Semiconductor Sequencing Applications for Plant Sciences
1 like1,984 views
The document discusses advancements in ion semiconductor sequencing technologies developed by Life Technologies, specifically the Ion PGMTM and Ion ProtonTM systems. These systems enable rapid genome-scale sequencing with high throughput and simplicity in workflows, catering to genetic research needs. Additionally, it highlights the use of deep candidate resequencing (Dcare) for mapping mutations in plant genetics, as demonstrated by research from the Max Planck Institute.
![2nd Allele of sup3
sup2 mu [W141Stop] 1 msup3[G273E]
14-6-1 m uta tion [W 141S top] 15-4-3 uta tion mu [G273E]
238
At3g63270 cDNA 237
1260 bp
Found a GA change in sup2
coding for a stop codon
sup3
like
F2
sup3♀ sup3♀ sup2♀ sup2♀ sup1♀ sup1♀
X X X X X X 30
F1 sup2♂ sup1♂ sup3♂ sup1♂ sup3♂ sup2♂](https://image.slidesharecdn.com/mappingbysequencingwebinarslide12112012jh-121211143736-phpapp01/85/Semiconductor-Sequencing-Applications-for-Plant-Sciences-30-320.jpg)
Semiconductor Sequencing Applications for Plant Sciences
- 1. Ion PGM™ & Ion Proton™ Systems and Applications November 2012 Visit the Life Technologies website for more information. Life Technologies™ | 1 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
- 2. Ion Torrent Founded in 2007 by Jonathan Rothberg − Pioneered next gen sequencing − Founder of 454, CuraGen, Raindance Acquired by Life Technologies in Jul 2010 Over 250 chemists, molecular biologists, MA engineers, software developers and CA CT bioinformaticists across 5 R&D sites TX First PostLight™ sequencing technology launched in Dec 2010 (Ion PGM™ System) First Postlight™ genome-scale sequencer shipped in Sep 2012 (Ion Proton™ System) Life Technologies™ | 2 2 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
- 3. Direct Detection of Hydrogen Ions and Conversion to an Electrical Signal Read by a Transistor Substrate dNTP H+ ∆ pH ∆Q Sensing Layer Sensor Plate ∆V Bulk Drain Source To column Silicon Substrate receiver Rothberg J.M. et al Nature doi:10.1038/nature10242 Life Technologies™ | 3 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
- 4. Ion Semiconductor Sequencing Systems: PGM™ for Genes. Proton™ for Genomes. Sequencing for All. For more information, visit lifetechnologies.com/ionsequencing Life Technologies™ | 4 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
- 5. Ion PGM™ and OneTouch™ 2 Systems with 3-Series Chips Ion 318™ Chip Ion 316™ Chip Ion 314™ Chip Ion PGM™ Chip Ion User Q20 bases External Performance 314 Rmease 143,516,106 Well Beyond Spec (Ion Community 316 Corebotz 786,016,516 RecogntION Runs) 318 Wtr 1,275,271,258 Life Technologies™ | 5 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
- 6. Ion Proton™ System Bringing Rapid Genome-Scale Sequencing to Every Lab Runs all Ion P-Series chips Benchtop system containing state-of-the-art electronics to support the highest throughput − Dual 8-core Intel® Xeon® Sandy Bridge processors − 128 GB of RAM − Dual Altera® Stratix V FPGAs − NVIDIA® Tesla® C2075 GPU − 11 TB of hybrid (SSD&HDD) storage − Ubuntu® 11.10 operating system Life Technologies™ | 6 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
- 7. Single Day Workflow with the Fastest Sequencing Runs ION LIBRARY PREPARE RUN ANALYZE KITS TEMPLATE SEQUENCE DATA lon Proton™ System Sample to results in a single day lon Xpress'" Plus lon Chef '" System• lon Proton '" Proton'" Torrent Server Fragment Library Kits or Sequencer ion OneTouch'" 2 System Life Technologies™ I 7 lrwllrogen A.!:lpt edBto,pte m G1bc0 Mott'NI.OrPiobH" Novu T qM:III"" Amboon !onTOO"rent hnolog1es The content provided herein may relate to products that have not been officially released and is subject to change without notice.
