the primers Following in silico analysis and validation, we tested the primers using DNA isolated from strains of species of the foodborne pathogens. Each PCR experiment was designed so that the primers are tested against their template DNA and DNA from the maximum number of closely related species. In parallel, genus inclusive primers were designed and PCR was performed to verify that the target species as well as other members of the genus could be detected. Genus inclusive primers gave an additional quality control to minimize cross reactivity with other genera or species within the genus. PCR products were resolved on 1.5 % agarose gels; the gels were stained with GelRed (Biotium, Hayward, CA) and photographed using AlphaImager (Cell Biosciences, Santa Clara, CA). As shown in Fig. 2, our species-specific primers gave very specific detection that discriminated each of the target species, whereas the genus-inclusive primers distinctively identified other members of the genus simultaneously with the target. Therefore, these conventional PCR data provided strong evidence that the primers were very specific, and yielded products of the expected size under the experimental conditions employed. Only a minor cross reactivity of the Escherichia genus specific primers with Vibrio cholera was noticed in this assay. However, the size of the product was larger than expected and also the intensity of the band was weak. 3.3. Validation of the detection of foodborne bacterial pathogens DNA by real-time PCR The conventional PCR method was employed as described above to visualize the PCR products and determine the specificity of our detection. However, as conventional PCR is time consuming and labor intensive, it is not practical to use it for the detection of pathogens in a high throughput platform. Therefore, we wanted to determine the suitability of our primers and the PCR system in a real-time setup. PCR conditions were selected so that a species-specific primer was used to detect DNA from target and other bacteria arrayed on 96-well plates. The average amount of DNA concentration used per well was 2 ng/µl. On the array, one well was designated for DNA from one bacterial species or strain. While DNA was added to the designated wells, a primer solution was aliquoted to all the 23 wells on the array corresponding the different species listed on Table 1. A positive curve was expected to Woubit et al. Page 5 J Food Prot. Author manuscript; available in PMC 2013 April 01. $watermark-text$watermark-text$watermark-text
  • 6. be generated only from the wells containing primers and the target DNA in the same well. In a parallel array of 23 wells, genus-inclusive primers were also aliquoted to all the wells containing DNA from the target species as well as other bacteria, including members of the genus. Positive curves were anticipated only from wells designated to the members of the same genus. As shown in Fig. 3, single curves were generated with all of the primers we tested. Since we did not multiplex the PCR, the multiple curves shown in Fig. 3 were generated by merging data from the corresponding single curves originating from parallel simultaneous detection of different strains of the same species. 3.4. Evaluation of the sensitivity of real-time PCR for the detection of DNA from foodborne pathogens To evaluate the sensitivity of our real-time assay, we serially diluted 1:5 the DNA from each of the major pathogen and performed real-time PCR detection on each of the dilutions. One microliters of each of the dilution was used in a 20 µl total PCR reaction volume and the PCR was run for 27 amplification cycles. At the end of the run, 4 µl aliquots from each of the wells were resolved on a 2 % agarose gel and visualized by GelRed staining (Biotium®). As shown in Fig. 4, the sensitivity of the assay was variable between the organisms used; e.g., starting with 3.8 µg/µl DNA, a 230 fg/µl dilution was detectable for Y. pestis DNA while 640 fg/µl of diluted F. tularensis DNA was reliably detected for both species at threshold cycles below 27. The overall detection range varied between 234 fg/µl (Y. pestis) and 1.18 pg/µl (S. typhimurium). The gel electrophoregrams also showed generation of bands of the correct size as well as visible limits of the serial dilution under conditions of the experiment. Therefore, under these conditions, we were able to achieve a high sensitivity of detection combined with the high specificity described above. 3.5. Evaluation of the application of the real-time PCR detection for bacteria in food matrix Finally, to preliminarily evaluate if our real-time detection approach would be compatible with DNA isolated from bacteria in a food matrix, we spiked commercially available skimmed milk with 7.5×108 attenuated S. dysentriae bacteria (ATCC) and serially diluted 1:10 the suspension in a total of 500 µl volumes. Immediately after the serial dilution, tubes were centrifuged to concentrate the bacteria and total DNA was isolated as described in materials and methods. Parallel cultures were also initiated from each dilution to count colony-forming units. As shown in Fig. 5, we were able to detect DNA isolated from milk spiked with Shigella organisms with an approximate detection limit of 6–60 colony forming units per ml of milk in less than one hour of experiment time. 4. Discussion We have developed a PCR-based real-time detection platform for simultaneous, rapid, sensitive and differential molecular detection of six primary biothreat agents, namely, Escherichia, Salmonella, Shigella, Vibrio, Yersinia and Francisella. Through extensive genomic data mining, text mining and multiple layer validation, we have identified 26 new target sequences (Table 2), which enabled us to design the platform with improved specificity. Some of these targets have a well-known functions such as stx2A (shiga toxin subunit A from E. coli O157:H7), fusA (Elongation factor A from F. tularensis ssp. tularensis), ipaH (invasive plasmid antigen from Shigella species), invC (invasion protein from Salmonella species), rpoB (DNA-directed RNA polymerase subunit beta, from Vibrio species). However, others have hitherto unknown functions such as in RloF gene from S. enterica ssp. enterica s. Saintpaul with putative functions, or hypothetical proteins such as pdpD (pathogenicity determinant protein D from F. tularensis ssp. tularensis). Moreover, we preliminarily evaluated the utility of the platform using milk as a food matrix into which Shigella organisms were spiked. Woubit et al. Page 6 J Food Prot. Author manuscript; available in PMC 2013 April 01. $watermark-text$watermark-text$watermark-text
  • 7. One of the known challenges in multiplexed or simultaneous PCR-based molecular detections is the need for optimization of the reaction conditions such as annealing temperatures optimal for all primer sets, avoiding primer dimers, generation of compatible amplicon sizes, and adjustment for different amplification efficiencies (Edwards and Gibbs, 1994). In this study, we have identified PCR conditions that are suitable for the amplification of 105 bp to 371 bp fragments from all the six pathogens under the same reaction conditions. Moreover, the specificities of the primers were tested and validated against a broad array of potential biothreat agents and related species or strains, which do not pose threat. For example, the Francisella tularensis ssp tularensis detection primers used in this study, designed from a hypothetical protein gene pdpD2, were tested against four other strains, Francisella subspecies (holartica, novicida, and mediasiatica) and the closely related F. philomiragia ssp philomiragia, and showed reactivity only to the F. tularensis ssp tularensis. On the other hand, F. tularensis ssp novicida primers based on another gene for hypothetical protein pdpD were specific to the subspecies, without detecting any of the other F. tularensis subspecies. Despite the degree of specificity we achieved with these primers, our E. coli O157:H7 primers EC1 and EC2 still in-silico cross detected the non-O157 E. coli such as O111 and O103, strains that evolved parallel to the O157 strain (Ogura et al., 2009). However, since such non-O157 strains also possess pathogenic potential (Reid et al., 2000), the ability of our primers to detect non-O157 strains may be a desirable feature in the investigation of E. coli outbreaks. Because of their close evolutionary relationship, differentiation of Escherichia from Shigella species poses a big challenge (Jin et al., 2002; Pupo et