- 8. Ion PI™ Chip for Whole Exomes/Transcriptomes; Ion PII™ Chip for Whole Genomes Ion PI™ Chip Ion PII™ Chip 165 M wells 660 M wells Up to 10 Gb Exome Up to 20X human genome 60-80M Filtered Reads 240-320M Filtered Reads Up to 200bp reads Up to 200bp reads 2-4 hours Runs in Hours Life Technologies™ | 8 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
- 9. Unprecedented Scalability 10,000-Fold From Ion 314™ to Ion PIII™ Chip Transcriptome Small Genome Small to Large Gene Panels Human Genome Exome 100G Ion PIII™ Ion PII™ Sequence Output per Run 10G Ion PI™ 1G Ion 318™ 100M Ion 316™ 10M Ion 314 from 1.2 Million Sensors …………………to 1.2 Billion Sensors Life Technologies™ | 9 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
- 10. Simple and Complete Workflows Ion PGM™ System Ion Proton™ System Life Technologies™ | 10 10 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
- 11. lon Semiconductor Sequencing: Enabling a Breadth of Applications SEQU£NC ING S1ALL SETS OF G£NE EXPRtSSION WHOLE HUMAN HUMAN APPLICAnONS GENOMES GENES CHIP SEQ TRANSCRIPTOME EXOMES GENOMES SEQUENCNG I OHIPS El PI Pll Life Technologies™ I 11 lrwllrogen A.!:lpt edBto,pte m G1bc0 Mott'NI.OrPiobH" Novu T qM:III"" Amboon !onTOO"rent hnologoes The content provided herein may relate to products that have not been officially released and is subject to change without notice.
- 12. Ion Reporter Software Workflow A secure, hosted informatics infrastructure for routine assays Automated informatics User interpretation Mapped Annotated Confident Relevant Interpretive Reads Variants Reads Variants Variants Variants Report Life Technologies™ | 12 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
- 13. All products mentioned in this presentation are for research use only and not for use in diagnostic procedures. All data shown in this presentation was generated by Life Technologies, except where indicated © 2012 Life Technologies Corporation. All rights reserved. The trademarks mentioned herein are the property of Life Technologies Corporation and/or its affiliate(s) or their respective owners. Life Technologies™ | 13 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
- 14. Fast isogenic mapping-by- sequencing of EMS-induced mutant bulks Franziska Turck Group Max Planck Institute for Plant Breeding Research 14
- 15. Presentation Outline Introduction to technical and biological problem Isogenic mapping approach Fast mapping using deep candidate resequencing (dCARE) with IonPGMTM 15
- 16. Mutations in LHP1/TFL2 alter plant development SD/LD lhp1 lhp1 ft AG SEP3 AP3 WT lhp1 AP1 CD Hinge CSD binds to H3K27me3 16
- 17. LHP1 represses target genes as part of Polycomb Repressive Complex 1 bmi1a; bmi1b BMI1c BMI1b Bratzel et al. (2010) Chen BMI1a et al. (2010), Olmo et al. RING1B (2010), Adrian et al. ? lhp1; ring1a; (2009), Xu and Shen RING1A (2008), Barrero et al. 1b (2007) LHP1 BMI1c ring1a; 1b lhp 17
- 18. Common problems in genetic screens lethality of strong enhancers 11D at 44LDs 16°C + 30LDs Col-0 lhp1 Col-0 lhp1 18-8-2 18-8-2 second allele of lhp1 in Ws can only be used as pollen donor variance between accessions greater than effect of weak enhancers and suppressors 18