al., 2000). In our study, even challenging was the distinction among Shigella species, especially Shigella sonnei from other members of the genus. After extensive comparative genome analysis, we identified the gene for rhsA protein in rhs element as target for the specific identification of S. sonnei. Similarly, Salmonella enterica ssp enterica s. typhimurium was identifiable by targets in the genes for putative inner membrane protein and putative DNA repair ATPase. On the other hand, while Vibrio parahemolyticus was identifiable using the hemolysin gene VP1729, Vibrio cholerae was identifiable using the gene for phosphotyrosine protein phosphatase VC0916 as a target. Our primers based on the genes for putative phage-related membrane protein (YPO2127) and the hypothetical protein YpAngola A2197 were able to detect all Y. pestis strains except the biovar Microtus strain 91001. Lack of identification of this organism using our present assay would not be a major problem since there has been so far no evidence that human plaque can arise from Microtus strains (Zhou et al., 2004). Furthermore subcutaneous inoculation of strains from serovar Microtus has demonstrated no virulence (Song et al., 2004). The genes for YPTS_2284 and YPTB2194 hypothetical proteins were also specific targets for the identification of Y. pseudotuberculosis isolates. These two regions were selected from a set of 67 refined species-specific genes (Mark Eppinger et al., 2007). While the targeting of hypothetical proteins for detection of the bacteria may not directly correlate with the hitherto known pathogenicity or virulence of the organisms, genetic studies may reveal the significance of these gene products in bacterial biology or host interaction, or even pathogenicity. The identification of these genomic regions as specific to the particular species or even sub species is an important step in advancing pathogen detection techniques by providing additional targets. We were able to verify our in silico results by in vitro differential identifications under identical PCR conditions. In previous studies other groups had also developed multiplexed PCR assays to simultaneously detect multiple food borne pathogens (Fukushima et al., 2010; Jothikumar and Griffiths, 2002; Skottman et al., 2007; Wilson et al., 2005). While our approach is similar in some aspects, for the first time we have combined into one assay the Woubit et al. Page 7 J Food Prot. Author manuscript; available in PMC 2013 April 01. $watermark-text$watermark-text$watermark-text
  • 8. detection of primary biothreat agents of bioterrorism potential, and identified highly specific targets capable of discriminating a broad range of pathogens or related bacteria. In this study, we did not multiplex the primers or DNA in a single tube. With added future improvements for even more rapid differential detection and multiplexing capabilities, our assay platform provides a strong foundation to strengthen national and international food defense strategies as a promising component of primary detection or confirmatory platforms. Through this study, we also have designed highly specific primers that yielded PCR assays with high sensitivity and low detection limits. For example to the detection limit for F. tularensis in this study are comparable to or better than some other reports (Sellek et al., 2008; Svensson et al., 2009), although different sources of DNA and procedures of detection may influence the detection limits. Food matrices provide a critical challenge in amplification-based pathogen detection approaches. Improved pre-analytical sample processing techniques are needed to reduce the time needed to arrive at diagnosis and decision-making (Benoit and Donahue, 2003; Dwivedi and Jaykus, 2011). Previous studies have shown immunomagnetic separation method to provide better concentration of bacteria from food matrices such as chicken meat (Taha et al., 2010). In milk, a combination of the two techniques, i.e. immunomagnetic separation and polymerase chain reaction, provided a detection of 1–10 CFU of salmonellae/ ml, after a selective pre-enrichment incubation of 12–16 hrs. However, a decreased sensitivity of 10–100 CFU/ml was observed after 8–10 h of pre-enrichment period (Mercanoglu Taban et al., 