- 19. Inverse mapping principle EMS EMS Back-crossing to parental mutants solves all problems due to variation between accessions 19
- 20. Phenotype of sup3 Col-0 sup3 lhp1 36 LDs • Plant size is increased • Rosette leaves, Cauline leaves and siliques are bigger than in lhp1 mutants • Flowers look the same in screening Col-0 sup3 lhp1 Col-0 sup3 lhp1 conditions 36d, 12h light, 16°C/day, 20 Col-0 sup3 lhp1 14°C/ night
- 21. Experimental strategy: Back-cross suppressor 2x to original lhp1 line Pick 270 individuals with suppressor phenotype in the F2 of BC2 Prepare DNA from bulked suppressor mutants Sequence 1 lane on Solexa GAIl or any other high-throughput sequencing device Sequence also original ems mutant lhp1 (bulk of 58) Analyse with SHORE map 21
- 22. Solexa Sequencing and Data Analysis Geo Velikkakam, IMPRS student Cologne Center for Genomics Group Schneeberger MPIPZ Read Statistics SNP Statistics Ref_lhp1 sup3 Homozygous All SNPs SNPs No. raw reads ~ 84 Million ~ 84 Million No. reliable SNPs lhp1 1603 / 273 8497 / 1836 vs Col-0 (all / EMS) No. aligned reads 79.68 Million 78.06 Million No. reliable SNPs Sup3 6/3 2125 / 455 Genomic coverage ~ 49 X ~ 41 X vs lhp1 (all / EMS) SHOREmap 22
- 23. Frequency distribution frequency frequency C hromosome 1 Chromosome 2 Chromosome 3 Parameters: at least 10 reads and a score frequency >10 (values 0-40) Chromosome 4 Chromosome 5 23 Chromosome 3
- 24. 2-3 candidates Chromosome 3 21455 Kb 21456 Kb 22622 Kb 22623 Kb 23376 Kb 23377 Kb Putative causal AT3G57940 AT3G63270 mutations * DNA sequence TCTCTTCTCCTGAAGGTCGCAAGGGAGTTAT CGGGTAACTGATCCCTCCAACAACGTATTCTC TCTCTTCTCCTGAAGATCGCAAGGGAGTTAT CGGGTAACTGATCCCTTCAACAACGTATTCTC CTCTTCTCCTGAAGATCGCAAGGGAGTTAT GGGTAACTGATCCCTTCAACAACGTATTCTC CTCTTCTCCTGAAGATCGCAAGGGAGTTAT GGGTAACTGATCCCTTCAACAACGTATTCTC TCTTCTCCTGAAGATCGCAAGGGAGTTAT GGGTAACTGATCCCTTCAACAACGTATTCTC CTTCTCCTGAAGATCGCAAGGGAGTTAT GTAACTGATCCCTTCAACAACGTATTCTC TTCTCCTGAAGATCGCAAGGGAGTTAT TAACTGATCCCTTCAACAACGTATTCTC TCTCTTCTCCTGAAGATCGCAAGGGAGTTA AACTGATCCCTTCAACAACGTATTCTC TCTCTTCTCCTGAAGATCGCAAGGGAGTT AACTGATCCCTTCAACAACGTATTCTC TCTCTTCTCCTGAAGATCGCAAGGGAGTT CGGGTAACTGATCCCTTCAACAACGTATTCT TCTCTTCTCCTGAAGATCGCAAGGGAGT CGGGTAACTGATCCCTTCAACAACGTATTC TCTCTTCTCCTGAAGATCGCAAGGGAG CGGGTAACTGATCCCTTCAACAACGTATT Protein change G Q I H S L L L K VA R E L Y K Y L N SQGAQIREYVVGGISYPLLP GQI HSLLLK I ARELYKYLN SQGAQIREYVV E GISYPLLP
- 25. Mapping strategy the slow way High resolution melting PCR isolate DNA from single Mapping with 2-3 two markers sup3 plants 25
- 26. Fast mapping using deep Candidate resequening (dCARE) 270 mutants were pooled in initial screen coverage by whole-genome re-sequencing was 40-fold on average Distance between candidate loci was at least 2 Megabases, therefore several recombination events should be present in the pool (average rate in Arabidopsis is 3 centi-Morgan by Megabase) Why not sequence the candidates to greater depths to recover a clear signal from the recombination events? 26