2009). In this study we have performed a preliminary test to evaluate the use of real-time PCR for detection of S. dysentriae spiked in milk. Using centrifugation to concentrate the bacteria serially diluted in milk, we were able to detect about 6–60 CFU/ml of milk matrix, without an enrichment step. According to CDC, 10–100 organisms of S. dysentriae are considered the minimum infectious dose with possible secondary transmission (Sobel et al., 2002). Caution is needed in correlating the CFU findings with PCR detection limits, because in general, PCR does not discriminate between live and dead organisms. Therefore, any correlation between our DNA detection limit and the observed CFU per dilution may not be direct. For example, if there is a time lapse between sample collection and PCR analysis, the CFU could underestimate the degree of contamination of the food matrix. Alternatively, sterilized products containing non-viable bacteria or their DNA may still yield positive data. Although our studies using food matrix are still preliminary, we were able to detect organisms in a milk matrix with reasonable sensitivity. Further work is needed to improve recovery of pathogen DNA from such matrices and improve the sensitivity. Ultimately the findings of this study will contribute to an effective means of identifying high impact pathogenic agents in human food supply systems before the agents reach the consumer. Acknowledgments This work was supported by the U.S. Department of Homeland Security through NCFPD grant to WA (Award Number 2007-ST-061-000003). We thank Dr Karl Klose, who provided us the Francisella DNA, and BEI Resources for Francisella and Yersinia DNA. Research in TS lab is supported by NIH grant SC2138178. In part this research was supported by the Center for Biomedical Research Grant # 5G12RR003059-22 from the National Center for Research Resources (NCRR), a part of the NIH, and the CVMNA endowment fund NIH Grant # 2 S21 MD 000102. The views and conclusions contained in this document are those of the authors and should not be interpreted as necessarily representing the official policies, either expressed or implied, of the U.S. Department of Homeland Security. Woubit et al. Page 8 J Food Prot. Author manuscript; available in PMC 2013 April 01. $watermark-text$watermark-text$watermark-text
  • 9. References Benoit PW, Donahue DW. Methods for rapid separation and concentration of bacteria in food that bypass time-consuming cultural enrichment. J Food Prot. 2003; 66:1935–1948. [PubMed: 14572237] Busta, FF.; Shaun, PK. Defending the safety of the global food system from intentional contamination in a changing market. In: Hefnawy, M., editor. Advances in Food Protection [Focus on Food Safety and Food Defense. (Security and Safety against Terrorist Threats and Natural Disasters) NATO/SPS Advanced Research Workshop Proceedings] NATO Science for Peace and Security Series A: Chemistry and Biology. New York: Springer Publishing; 2011. p. 119-135. Dwivedi HP, Jaykus LA. Detection of pathogens in foods: the current state-of-the-art and future directions. Crit Rev Microbiol. 2011; 37:40–63. [PubMed: 20925593] Edwards MC, Gibbs RA. Multiplex PCR: advantages, development, and applications. PCR Methods Appl. 1994; 3:S65–S75. [PubMed: 8173510] Fukushima H, Kawase J, Etoh Y, Sugama K, Yashiro S, Iida N, Yamaguchi K. Simultaneous Screening of 24 Target Genes of Foodborne Pathogens in 35 Foodborne Outbreaks Using Multiplex Real-Time SYBR Green PCR Analysis. Int J Microbiol. 2010; 2010 He Q, Marjamaki M, Soini H, Mertsola J, Viljanen MK. Primers are decisive for sensitivity of PCR. Biotechniques. 1994; 17:82–84. 86–87. [PubMed: 7946322] Jin Q, Yuan Z, Xu J, Wang Y, Shen Y, Lu W, Wang J, Liu H, Yang J, Yang F, Zhang X, Zhang J, Yang G, Wu H, Qu D, Dong J, Sun L, Xue Y, Zhao A, Gao Y, Zhu J, Kan B, Ding K, Chen S, Cheng H, Yao Z, He B, Chen R, Ma D, Qiang B, Wen Y, Hou Y, Yu J. Genome sequence of Shigella flexneri 2a: insights into pathogenicity through comparison with genomes of Escherichia coli K12 and O157. Nucleic Acids Res. 2002; 30:4432–4441. [PubMed: 12384590] Jothikumar N, Griffiths MW. Rapid detection of Escherichia coli O157:H7 with multiplex real-time PCR assays. Appl Environ Microbiol. 2002; 68:3169–3171. [PubMed: 12039787] Kennedy S. Epidemiology. Why can't we test our way to absolute food safety? Science. 2008; 322:1641–1643. [PubMed: 19074334] Lantz PG, Abu al-Soud W, Knutsson R, Hahn-Hagerdal B, Radstrom P. Biotechnical use of polymerase chain reaction for microbiological analysis of biological samples. Biotechnol Annu Rev. 2000; 5:87–130. [PubMed: 10874998] Mark Eppinger MJ, Rosovitz, Fricke WF, Rasko DA, Kokorina G, Fayolle C, Lindler LE, Carniel E, Ravel J. The Complete Genome Sequence of Yersinia pseudotuberculosis IP31758, the causative agent of Far East Scarlet-Like Fever. PLoS Genetics. 2007; 3:1508–1523. Markoulatos P, Siafakas N, Moncany M. Multiplex polymerase chain reaction: a practical approach. J Clin Lab Anal. 2002; 16:47–51. [PubMed: 11835531] McKillip JL, Drake M. Real-time nucleic acid-based detection methods for pathogenic bacteria in food. J Food Prot. 2004; 67:823–832. [PubMed: 15083739] Mercanoglu Taban B, Ben U, Aytac SA. Rapid detection of Salmonella in milk by combined immunomagnetic separation-polymerase chain reaction assay. J Dairy Sci. 2009; 92:2382–2388. [PubMed: 19447970] Ogura Y, Ooka T, Iguchi A, Toh H, Asadulghani M, Oshima K, Kodama T, Abe H, Nakayama K, Kurokawa K, Tobe T, Hattori M, Hayashi T. Comparative genomics reveal the mechanism of the parallel evolution of O157 and non-O157 enterohemorrhagic Escherichia coli. Proc Natl Acad Sci U S A. 2009; 106:17939–17944. [PubMed: 19815525] Pohanka M, Skladal P. Bacillus anthracis, Francisella tularensis and Yersinia pestis. The most important bacterial warfare agents - review. Folia Microbiol (Praha). 2009; 54:263–272. [PubMed: 19826916] Pupo GM, Lan R, Reeves PR. Multiple independent origins of Shigella clones of Escherichia coli and convergent evolution of many of their characteristics. Proc Natl Acad Sci U S A. 2000; 97:10567– 10572. [PubMed: 10954745] Reid SD, Herbelin CJ, Bumbaugh AC, Selander RK, Whittam TS. Parallel evolution of virulence in pathogenic Escherichia coli. Nature. 2000; 406:64–67. [PubMed: 10894541] Woubit et al. Page 9 J Food Prot. Author manuscript; available in PMC 2013 April 01. $watermark-text$watermark-text$watermark-text
  • 10. Sellek R, Jimenez O, Aizpurua C, Fernandez-Frutos B, De Leon P, Camacho M, Fernandez-Moreira D, Ybarra C, Carlos Cabria J. Recovery of Francisella tularensis from soil samples by filtration and detection by real-time PCR and cELISA. J Environ Monit. 2008; 10:362–369. [PubMed: 18392279] Skottman T, Piiparinen H, Hyytiainen H, Myllys V, Skurnik M, Nikkari S. Simultaneous real-time PCR detection of Bacillus anthracis, Francisella tularensis and Yersinia pestis. Eur J Clin Microbiol Infect Dis. 2007; 26:207–211. [PubMed: 17294160] Sobel J, Khan AS, Swerdlow DL. Threat of a biological terrorist attack on the US food supply: the CDC perspective. Lancet. 2002; 359:874–880. [PubMed: 11897303] Song L, Ahn S, Walt DR. Detecting biological warfare agents. Emerg Infect Dis. 2005; 11:1629–1632. [PubMed: 16318712] Song Y, Tong Z, Wang J, Wang L, Guo Z, Han Y, Zhang J, Pei D, Zhou D, Qin H, Pang X, Zhai J, Li M, Cui B, Qi Z, Jin L, Dai R, Chen F, Li S, Ye C, Du Z, Lin W, Yu J, Yang H, Huang P, Yang R. Complete genome sequence of Yersinia pestis strain 91001, an isolate avirulent to humans. DNA Res. 2004; 11:179–197. [PubMed: 15368893] Svensson K, Back E, Eliasson H, Berglund L, Granberg M, Karlsson L, Larsson P, Forsman M, Johansson A. Landscape epidemiology of tularemia outbreaks in Sweden. Emerg Infect Dis. 2009; 15:1937–1947. [PubMed: 19961673] Taha EG, Mohammed A, Srivastava KK, Reddy PG. Rapid Detection of Salmonella in chicken meat using Immunomagnetic separation, CHROMagar, ELISA and Real time polymerase chain reaction (RT-PCR). International Journal of Poultry Science. 2010; 9:831–835. Versage JL, Severin DD, Chu MC, Petersen JM. Development of a multitarget real-time TaqMan PCR assay for enhanced detection of Francisella tularensis in complex specimens. J Clin Microbiol. 2003; 41:5492–5499. [PubMed: 14662930] Wilson WJ, Erler AM, Nasarabadi SL, Skowronski EW, Imbro PM. A multiplexed PCR-coupled liquid bead array for the simultaneous detection of four biothreat agents. Mol Cell Probes. 2005; 19:137–144. [PubMed: 15680215] Wright PA, Wynford-Thomas D. The polymerase chain reaction: miracle or mirage? A critical review of its uses and limitations in diagnosis and research. J Pathol. 1990; 162:99–117. [PubMed: 2250198] Zhou D, Tong Z, Song Y, Han Y, Pei D, Pang X, Zhai J, Li M, Cui B, Qi Z, Jin L, Dai R, Du Z, Wang J, Guo Z, Huang P, Yang R. Genetics of metabolic variations between Yersinia pestis biovars and the proposal of a new biovar, microtus. J Bacteriol. 2004; 186:5147–5152. [PubMed: 15262951] Woubit et al. Page 10 J Food Prot. Author manuscript; available in PMC 2013 April 01. $watermark-text$watermark-text$watermark-text