- 27. Deeper coverage results in higher confidence prediction of rare recombination events dCARE distinguishes the causal from closely linked mutations 1.02 1 0.98 Mutation frequency 0.96 0.94 coverage at 40-fold 0.92 at 20000-fold 0.9 0.88 0.86 0.84 AT3G57940 AT3G61130 AT3G63270 27
- 28. Deep candidate resequencing (dCARE) Deep sequencing with Ion PGMTM 314K chip -Relatively small coverage was still sufficient for a limited number of amplicons -Fast, almost overnight results -Easy design of library using extended primers 120-250bp 1-50bp
- 29. Deep candidate resequencing (dCARE) Seq-run Pos SNP Cov A C G T N Cov Freq Cov Freq Cov Freq Cov Freq Cov Freq AT3G57940 A 50 47 0,940 0 0,000 2 0,040 0 0,000 1 0,020 AT3G61130 T 48 0 0,000 2 0,042 0 0,000 44 0,917 2 0,042 Here we Illumina AT3G63270 T 41 0 0,000 1 0,024 0 0,000 39 0,951 1 0,024 have a AT3G57940 A 20111 18966 0,943 0 0 1145 0,057 1 0 0 0 winner 4390 0 0 90 0,02 0 0 4300 0,979 0 0 AT3G61130 T dCARE AT3G63270 T 19203 0 0 86 0,005 0 0 19117 0,996 0 0
- 30. 2nd Allele of sup3 sup2 mu [W141Stop] 1 msup3[G273E] 14-6-1 m uta tion [W 141S top] 15-4-3 uta tion mu [G273E] 238 At3g63270 cDNA 237 1260 bp Found a GA change in sup2 coding for a stop codon sup3 like F2 sup3♀ sup3♀ sup2♀ sup2♀ sup1♀ sup1♀ X X X X X X 30 F1 sup2♂ sup1♂ sup3♂ sup1♂ sup3♂ sup2♂
- 31. Complementation of sup3 and sup2 but not sup1 with 35S:AT3G63270:HA Flowering time of T1 and non-transformed plants in LDs Rosette leaves T1 Rosette leaves Cauline leaves T1 Cauline leaves 25 20 Number of leaves 15 10 5 0 Col-0 lhp1 sup1 sup2 sup3 Col-0 lhp1 sup1 sup2 sup3 Plants 31
- 32. SUP3 enodes a domesticated Harbinger- like transposase Protein blast on NCBI Chose first 100 proteins from all species Chose A.t. proteins with E-value < 0.05 (0.0003) Bootstrapped neighbor joining tree with 10.000 replicates SUP3 does not cluster with “real” transposons 32
- 33. Differential gene expression in lhp1 and sup3 Genes up-regulated compared to Col-0 FDR > 0,05 / logFC > 2 AGL79, MYB18, MYB43, FUL, AGO3, HB21, SPL5, MYB85, HSP70, AP1, AGL44, MYB45 lhp1 (286) sup3 (82) AGL19, STM 252 34 48 SEP1, SEP2, SEP3, AP3, AG, PI, PRR3, FLC 33
- 34. ALP1 – a Trithorax Group protein? Suppresso r ALP1 H3K4me3 adapted from T. Zografou ALP1 LHP1 LHP1 ALP1 Target Gene PRC1 components 34
- 35. Perspectives 3 suppressors (all sequenced and mapped) 16 enhancers (3 sequenced and mapped, 2 worked with dCARE, one worked down to two candidates) One back-cross was sufficient, 100 mutants in the pool was also o.k. Barcoding and pooling of Illumina High-seq re-sequencing with lower coverage was o.k. Safe cost in whole genome sequencing and do dCARE for more candidates 35
- 36. Turck Group: Collaborations: Korbinian Justin Goodrich Theo Zografou Schneeberger Shih Chieh-Liang Liangyu Liu Geo Velikkakam (Edinburgh University) Tingting Ning MPIPZ Petra Tänzler Yue Zhou former members Sara Farrona Jessika Adrian Jian Zhang Benjamin Hartwig Julia Engelhorn Julia Reimer
- 37. Thank you! Visit the Life Technologies website for more information. 37
- 38. Enhancers on plates 15-9-1 / 2 plants in bulk 16-2-1_1 / 1 plant in bulk