  • 11. Fig. 1. Specific in silico validation performed using our primers 1a. Pre-validation of ST1-F-m-2/ R-m-2 primers for S. enterica ssp. enterica s. Typhi 1. S. enterica subsp. enterica s. Typhimurium LT2, 2. S. enterica ssp. enterica s. Typhi, 3. S. enterica subsp. enterica s. Typhi Ty2, 4. S. enterica subsp. enterica s. Paratyphi A str. ATCC 9150, 5. S. enterica subsp. enterica s. Choleraesuis str. SC-B67, 6. S. enterica subsp. enterica s. Paratyphi B str. SPB7, 7. S. enterica subsp. arizonae s. 62:z4, z23:--8. S. enterica subsp. enterica s. Newport str. SL254, 9. S. enterica subsp. enterica s. Heidelberg str. SL476, 10. S. enterica subsp. enterica s. Schwarzengrund str. CVM19633, 11. S. enterica subsp. enterica s. Agona str. SL483, 12. S. enterica subsp. enterica s. Paratyphi A str. AKU_12601, 13. S. enterica subsp. enterica s. Dublin str. CT_02021853, 14. S. enterica subsp. enterica s. Gallinarum str. 287/91, 15. S. enterica subsp. enterica s. Enteritidis str. P125109, 16. S. enterica subsp. enterica s. Paratyphi C strain RKS4594; 1b. Pre-validation of FT1-F/R, primers for F. tularensis ssp. tularensis, 1- Francisella tularensis subsp. tularensis Schu4, 2 - Francisella tularensis subsp. holarctica, 3 - Francisella tularensis subsp. tularensis FSC 198, 4 - Francisella tularensis subsp. holarctica OSU18, 5 - Francisella tularensis subsp. novicida U112, 6 - Francisella tularensis subsp. tularensis WY96-3418, 7 - Francisella tularensis subsp. holarctica FTNF002-00, 8 - Francisella philomiragia subsp. philomiragia ATCC 25017, 9 - Francisella tularensis subsp. mediasiatica FSC147 Woubit et al. Page 11 J Food Prot. Author manuscript; available in PMC 2013 April 01. $watermark-text$watermark-text$watermark-text
  • 12. Fig. 2. (A and B). Validation of the specificity of the primers by conventional PCR and gel electrophoresis to detect biothreat agents (A) and major foodborne pathogens (B): A. a. detection of E. coli O157:H7 using the EC2 primers and a genus inclusive primer (right panel) b. detection Francisella using F. tularensis ssp tularensis (FT2, left panel) and genus inclusive primers (F. tularensis and F. novicida shown in the right panel); c. detection of Shigella using S. dysentriae primers (ShD1, left panel) and genus inclusive (S. dysentriae and S. sonnei shown in the right panel) primers d. detection of Salmonella using the ST2 primers for Salmonella typhimurium (left panel) and genus-inclusive primers (S. typhi, S. typhimurium, S. saintpaul, and S. braenderup shown in the right panel); e. detection of V. cholerae using VC1 primers (left panel) and Vibrio genus inclusive primers (V. cholerae, V. parahemolyticus, and V. vulnificus (right panel); f. detection of Yersinia using YP1 primers for Y. pestis (left panel) or genus inclusive primers (three different Y. pestis strains, two Y. pseudotuberculosis strains, and Y. enterocolitica (right panel)). B. Validation of specificity of primers to major foodborne pathogens: a. detection of Shigella sonnei using rhs-y- Sonnei-F/R, b. detection of Salmonella enterica ssp. enterica serovar Typhimurium using STM-F-M/R-M, c. detection of Vibrio parahemolyticus using VpH1-F/R, d. Salmonella enterica ssp. enterica serovar Saintpaul using SS2-F-n/R-n; e. Francisella tularensis ssp novicida using FN2-F-m/R-m; and f. Yersinia pseudotuberculosis using YPs1-F-M/R. Woubit et al. Page 12 J Food Prot. Author manuscript; available in PMC 2013 April 01. $watermark-text$watermark-text$watermark-text
  • 13. Fig. 3. Validation of the specificity of the primers against DNA from 23 foodborne pathogens and related bacterial species (listed in table 2) by real-time PCR: Detected were a. E. coli (left panel 0157:H7, right panel 0157:H7, HB101, and ATCC 1175 strains with genus-inclusive primers) b. Shigella (left panel S. dysentriae, middle panel S. sonnei, right panel S. dysentriae and S. sonnei with genus inclusive primers) c. Francisella (right panel F. tularensis ssp tularensis, middle panel two strains of F. tularensis ssp. novicida, and right panel all Francisella with genus inclusive primers) d. Salmonella (panels from left to right: 1st S. typhi, 2nd S. enterica ssp enterica s. Saintpaul, 3rd S. enterica ssp enterica s. Typhimurium, 4th all Salmonella with genus inclusive primers, e. Vibrio (left panel V. cholerae, middle panel V. parahemolyticus, right panel all Vibrios with genus inclusive Woubit et al. Page 13 J Food Prot. Author manuscript; available in PMC 2013 April 01. $watermark-text$watermark-text$watermark-text
  • 14. primers f. Yersinia (left panel Y. pseudotuberculosis, middle panel Y. pestis, and right panel all Yersinia with genus inclusive primers). PCRs using genus inclusive primers and those on multiple strains of the same species e.g. Y. pestis (f) were run separately, and the amplification plots were merged. The highest number of cycles used for all the plots is 27. Woubit et al. Page 14 J Food Prot. Author manuscript; available in PMC 2013 April 01. $watermark-text$watermark-text$watermark-text
  • 15. Fig. 4. Sensitivity of the real-time PCR assay to detect six major foodborne pathogens: Aliquots of DNA from E. coli O157:H7 (a), S. dysentriae (b), F. tularensis ssp. tularensis (c), S. enterica ssp enterica s. Typhi (d), V. cholerae (e), and Y. pestis (f), were serially five-fold diluted and analyzed by real-time PCR to determine the lowest detection limit of the assay. At the end of the 27 cycles of PCR, aliquots of the reactions were also resolved by agarose gel electrophoresis to examine the PCR products and intensity from each dilution (lower inset panels). Woubit et al. Page 15 J Food Prot. Author manuscript; available in PMC 2013 April 01. $watermark-text$watermark-text$watermark-text
  • 16. Fig. 5. Sensitive detection of Shigella dysentriae in milk using real-time PCR assay: Attenuated S. dysentriae bacteria (7.5 × 108 CFU) were serially 10-fold diluted in milk as described in materials and methods. Bacteria suspended in each of the 500µl serial dilution volumes were concentrated, and genomic DNA was isolated. The DNA was detected using ShD1 primers by real-time PCR. In parallel, bacterial cultures were initiated to determine the CFU of bacteria in those dilutions. The real time PCR assay was able to detect DNA isolated from at least 3–30 CFU/500µl (6–60 CFU/ml) of S. dysentriae in milk. Woubit et al. Page 16 J Food Prot. Author manuscript; available in PMC 2013 April 01. $watermark-text$watermark-text$watermark-text
  • 17. $watermark-text$watermark-text$watermark-text Woubit et al. Page 17 Table 1 List of organisms used in the validation of specific PCR Species/ Strain CDC category Origin Genus Escherichia Escherichia coli O157:H7 EDL933 B ATCC Escherichia coli 1175 ATCC Genus Francisella Francisella tularensis ssp. tularensis Schu S4 A Dr. Karl Klose (UTSA, STCEID Francisella tularensis ssp. novicida U112 Dr. Karl Klose (UTSA, STCEID Francisella tularensis ssp. novicida KM145 Francisella tularensis ssp. philomiragia ATCC Genus Salmonella Salmonella enterica subsp. enterica serovar Braenderup ATCC (®BAA-664™) ATCC Salmonella enterica serovar typhimurium LT2 ATCC® (700720D-5™) B ATCC Salmonella enterica serovar typhi Ty2 ATCC (®700931™) B ATCC Salmonella enterica subspecies enterica serovar Saintpaul 127 ATCC (®9712™) B ATCC Genus Shigella Shigella dysentriae ATCC (®11456a™) B ATCC Shigella sonnei ATCC (®11060™) B ATCC Genus Vibrio Vibrio cholerae ATCC (®39315™) B ATCC Vibrio parahaemolyticus EB 101 ATCC (®17802™) ATCC Vibrio vulnificus Type strain Bio-group 1 ATCC (®27562™) ATCC Genus Yersinia Yersinia pestis A1122 BEI (NR-15) A Yersinia pestis KIM10+ BEI (NR-642) A BEI Yersinia pestis ZE 94–2111 A ATCC Yersinia pseudotuberculosis P62 ATCC (29910) B BEI (NR-804) Yersinia pseudotuberculosis NCTC 10275 ATCC (29833) B ATCC Yersinia enterocolitica Billups-1803-68 ATCC (23715) BEI (NR-204) Yersinia enterocolitica WA ATCC (27729) ATCC J Food Prot. Author manuscript; available in PMC 2013 April 01.
  • 18. $watermark-text$watermark-text$watermark-text Woubit et al. Page 18 Table2 PrimersusedtoestablishPCRtodetectfoodthreatandmajorfoodbornebacterialpathogens.Theprimerswereusedforbothconventionalandreal-time PCRmethodsestablishedinthisstudy.Alltheprimersexceptthoseindicatedinthefootnotebelowthetable,werenewlydesigned. PrimerNameSequence5`–3`BacterialspeciesTargetgene Gene AccessionNo. Amplicon Size EC2-SLT-R-m EC2-SLT-F-m CAGACGAAGATGGTCAAAACGCG AGTTTACGATAGACTTTTCGACCC EscherichiacoliO157:H7EDL933Stx2NP_286976201bp EC1-Rm EC1-Fm TCTGGTTGACTCTCTTCATTCACGG TACAGAGAGAATTTCGTCAGGCACTG EscherichiacoliO157:H7strEC4115Stx2AYP_002271797256bp lacY-ecoli-F lacY-ecoli-R GCACTTCAAACTGGCTGGTAATA TGCACCTACGATGTTTTTGACC EscherichiacoliCFT073lacYNP_752393331bp FT1-F FT1-R GAAGGTCTTCTAGAAAATTCTGCTC TTGCTGGTAATTCGTAGATAATATC Francisellatularensissubsp.tularensisSchu4PdpD2YP_170620345bp FT2-mR FT2-mF GGAAGCATAGCTATTAGCATATTCTGG TTGTCTAAAGCAAATATTGAGTGGG Francisellatularensissubsp.tularensisSchu4HPYP_169554234bp FN2-F-m FN2-R-m ATGCAAAAGATAAGGCTAACTCTT GAATCAATATTCGTTAGGTCTTCA Francisellatularensissubsp.novicidaU112PdpDYP_898955214bp AllF-R-m AllF-F-m GGAACACCGTARTTGTTAGCTTGG ATTGGTATCTGTGCTCACGTTGATG Francisellatularensissubsp.holarcticaOSU18fusAYP_762892371bp ShD1-F ShD1-R ATGGTGTCGTCGATAATATCGGCC AAGAGCGTATCTGGAGTATTTCACC ShigelladysenteriaeSd197Z5694-likeproteinYP_405526270bp ShD2-F-m ShD2-R-m GTGATGGTTTGTTAGATTCTACCAA ATGCAATTGCCAATAGACAACCA ShigelladysenteriaeSd197HPYP_402814231bp rhsA-y-Sonnei-F rhsA-y-Sonnei-R TATTGCTGCGGTCATACACTGCC CTGATCGAACTTCGATGCCAATCC ShigellasonneiSs046rhsAYP_309648303bp ipaH-F ipaH-R CACAGTGCCTCTGCGGAGCTTCG GAGAGTTCTGACTTTATCCCG ShigellasonneiSs046ipaHYP_310220234bp Inv-F Inv-R TCAAGAATAGAGCGAATTTCATCC TGCTTTTTATCGATTCCATGACCC Salmonellaentericasubsp.entericaserovar TyphimuriumLT2 invCNP_461815235bp ST1-F-m-2 ST1-R-m2 ATGACCTTTGCAGCTATCGAGTAA AACGAGAGGACGTAATCGCGAA Salmonellaentericasubsp.entericaserovarTyphi Ty2 cIphageimmunityrepressorproteinNP_808111319bp †Typhi-vipR-ST2-F †Typhi-vipR-ST2-R GGTTTCATCATTTCTGGCCTCC CTGCTCCGTCAAGATCTTTTCACC Salmonellaentericasubsp.entericaserovarTyphi Ty2 tviAVINP_807946335bp STM1-F-M STM1-R-M CAGATTCATCCATCAAAAAAATGGG GCTAATGCGGCTCTGAACCTGTG Salmonellaentericasubsp.entericaserovar TyphimuriumLT2 IMPNP_463357229bp STM2-R-M STM2-F-M GACATTCTACGTAACCAGCTTGCT TGAGCGTTCACCCATGGCTAACTGTT Salmonellaentericasubsp.entericaserovar TyphimuriumLT2 DNArepairATPaseNP_463355189bp SS2-F-n SS2-R-n GGGAGTGGTTAAAGCAACCGTGTCA TCACAGACTCTTCGGTCCATTCCTT Salmonellaentericasubsp.entericaserovar SaintpaulSARA23 RloFZP_03165416312bp J Food Prot. Author manuscript; available in PMC 2013 April 01.
  • 19. $watermark-text$watermark-text$watermark-text Woubit et al. Page 19 PrimerNameSequence5`–3`BacterialspeciesTargetgene Gene AccessionNo. Amplicon Size VC1-pho-F VC1-pho-R AAGGTTTATCAGTATTAGTCGTGTG TTGCTGGACTGGGTTGACCATAGGG VibriocholeraeM66-2chromosomeIphosphotyrosineproteinphosphataseYP_002809642212bp VC2-B-tox-R VC2-B-tox-F CCTCAGGGTATCCTTCATCCTTTC CTTCAGCATATGCACATGGAACACC VibriocholeraeO1biovarElTorstr.N16961EnterotoxinsubunitBNP_231099239bp VpH1-F VpH1-R GGCGTCGTCTTCTAAATACTGTTC ATGAAACACCATGCACAAACTTCT VibrioparahaemolyticusRIMD2210633thermostablehemolysindelta-VPHNP_798108249bp VpH2-F VpH2-R CTTTTTAAGAGCGGCAGATATCA ATGACTGCGACTAACTTATTCGTC VibrioparahaemolyticusRIMD2210633thrANP_796873105bp All-Vibrio-rpoBF All-Vibrio-rpoBR TGGACATTCCATACCTGCTATCG ACCACGGATTTGACATTCTTTA VibriovulnificusYJ016rpoBNP_935952203bp YP1-F-m2 YP1-R-m2 CCAGCTATTATAGCAAATAGTAAGGG CAGTGTTTGCATTTAATGGCTT YersiniapestisstrainCO92Putativephage-relatedmembraneproteinYPO2127206bp YP2-R-M3 YP2-F-M2 ATTGCCGTTCGGGTCTTTCC GGCAATCAACAATACAGCCGTT YersiniapestisstrainCO92HPYP_002347092241bp YPs1-F-M YPs1-R AGCAATGTGTCTGAACTTTCTTCA CATATTGCCGTCACCGACTACACC YersiniapseudotuberculosisIP32953HPYP_070722348bp YPs2-R YPs2-F CAGGCAACGCTGAGTATTAGGT CTGCTGATGTTGCCATTAGTATGG YersiniapseudotuberculosisIP32953HPYP_070711288bp wzzR wzzF TCATCTAAAGCACCAACGAAYACC TATTTGTTGCTCGCAAAGTTGCC YersiniapseudotuberculosisIP32953rfeYP_068715211bp † TheseprimerswereslightlymodifiedbyremovingGfromthe3'endoftheforwardprimerandCTfromthe5'endfrompublishedsequences(Jinetal.2008) RloF=putativeproteinofunknownfunction IMP:Innermembraneprotein HP:Hypotheticalprotein J Food Prot. Author manuscript; available in PMC 2013 April 01.